ID: 1081929534

View in Genome Browser
Species Human (GRCh38)
Location 11:46859186-46859208
Sequence CTCACGGGGGGGCCTCCTCC GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 143}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081929534_1081929546 28 Left 1081929534 11:46859186-46859208 CCCGGAGGAGGCCCCCCCGTGAG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 1081929546 11:46859237-46859259 CAGCATCATCCCCAGACAGGAGG 0: 1
1: 0
2: 2
3: 20
4: 245
1081929534_1081929542 -5 Left 1081929534 11:46859186-46859208 CCCGGAGGAGGCCCCCCCGTGAG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 1081929542 11:46859204-46859226 GTGAGCTTCGCAGTTGCTTGAGG 0: 1
1: 0
2: 0
3: 5
4: 65
1081929534_1081929545 25 Left 1081929534 11:46859186-46859208 CCCGGAGGAGGCCCCCCCGTGAG 0: 1
1: 0
2: 0
3: 19
4: 143
Right 1081929545 11:46859234-46859256 ACTCAGCATCATCCCCAGACAGG 0: 1
1: 0
2: 0
3: 22
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081929534 Original CRISPR CTCACGGGGGGGCCTCCTCC GGG (reversed) Exonic
900386766 1:2414215-2414237 CTGACGGGAGGGCCTGCTCTAGG + Intergenic
900392925 1:2441573-2441595 GTCACGGTGGGGTTTCCTCCTGG + Intronic
905201571 1:36320241-36320263 CTGGCGTGTGGGCCTCCTCCTGG - Exonic
915724393 1:158007420-158007442 CTCACTGGGCGACCTCCTTCCGG - Intronic
915734944 1:158078661-158078683 TTCACCTGGGGGCCTCCTCCAGG + Intronic
920212048 1:204335416-204335438 CTCCAGGAGGGGCCTTCTCCAGG - Intronic
920398704 1:205663914-205663936 CTCACAGGGGCCCCTCTTCCTGG + Intronic
923087780 1:230714268-230714290 CTCACGCTGGGACCTCTTCCAGG + Exonic
923335945 1:232970309-232970331 CTTATGGGGGGGCCTCCTGACGG + Intronic
1066460501 10:35608442-35608464 CTCTCGGTGGGGCCTGCCCCGGG - Exonic
1069787562 10:70998446-70998468 CAGACGGGGGTCCCTCCTCCAGG + Intergenic
1071573772 10:86711655-86711677 CTCCCCCCGGGGCCTCCTCCGGG + Intronic
1076574004 10:131451942-131451964 CTCTCAGCGGGGCCTCCTCTTGG - Intergenic
1076751429 10:132545415-132545437 CTCACGGAGGGACAGCCTCCAGG + Intronic
1077100535 11:820380-820402 CTCAGCGGGGCTCCTCCTCCGGG - Intronic
1077557190 11:3231402-3231424 CCCACAGGGAGACCTCCTCCAGG - Intronic
1081929534 11:46859186-46859208 CTCACGGGGGGGCCTCCTCCGGG - Exonic
1083258081 11:61508821-61508843 CCCAAGTGGGTGCCTCCTCCCGG + Exonic
1083758443 11:64803305-64803327 GTCCCGCGGGCGCCTCCTCCCGG - Intergenic
1084681835 11:70670822-70670844 TGCACGGAGGGGACTCCTCCTGG + Intronic
1089166180 11:116478256-116478278 CTCACTGGGGGTGCTCTTCCGGG + Intergenic
1100869514 12:98895219-98895241 GGCGCGCGGGGGCCTCCTCCTGG + Intronic
1101829584 12:108246884-108246906 CTCAGGCGGGTGCCTCCTCTGGG - Intronic
1104913426 12:132251531-132251553 CTCTCAGAGGGGACTCCTCCGGG + Intronic
1105704327 13:22960190-22960212 CTCATGAGGGGGCCATCTCCGGG - Intergenic
1105857278 13:24385242-24385264 CTCATGAGGGGGCCATCTCCGGG - Intergenic
1106344617 13:28863563-28863585 CTCACTGGTAAGCCTCCTCCAGG - Intronic
1107994624 13:45848105-45848127 CTCATGAGGGCGCCTGCTCCTGG - Intronic
1108688974 13:52846003-52846025 CTCCCCGGGCGGCCTCCTCCGGG + Exonic
1109537572 13:63739337-63739359 CTCGCGGGGGTGCCTCCCCCAGG + Intergenic
1109546256 13:63840630-63840652 CTCGCGGGGGTGCCTCCCTCAGG - Intergenic
1109547109 13:63844129-63844151 CTCGCGGGGTTGCCTCCCCCAGG - Intergenic
1110892274 13:80707167-80707189 CTCGCGGGGGAGCCTCCGCCCGG - Intergenic
1112494346 13:99893693-99893715 CACACAGAGGGGCCTCCTCAAGG + Exonic
1118610215 14:67533610-67533632 CTCCCGGGGGAGGCTCCTCCTGG - Intronic
1121491843 14:94366662-94366684 CTCATGGGGCGTCCTCCTGCTGG - Intergenic
1122355945 14:101122885-101122907 CTCACTGAAGGGCCTCCACCTGG - Intergenic
1122819067 14:104332205-104332227 CCCAAGGAGAGGCCTCCTCCGGG - Intergenic
1122917925 14:104867322-104867344 CTCACTGGGAGGCAGCCTCCAGG - Intronic
1124434757 15:29637949-29637971 TTCACTGTGGGGCATCCTCCTGG - Intergenic
1128580661 15:68807488-68807510 CTCCAGGCGAGGCCTCCTCCTGG + Intronic
1129191678 15:73941320-73941342 CTCATGGGGGAGCCTGGTCCAGG - Intronic
1129462276 15:75705328-75705350 CTCACGGGGCCACCTCCTCTAGG + Intronic
1129722580 15:77886520-77886542 CTCACGGGGCCACCTCCTCTAGG - Intergenic
1130362888 15:83207460-83207482 CCCGCGGGGGGGCGGCCTCCCGG - Exonic
1132646286 16:1000745-1000767 CACATGGCGGGGGCTCCTCCTGG + Intergenic
1132993283 16:2808499-2808521 CTCACGGGGGAGCAGCCTCAGGG - Intergenic
1133386514 16:5374439-5374461 CTCACAGGGCTCCCTCCTCCTGG - Intergenic
1136254557 16:29029469-29029491 CTCACATGGAGGCCTCCCCCAGG + Intergenic
1139641475 16:68294720-68294742 CTCCCGGGAGGGCCACCTACCGG + Exonic
1142371692 16:89686340-89686362 CTCTCGGTGGGGGGTCCTCCAGG - Intronic
1143411748 17:6713449-6713471 CGCACGGGGGCGCCTCCCCGCGG + Exonic
1143660598 17:8322310-8322332 CTGAAGGGGAGGCCTCGTCCCGG - Exonic
1144778181 17:17795327-17795349 CCCCAGGGGGGTCCTCCTCCTGG - Exonic
1145963802 17:28902860-28902882 CGCACGGCGGGGCCTTCACCAGG + Exonic
1146008389 17:29176690-29176712 CTCCAGGGGGAGCCTCCTCCCGG + Intronic
1146907758 17:36629015-36629037 CACACGGTGGGGCCTCTTCTGGG + Intergenic
1147315394 17:39617897-39617919 CTCCCGGGGCGGCCTCCCCGCGG + Intergenic
1147425289 17:40343259-40343281 CTGGCGGGGGGGCCTTCCCCCGG - Intronic
1147647086 17:42040379-42040401 CTCAGGTGGGGCCCGCCTCCAGG - Intronic
1152072375 17:78140414-78140436 CTCAGGGTGGGGCCTCTACCGGG + Intronic
1152431065 17:80248521-80248543 CTGACCGGGTGGCCTCCACCAGG - Intronic
1152840045 17:82561547-82561569 CTCACAGAGTGGCCACCTCCTGG - Intronic
1153236204 18:2990916-2990938 CCCACACGGGGCCCTCCTCCTGG + Intronic
1155381077 18:25223385-25223407 GCCACAGGGGGGCCTCCGCCAGG + Intronic
1156373252 18:36490063-36490085 ATCACGGTGCTGCCTCCTCCGGG + Intronic
1156373484 18:36491720-36491742 ATCACGGTGCTGCCTCCTCCGGG + Intronic
1158045533 18:53150670-53150692 CTGACGTGGGGGCCTCCTTCAGG - Intronic
1159945424 18:74441277-74441299 GACACTGTGGGGCCTCCTCCGGG + Intronic
1160734012 19:653589-653611 CTCACAGGGCGGACTCCTCATGG + Intronic
1161493492 19:4575385-4575407 CTCTCAGCGGGGCCCCCTCCAGG - Intergenic
1162228388 19:9243904-9243926 CTCACCAGGCTGCCTCCTCCCGG + Intergenic
1162495979 19:11023669-11023691 CTCACGTGGGGGCTTTCTCCAGG + Intronic
1162850610 19:13428536-13428558 CCCACTAGGGGGCCTGCTCCAGG - Intronic
1162915687 19:13873288-13873310 CTCTCGGGGGCGCGTCCTCGGGG + Intronic
1164671739 19:30076367-30076389 CCCACAGGGGAGCCCCCTCCAGG + Intergenic
1164834872 19:31350185-31350207 CCCACGGGCAGGCCCCCTCCAGG + Intergenic
1167264557 19:48477318-48477340 GTCCTGTGGGGGCCTCCTCCAGG + Intronic
1167290800 19:48624411-48624433 CACACGCCGGGTCCTCCTCCAGG - Intronic
1167922275 19:52791782-52791804 CTCGTGGGGGAGGCTCCTCCAGG - Intronic
929983167 2:46699418-46699440 CGCGCGGGGCGGCCTCATCCAGG - Intronic
931244348 2:60480081-60480103 ATCTCAGTGGGGCCTCCTCCCGG - Intronic
932779919 2:74553638-74553660 CTAAGGGAGGGGGCTCCTCCGGG - Intronic
933684909 2:85134433-85134455 CTCACGGTGCGCGCTCCTCCGGG - Exonic
933893270 2:86789829-86789851 CCCACGGGGACGCCTCCCCCCGG + Intronic
935861965 2:107340830-107340852 CTTACTGGTGGGCCTACTCCTGG + Intergenic
936235542 2:110739573-110739595 CTCACTGAGGGGTCTCCTACTGG + Intronic
946051123 2:216863432-216863454 CTCAAGGAAGGGCCTCATCCTGG - Intergenic
947587359 2:231364859-231364881 CTCACGGGGTGGGCTCTGCCAGG - Intronic
947742551 2:232491219-232491241 CACAAGGCAGGGCCTCCTCCTGG + Intergenic
947793475 2:232880468-232880490 CTCCAGGGGAGGCCTTCTCCAGG - Intronic
1171411398 20:24950751-24950773 CTCACAGGGGCCTCTCCTCCTGG + Intronic
1174116328 20:48229053-48229075 CTCACAGCGTGGCCTCCTGCAGG + Intergenic
1174181203 20:48676175-48676197 CTCAGGTGAGGGCCTCCTCAGGG - Exonic
1174402533 20:50283611-50283633 TTCAGGGGGAGGCATCCTCCAGG + Intergenic
1174614951 20:51828568-51828590 CACACTGGGGGGCCGCTTCCAGG + Intergenic
1176121316 20:63455759-63455781 CTCACGGGGCCCCCACCTCCGGG + Intronic
1176170556 20:63694595-63694617 CTCATGGTGGGGACTGCTCCCGG + Intronic
1176311884 21:5154878-5154900 CCCAAGGCGGGGCCTTCTCCGGG + Intergenic
1179724217 21:43332943-43332965 CTCGTGGAGGGGCCTCCTCAAGG + Intergenic
1180214774 21:46317132-46317154 CTCCAGGGGGAGCCACCTCCAGG - Intronic
1180622626 22:17171952-17171974 CTCCAGGGGGCGCCGCCTCCGGG - Intergenic
1180707430 22:17818161-17818183 CTCCCGGGGGGGCCGCATCCAGG + Exonic
1180964554 22:19779889-19779911 CTCACCGTGGTGCCTCCGCCTGG - Intronic
1181396928 22:22629501-22629523 GTCACAGAGGGGCTTCCTCCCGG + Intergenic
1181499675 22:23308860-23308882 GTCACAGAGGGGCTTCCTCCCGG + Intronic
1182103668 22:27674130-27674152 GTCCCCGGGGGGCCTCCCCCGGG - Intergenic
1183099576 22:35575568-35575590 CCCACGGGGGTGCCTCCCCCTGG + Intergenic
1183279955 22:36926662-36926684 CACACCGGGGCCCCTCCTCCAGG - Intronic
1184470366 22:44692421-44692443 CTCCCGGGGGCTCCTCCTCCTGG + Intronic
1184470404 22:44692516-44692538 CTCCTGGGGGCTCCTCCTCCCGG + Intronic
1184470411 22:44692532-44692554 CTCCCGGGGGCTCCTCCACCTGG + Intronic
1184523588 22:45009189-45009211 CTCACGAAGGGGCCCCCTCCAGG + Intronic
1184766961 22:46577156-46577178 CCCGCGGGGCCGCCTCCTCCCGG + Intronic
1185244950 22:49768643-49768665 CTCACGTGCAGGCCCCCTCCAGG + Intergenic
1185339794 22:50286168-50286190 CTCACGGCAGGTTCTCCTCCAGG + Exonic
1185402793 22:50627318-50627340 CTCCCGGGGGGGCCTGCCCCTGG - Exonic
949552438 3:5122383-5122405 CACACGAGCGGGCCTCCGCCCGG - Exonic
953641291 3:44710908-44710930 CGCACGGGGCAGCCTCATCCAGG + Intergenic
962814090 3:138983043-138983065 CTCAGGATGGGGCCTTCTCCAGG + Intergenic
964801498 3:160564504-160564526 CTCACGGTGTGCCCTCTTCCAGG - Intronic
967997782 3:195179911-195179933 ATCACGGGGAGGCATCCTCAGGG - Intronic
968025937 3:195442696-195442718 CGGACGGCGGGGCCTCCTCCGGG + Intronic
968689952 4:1985294-1985316 CCCACAGTGTGGCCTCCTCCAGG + Intronic
968811039 4:2799795-2799817 CCCCCGGGGGGGCCTCCTTGAGG + Intronic
969627748 4:8316390-8316412 GTCACAGGGGGGCCTGGTCCTGG - Intergenic
976045331 4:80940142-80940164 CTCACGGGTGGGCCTCTTGGTGG + Intronic
976600665 4:86935119-86935141 CGCAGGGGAGCGCCTCCTCCCGG - Exonic
978591534 4:110329671-110329693 ATCACAGGGAGGCCTCCTCCTGG + Intergenic
980206052 4:129720896-129720918 CTAACTGGGGGGCACCCTCCAGG - Intergenic
984136598 4:175948392-175948414 CTCAGCGAGGGCCCTCCTCCCGG - Intronic
984891316 4:184496179-184496201 CTCATGGGGGTGGCTTCTCCTGG + Intergenic
985652990 5:1115665-1115687 CTCCAGGGCCGGCCTCCTCCAGG - Intergenic
1002098988 5:176848108-176848130 CCCACGCTGCGGCCTCCTCCAGG + Intronic
1002915777 6:1526564-1526586 CTCAGGGAGGGGCTTGCTCCCGG - Intergenic
1006289165 6:33121245-33121267 CTTTCTGGGGGGCCTCCTCCTGG + Intergenic
1007680307 6:43629098-43629120 CCCACGGCCGGGCCCCCTCCGGG + Exonic
1017245119 6:152216401-152216423 GTCACTGGGGGGCCTGGTCCTGG + Intronic
1018857441 6:167684834-167684856 CTCCCCGGGGACCCTCCTCCAGG - Intergenic
1019351579 7:556568-556590 CTCACGGGTGGGGCCCCTGCCGG - Intronic
1019399480 7:844114-844136 CACCGCGGGGGGCCTCCTCCTGG + Intronic
1019445893 7:1071069-1071091 CTCATGGAGTAGCCTCCTCCAGG + Intronic
1022453054 7:30533821-30533843 CTGACAGGCGGGCCTTCTCCTGG + Intronic
1023114006 7:36842468-36842490 CTCAAGGGGGGGCCTCCAAGTGG + Intergenic
1023834642 7:44061006-44061028 CTCACTGGGGGTCCTATTCCTGG - Exonic
1024325686 7:48107571-48107593 CTCGCTGGGGCCCCTCCTCCTGG + Intronic
1025869981 7:65422464-65422486 CTCAGGGTGGGGCCTCCTACTGG + Intergenic
1029465217 7:100720909-100720931 CACACCGGGGGCCCTCATCCCGG - Exonic
1035061795 7:156074910-156074932 CTCGCAGAGGGGCCTTCTCCAGG + Intergenic
1035336722 7:158134020-158134042 CACACTCGGGGGCCTCCTGCAGG - Exonic
1041255483 8:55976708-55976730 CTCTCAGGGTGACCTCCTCCAGG - Intronic
1046108151 8:109691366-109691388 CGCACGTAGGTGCCTCCTCCTGG - Exonic
1047643334 8:126844127-126844149 CTCCGGGGAGGGCTTCCTCCGGG - Intergenic
1048952615 8:139508793-139508815 CTGACCTGGGGGCCTCATCCTGG + Intergenic
1049211616 8:141389200-141389222 CACCTGCGGGGGCCTCCTCCTGG + Intergenic
1049387786 8:142353095-142353117 CTCCCGGGGCTGCCTTCTCCAGG + Intronic
1056816752 9:89807285-89807307 CTCGTGCGGGGGCTTCCTCCGGG + Intergenic
1057210839 9:93200206-93200228 CTTATCGGGGGGCCTCCTCGAGG + Intronic
1061946091 9:133908780-133908802 CTCCCGAGGGGGCCTGCTCCTGG - Intronic
1062217559 9:135397477-135397499 CTCACCTGGGAGCCTCCTCTGGG + Intergenic
1062611464 9:137376465-137376487 CTCTCGAGGCGGCCTCCTGCAGG - Intronic
1187271936 X:17787842-17787864 CTCACTAGGAGGCTTCCTCCAGG + Intergenic
1189319836 X:40081186-40081208 CTCACAGGAGGCCCTCCTCCTGG + Intronic