ID: 1081929623

View in Genome Browser
Species Human (GRCh38)
Location 11:46859897-46859919
Sequence TGTTAAGGAGAAAACTTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 295
Summary {0: 1, 1: 0, 2: 4, 3: 16, 4: 274}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081929623 Original CRISPR TGTTAAGGAGAAAACTTGGG AGG Intronic
901050143 1:6421881-6421903 GGTTGAGGAGAAACCTGGGGTGG + Intronic
903413354 1:23165114-23165136 TGTTAATGTGCCAACTTGGGAGG - Intronic
904493453 1:30874102-30874124 TGGGAAGGAGGAAAGTTGGGAGG + Intronic
905703463 1:40036843-40036865 AGATAAAGAGGAAACTTGGGTGG + Intergenic
907965823 1:59328504-59328526 TGATATGGAGAAAATTTGAGTGG - Intronic
909401445 1:75236178-75236200 TGTTAACCAAGAAACTTGGGTGG + Intronic
910049695 1:82959751-82959773 TGTGAAGGAGAAAAACTGGCAGG - Intergenic
910314296 1:85864781-85864803 TGTTTAGGACAAAATTTGGTTGG - Intronic
911542009 1:99168048-99168070 AGTTAAAGAGAAAACTGGGTTGG + Intergenic
913015560 1:114730479-114730501 TGTTTCTGAGAAAAGTTGGGAGG - Intronic
913253872 1:116936983-116937005 TGATAAGGAGAAAATTTGGCAGG + Intronic
913431360 1:118795993-118796015 TGTAAAAGAGAAAACGTGGATGG - Intergenic
913569607 1:120107055-120107077 TGATAAGGAGCAGAGTTGGGTGG - Intergenic
915865353 1:159493624-159493646 TTTCAAGCACAAAACTTGGGCGG - Intergenic
917186623 1:172363815-172363837 TGTTAGGGAAAATACTGGGGAGG - Intronic
917208762 1:172608776-172608798 TTTTCTGGAGAAAACTTGAGGGG - Exonic
917861481 1:179149182-179149204 TGATATGGAGAAAATTTGAGTGG + Intronic
918096851 1:181343162-181343184 TGACAAGGAGAAGACTGGGGTGG + Intergenic
918176614 1:182051970-182051992 GGTTAAGGAGAAAAATGAGGAGG + Intergenic
919038650 1:192351110-192351132 TGCTAAGGATAATACCTGGGAGG + Intronic
920266779 1:204729930-204729952 TGTTAAAGAAAAAAATTGGCCGG + Intergenic
920551063 1:206861428-206861450 AGTTAAGGTGAAAAGGTGGGAGG + Intergenic
921347659 1:214203559-214203581 TATCAGGGAGAAAACATGGGGGG - Intergenic
923064106 1:230502471-230502493 TGTTACTGTGCAAACTTGGGAGG - Intergenic
924409646 1:243790528-243790550 TGATAAGGAGAAAGTTTGAGTGG - Intronic
1063214458 10:3911862-3911884 TGTCAAGGAGAAATGTTGGAAGG + Intergenic
1064261059 10:13786939-13786961 TATTCAGGAGAAAATTGGGGTGG - Intronic
1065383053 10:25109333-25109355 TGTTAAGCAGAAAACATAAGAGG + Intergenic
1065438140 10:25722441-25722463 TGGTATGGCGAAAATTTGGGGGG - Intergenic
1065508752 10:26456548-26456570 TTTTAAGAAGAAAACTCTGGTGG + Intronic
1065654582 10:27934951-27934973 TGTTAGGGAGAACACTTGGGAGG - Intronic
1065725559 10:28665014-28665036 TGATGTGCAGAAAACTTGGGAGG + Intergenic
1066057032 10:31691578-31691600 TGATATGGAGAAAGCTTGAGTGG - Intergenic
1067075398 10:43177065-43177087 TGATAAGGAGACAAGGTGGGGGG - Intronic
1068327757 10:55516635-55516657 ATTTATGGAGAAGACTTGGGTGG - Intronic
1069135153 10:64754621-64754643 TATTCAGGTGAAAGCTTGGGAGG + Intergenic
1070203036 10:74226467-74226489 TGTTAATGATAAAACCTTGGTGG - Intronic
1071496255 10:86169532-86169554 TGCCAAGGAGAAAACGAGGGTGG + Intronic
1073623731 10:105075060-105075082 CATTAAGGAGACAGCTTGGGAGG - Intronic
1073785526 10:106885270-106885292 TTTTAAGGAGAAAATTGGGGGGG + Intronic
1074210727 10:111331848-111331870 TGATAAGGAGAAAGTTTGAGTGG + Intergenic
1074468803 10:113708062-113708084 TTTTAAGGGGAAAAGATGGGTGG + Intronic
1074896748 10:117784085-117784107 TGTCCTGGAGAAAACTTGGCAGG + Intergenic
1075746517 10:124731956-124731978 AGATAGGGAGAAGACTTGGGAGG - Intronic
1076499709 10:130928005-130928027 TATTCAGGAGAAATATTGGGGGG + Intergenic
1077313473 11:1904230-1904252 GTTTAAAGAGAAAACTTGGCCGG + Intergenic
1077913240 11:6592647-6592669 GGTTAAGAAGAAAAATTGGCCGG - Intronic
1080673420 11:34402007-34402029 TTCTAAGGAGAAAACTTTCGGGG + Intergenic
1080686523 11:34520151-34520173 TATTTAGGAGCAAACTTGTGTGG + Intergenic
1080991298 11:37538931-37538953 TAGAAAGGAGAAAACTTAGGTGG + Intergenic
1081162098 11:39761581-39761603 TGATAGGGAGAAAACTTTAGCGG - Intergenic
1081877810 11:46422012-46422034 TGTTCAGAACAAAGCTTGGGTGG + Intronic
1081929623 11:46859897-46859919 TGTTAAGGAGAAAACTTGGGAGG + Intronic
1082195196 11:49296292-49296314 CCTTATGGAGAAAACTTTGGAGG - Intergenic
1082198980 11:49340104-49340126 TGCTGGGAAGAAAACTTGGGAGG + Intergenic
1086772505 11:90785101-90785123 TGTTTAGTAGGAAATTTGGGAGG - Intergenic
1086962485 11:92993189-92993211 TCTTAAGGAGAAAACATTTGTGG - Intergenic
1089048191 11:115522257-115522279 TGTTAATGCGAAACCTGGGGTGG - Intergenic
1091093470 11:132794157-132794179 TGTTAAGGAGTTTACCTGGGAGG - Intronic
1091609950 12:1997960-1997982 TGTTTAGGAGAAAACTGATGTGG - Exonic
1092152322 12:6258887-6258909 TGATAAGGAGAAAGTTTGAGTGG - Intergenic
1093883768 12:24436381-24436403 TGATAAGGAGAAAGTTTGAGTGG + Intergenic
1095622551 12:44275367-44275389 TGTTATGGAGAACAGTTTGGAGG + Intronic
1097616547 12:61890844-61890866 TGTTGAGGAGGATACATGGGTGG - Intronic
1099069851 12:78032215-78032237 TATTAAAGAGCAAACTTGAGTGG + Intronic
1101211328 12:102537995-102538017 TGTTAAGGAAATAACTTGGGAGG + Intergenic
1102185127 12:110941748-110941770 TGATAAGGACAAAAGATGGGAGG - Intergenic
1102330552 12:112025538-112025560 TGCTAAAGAAAAACCTTGGGAGG + Intergenic
1102804200 12:115764906-115764928 TATTAAGGAGAAAACAGGTGAGG + Intergenic
1105717045 13:23077134-23077156 TGTAAAAGATAAAACTTGGCAGG - Intergenic
1106726330 13:32490119-32490141 TATTAAGGAGAAAAAGTAGGAGG - Intronic
1106919217 13:34545172-34545194 TTTTAATCAGATAACTTGGGGGG + Intergenic
1107849873 13:44560299-44560321 TTTCAAAGAGAAAAATTGGGGGG + Intronic
1109350508 13:61174477-61174499 TGATAAGAAGAAAGCTTAGGTGG + Intergenic
1110496946 13:76179126-76179148 TGACAATGAGAAAACTTTGGAGG + Intergenic
1111127136 13:83924993-83925015 TTTTATGAAGAAAACTTGGATGG - Intergenic
1112723894 13:102279891-102279913 TATTAGGGAGAAGACTTGGAAGG - Intronic
1114121145 14:19671337-19671359 TGGAAAGGATAATACTTGGGGGG + Intergenic
1115773027 14:36686347-36686369 TGTAAAAGAGAAAAAATGGGGGG - Intronic
1115848383 14:37564173-37564195 TGTTAATGTGAAAAGTTGGATGG - Intergenic
1116264119 14:42664844-42664866 TGTAAAGGAGGAACCTTTGGAGG + Intergenic
1116380842 14:44265950-44265972 TGTTAATAAGAAGACTTAGGAGG + Intergenic
1118859467 14:69651243-69651265 TGTTAAAGAGAAGACTTAGGTGG + Intronic
1119465431 14:74854317-74854339 TGATCAGCAGAAATCTTGGGCGG + Exonic
1123501737 15:20891515-20891537 TTTTAAGGTAAAAACTCGGGAGG - Intergenic
1123558989 15:21465214-21465236 TTTTAAGGTAAAAACTCGGGAGG - Intergenic
1123595219 15:21902495-21902517 TTTTAAGGTAAAAACTCGGGAGG - Intergenic
1124291972 15:28460373-28460395 TGTCAAGGAGAAGAATTGAGAGG - Intergenic
1124817699 15:33012763-33012785 GGTTATGGAGAAAACTTCAGTGG + Intronic
1127251896 15:57247361-57247383 TATTATGGAGGAAACTTTGGAGG - Intronic
1128617765 15:69123553-69123575 TTTTAAGGTGAAAAGTTTGGGGG - Intergenic
1128690083 15:69717749-69717771 TGATATGGAGAAAGTTTGGGTGG - Intergenic
1129667172 15:77585850-77585872 TGTTAAGGAGAAAAAGAGGTCGG + Intergenic
1131316378 15:91341740-91341762 TGATAAGGAGAAACATTGGTGGG + Intergenic
1132395463 15:101470381-101470403 TGGTTAGCAGAAAACTTGGAAGG - Intronic
1133081890 16:3328408-3328430 TTTTAGGGAGTAAACTTAGGCGG - Intergenic
1133627684 16:7587062-7587084 TAATAAGGAGAAAATATGGGTGG + Intronic
1133944029 16:10333733-10333755 TTTTAAGGAGACACCCTGGGAGG + Intronic
1135524382 16:23202949-23202971 AGTTAAGGAGAAAACCTTGGGGG + Intronic
1136706812 16:32197299-32197321 TGTCAAGGAAAAAAATTGAGAGG + Intergenic
1136761099 16:32732118-32732140 TGTCAAGGAAAAAAATTGAGAGG - Intergenic
1136807004 16:33138268-33138290 TGTCAAGGAAAAAAATTGAGAGG + Intergenic
1136995549 16:35186301-35186323 TGTTGAGGAGAGTACTTGGTGGG - Intergenic
1140016646 16:71193326-71193348 TGTTAAGTAGAAACATTGGAAGG - Intronic
1203063251 16_KI270728v1_random:992435-992457 TGTCAAGGAAAAAAATTGAGAGG - Intergenic
1144177983 17:12726916-12726938 AATTAAGGAGAAAATTTGAGTGG - Intronic
1145202751 17:20961397-20961419 TGTTAAAGAGAAGAATTGTGAGG - Intergenic
1146152735 17:30489797-30489819 AGTCTAGGAGAAAACTTGAGAGG - Intronic
1147315637 17:39618797-39618819 TTCTAAGGAGAGAACCTGGGCGG + Intergenic
1147428378 17:40356943-40356965 TTTTAAAGAGAAAACTGAGGAGG - Intronic
1148116498 17:45178363-45178385 TGTTCAGGAGAGAGCCTGGGAGG - Intergenic
1149400786 17:56293914-56293936 TATTAAGAAGAAAGCTTGTGGGG - Intronic
1149623042 17:58060431-58060453 TGTGTAGGAGAGAACTTGGGGGG - Intergenic
1150454505 17:65295894-65295916 GCTTAAGGAGAAAACGTGGAAGG + Intergenic
1152169164 17:78732325-78732347 TAATGAAGAGAAAACTTGGGAGG + Intronic
1155351359 18:24910559-24910581 TGTTAAGGAGAAAAATAGATAGG + Intergenic
1158388618 18:57023409-57023431 TGTTAATGAGAAATATTGGTTGG + Intronic
1158709574 18:59825405-59825427 TTTTAATGAAAAAAATTGGGGGG + Intergenic
1159436905 18:68429821-68429843 TGTAATGGAGAAAACAAGGGAGG + Intergenic
1160166131 18:76514060-76514082 TGATATGGAGAAAGCTTGAGTGG - Intergenic
1160287174 18:77554542-77554564 TGTTCAGAAGAAAACCTGAGCGG - Intergenic
1160452291 18:78973913-78973935 CGCTAATGAGGAAACTTGGGGGG + Intergenic
1160923969 19:1534106-1534128 TGTTACGGAGCAAGCTTTGGGGG + Intronic
1162211274 19:9094048-9094070 TGTGAAGGAGAAAGCTTCTGCGG + Exonic
1163719197 19:18890283-18890305 TGTGGATGAGAAAACTTGTGTGG - Intronic
1164411892 19:28013108-28013130 TCTCAACTAGAAAACTTGGGAGG + Intergenic
1164940176 19:32246297-32246319 TGATAAGGAGAAAGTTTGAGTGG + Intergenic
1166234371 19:41445217-41445239 TTTTAAGGAGAAAACTCCCGTGG - Intergenic
1166306719 19:41939804-41939826 TCTGAAGGAGGAAACTGGGGTGG - Intergenic
1166863139 19:45821157-45821179 TGTAAAGGGTAAAACCTGGGAGG + Intronic
1168690887 19:58376781-58376803 TATCAAAGAGAAAACTTGGCTGG + Intronic
925600905 2:5607921-5607943 TGTGAAGGAGAGAACCTGAGTGG + Intergenic
927049701 2:19314780-19314802 TTTTAATGAGAAGAGTTGGGTGG + Intergenic
928457417 2:31435083-31435105 AATGAAGGAGAAAAATTGGGTGG + Intergenic
928831670 2:35493285-35493307 AGTTAAGGAGAAAATTTGCTAGG - Intergenic
930859621 2:56057010-56057032 TGATAGGGAGAAAGCTTGAGTGG - Intergenic
932645679 2:73499014-73499036 TGCTAAGGAGAATAGTTTGGAGG - Intronic
933476819 2:82802432-82802454 TATTAAAAAGAAAATTTGGGGGG + Intergenic
936933350 2:117813466-117813488 AGAGAGGGAGAAAACTTGGGAGG - Intergenic
937403809 2:121609629-121609651 TTTTAAGGAGAGAAACTGGGTGG - Intronic
938273494 2:129995328-129995350 TGGAAAGGACAATACTTGGGGGG + Intergenic
938442720 2:131350782-131350804 TGGAAAGGATAATACTTGGGGGG - Intronic
940184784 2:150971873-150971895 TGATATGGAGAAAACTTTAGTGG - Intergenic
941014343 2:160337645-160337667 TTTTAAGAAAAAAACTGGGGGGG + Intronic
942001975 2:171656749-171656771 TATTATGGAGAACACTTTGGGGG + Intergenic
942150291 2:173069744-173069766 TGTTAAGGAGTAATCTTGGGAGG - Intergenic
942284117 2:174396498-174396520 TGTTAAGAATAAACCTTGGCCGG + Intronic
942997846 2:182286295-182286317 TGGTAAGGAGAAAGGTAGGGAGG - Intronic
943379652 2:187128383-187128405 TGTCAAGGAGACTAGTTGGGAGG - Intergenic
943492709 2:188576037-188576059 TGTTAAGGAGAAAACCTGAAGGG - Intronic
943740801 2:191406258-191406280 TGATAAGGAGAAAATTTTAGTGG - Intronic
943829319 2:192438804-192438826 GGTTAATGAGAAAACTGAGGTGG - Intergenic
946050227 2:216856060-216856082 CGTTCTGGAGAAAACTGGGGAGG + Intergenic
948185485 2:236018395-236018417 TGTGCAGGAGGAAACTCGGGAGG + Intronic
948955073 2:241283109-241283131 TGATAAGGAGAAAGTTTGAGTGG + Intronic
1168946531 20:1764256-1764278 TGATAAGGAGAAAATTTTAGTGG - Intergenic
1170255017 20:14331989-14332011 TGTTAATGGGGTAACTTGGGAGG + Intronic
1170420367 20:16186484-16186506 AGCGAAGGAGAAAACTTAGGAGG + Intergenic
1172660929 20:36568244-36568266 TGATATGGAGAAAATTTGAGTGG - Intergenic
1175287111 20:57844361-57844383 TGTGAAGGTGAGGACTTGGGTGG + Intergenic
1177007374 21:15690329-15690351 TGTTAAAGGGTACACTTGGGAGG + Intergenic
1177112418 21:17044452-17044474 TTTTAAGGAGAAAACTAAAGGGG - Intergenic
1177209340 21:18050663-18050685 TGTGAAGGAGAAAACTGGGAGGG + Intronic
1178340487 21:31782024-31782046 TGCAATGGAGAAGACTTGGGAGG - Intergenic
1178973902 21:37205742-37205764 TGTTAAGAAGAATAATTTGGGGG + Intergenic
1179526975 21:41985496-41985518 TGTTATGGGGAACACTTAGGAGG + Intergenic
1179803862 21:43825179-43825201 TGTTGACGAGAAAACTGGGATGG - Intergenic
1182611803 22:31554213-31554235 TGTTTAGGAGAAAACATAAGAGG - Intronic
1185114250 22:48922395-48922417 TGTTATGGAGAACACTGGGCAGG - Intergenic
951034799 3:17921267-17921289 TGTGAAGGGGAAGACTTTGGAGG + Intronic
951959046 3:28294360-28294382 TGTTAAGTAGCAAAATTTGGGGG + Intronic
953040467 3:39251271-39251293 TGTTAGGGAGAACACCTGTGAGG - Intergenic
953618902 3:44515490-44515512 TGTTAATGAGAAAACTGGGCAGG - Intergenic
955201122 3:56853186-56853208 TGTTAAAGAAAAATCTGGGGTGG + Intronic
955423757 3:58766369-58766391 TATTTAGGAGAAAAATTGGCAGG - Intronic
955996326 3:64684504-64684526 TGGTAAGGGGAAGTCTTGGGAGG + Intronic
956312554 3:67897470-67897492 TGTGAAGAAGAAAAATTGGCAGG - Intergenic
957165680 3:76669831-76669853 TGCTGAGAAGAAAACTTGTGTGG - Intronic
958050997 3:88346037-88346059 TGATATGGAGAAAAATTTGGTGG + Intergenic
958971979 3:100621450-100621472 TGATATGGAGAAAATTTGAGTGG + Intronic
959248136 3:103902170-103902192 AGTTGAGGAGAAAACGTGGTTGG - Intergenic
959966734 3:112364128-112364150 TTTTATGGGGAAGACTTGGGAGG + Intergenic
960964480 3:123095295-123095317 TGTTCAGGAGAAAGCTGGAGGGG + Intronic
962258822 3:133890074-133890096 AGGAAAGGAGAAAAATTGGGAGG + Intronic
963989119 3:151633155-151633177 AGTTAAAGAGAAAACATGGCTGG - Intergenic
965294613 3:166927632-166927654 TGTGAAGGAGAAAATTAGAGAGG - Intergenic
965554069 3:170001691-170001713 TGTTAATAAGAAACTTTGGGTGG - Intergenic
966448813 3:180034636-180034658 TGTTAAGCATAAAACTTCCGAGG - Intronic
967294632 3:187953140-187953162 TCTGAAGGAGAATACCTGGGCGG - Intergenic
967381775 3:188866971-188866993 TGAGAAAGAGAAGACTTGGGTGG - Intronic
968472375 4:788023-788045 CGTCCAGGAGAAAACTTAGGAGG + Intronic
970286262 4:14519829-14519851 TCTTAAAGAGAAAACTAGGGTGG + Intergenic
974414696 4:61592323-61592345 AGTAAAGGAGAATACTTGAGCGG - Intronic
974630584 4:64482169-64482191 TGATAATTAGAAAACGTGGGAGG - Intergenic
976568888 4:86585788-86585810 TGTCTAGTAGAAAACTTAGGAGG - Intronic
978390582 4:108221114-108221136 TGATAATTATAAAACTTGGGTGG + Intergenic
979007723 4:115323243-115323265 GGATAAGGAGAAAAATTGAGAGG + Intergenic
979745804 4:124211771-124211793 TATTAATGAGAAAACGTGGCTGG - Intergenic
982303674 4:153906175-153906197 TGTCAAGGAGGAAACTGGAGAGG - Intergenic
983073682 4:163298933-163298955 AGTTCAGGAGAAAACTTGAATGG - Intergenic
984646820 4:182229233-182229255 TGTTGAGGCGAGGACTTGGGAGG + Intronic
984685586 4:182664726-182664748 TGATAAGGAGAACATTTGAGTGG + Intronic
984822984 4:183899506-183899528 TGGTATGGAGAAAATTTGAGTGG + Intronic
986488836 5:8269004-8269026 TATTAAAGAGAAAACTGGGATGG + Intergenic
988616043 5:32775852-32775874 TGTTATTAAGAAAGCTTGGGAGG - Intronic
988857135 5:35238720-35238742 TGATAAACAGAAAACTTTGGAGG - Intergenic
988910926 5:35842543-35842565 TGAGTAGGAGAAAACTTTGGGGG - Intergenic
989654080 5:43725591-43725613 TGATATGGAGAAAACTTGAGTGG - Intergenic
989810412 5:45666008-45666030 TGTCAAGAAGAGAACTTGGGGGG - Intronic
990758067 5:59098113-59098135 TGTTTAGTACAAAAATTGGGAGG - Intronic
992268982 5:75046642-75046664 AGTTAAGGAGAAAACTGGCAAGG - Intergenic
993852401 5:93026752-93026774 TGTTATGGAGAACATTTTGGAGG + Intergenic
994844270 5:104965985-104966007 TGCTAAGGAGAAAACCTGGGGGG - Intergenic
994851443 5:105058812-105058834 TGATATGGAGAAAGCTTGAGTGG + Intergenic
995430167 5:112065821-112065843 TGTTTATGATAAAACTGGGGGGG - Intergenic
995964164 5:117883845-117883867 TATTTATGAGAAAATTTGGGAGG - Intergenic
996045778 5:118872205-118872227 TGATAGGGAGAAAATTTGAGTGG - Intronic
996431168 5:123379251-123379273 GGTTATGGAGAAAAGATGGGTGG - Intronic
996482913 5:123995732-123995754 TGATATGGAGAAAATTTGAGTGG - Intergenic
996567888 5:124900579-124900601 TGTTGAGGTGAAGACTAGGGCGG - Intergenic
1001160888 5:169311755-169311777 TGTTAAGGAGAAATTCTGGAAGG - Intergenic
1001433468 5:171681632-171681654 TCATGGGGAGAAAACTTGGGAGG + Intergenic
1003109309 6:3240349-3240371 TATAAAGGAGAAATTTTGGGTGG - Intronic
1005210179 6:23451840-23451862 TCTCAAGGAGAAAAGTTGGTGGG + Intergenic
1005436509 6:25817468-25817490 TGATAAGGAAAAAACATGTGAGG + Intronic
1005703019 6:28422909-28422931 TGTTAAGGAGAACGCTGAGGAGG - Intergenic
1008879279 6:56364268-56364290 TGTAAATGAGAAAACCTAGGCGG + Intronic
1010275925 6:73968276-73968298 TGGTAAGCAGAAAAGTTGGAGGG + Intergenic
1010504018 6:76633986-76634008 TGTTAAGAGGAACACATGGGCGG - Intergenic
1010943493 6:81947818-81947840 TGGTATGGAGAAAATTTGAGGGG - Intergenic
1011115189 6:83882223-83882245 TGTGAAGGTGAAAACTCAGGTGG + Intronic
1011911969 6:92451521-92451543 TGCTCAGGAGAAAACTTAAGAGG + Intergenic
1012824725 6:104132934-104132956 TGATATGGAGAAAGCTTGAGTGG + Intergenic
1013514567 6:110874436-110874458 TGATTAGCAGAAAACATGGGTGG - Intronic
1014478057 6:121899537-121899559 TGATACGGAGAAAATTTGAGTGG + Intergenic
1017420198 6:154264713-154264735 AATTAAGGAGAAAACTTGCTAGG - Intronic
1018076567 6:160221401-160221423 TGATATGGAGAAAGCTTGAGTGG - Intronic
1020991064 7:15196387-15196409 TGTGAAACAGAAAACTTTGGTGG + Intergenic
1021221738 7:17982296-17982318 TGATAAGGAGAAAGTTTGAGTGG - Intergenic
1021446448 7:20738828-20738850 TTTTAAAGAGATAACTTGGTGGG + Intronic
1022983364 7:35625556-35625578 TGTTTAGGGGAAAACATGAGAGG - Intergenic
1024938227 7:54734432-54734454 TGTTATGCAGAAAGCTTGGCTGG - Intergenic
1025709784 7:63898699-63898721 TGTTGGGTATAAAACTTGGGCGG - Intergenic
1026484307 7:70804785-70804807 TGTTATGGAAAACAGTTGGGAGG + Intergenic
1028266865 7:88736488-88736510 TGTTAAGAAAACAATTTGGGAGG + Intergenic
1028348562 7:89814586-89814608 AGTTAAGGAGAATACTAGGCAGG + Intergenic
1030312574 7:108083193-108083215 TGCTGAGGAGAATACTTGGGAGG + Intronic
1030422986 7:109332364-109332386 TGATTTGGAGAAAACTTAGGAGG - Intergenic
1030446541 7:109652442-109652464 TTTTCAGTAGAAAAATTGGGGGG - Intergenic
1030640658 7:112002747-112002769 TGTTAACAAGAAAAGCTGGGTGG + Intronic
1031580731 7:123471634-123471656 TGTTAGGCTAAAAACTTGGGGGG - Intronic
1034130912 7:148716612-148716634 TTTCAAGAAGAAAAATTGGGAGG - Intronic
1037894577 8:22643328-22643350 TGTTAAAAAAAAAAGTTGGGGGG - Intronic
1038460145 8:27709438-27709460 TGTTAAAGAGAAAATCAGGGTGG - Intergenic
1043510759 8:80948105-80948127 TAGTAAGGAGAAAACTTTAGAGG - Intergenic
1043802303 8:84624876-84624898 AGTTTAGGAGAAATTTTGGGAGG - Intronic
1045486876 8:102638375-102638397 TGCTAAGGACAAAACTCTGGGGG + Intergenic
1046902229 8:119535818-119535840 TGTAACTGAGAAAACTTGGGAGG + Intergenic
1048088909 8:131217585-131217607 TGATAAGGAGATTACCTGGGTGG - Intergenic
1048217021 8:132505707-132505729 TGGAAAAGAGAAGACTTGGGGGG - Intergenic
1048319886 8:133390365-133390387 TCTTAAGGAGAAAAATAGGCTGG + Intergenic
1050349564 9:4727612-4727634 TGATATGGAGAAAGCTTGAGTGG - Intronic
1050427003 9:5521886-5521908 AGTAAAGGAGAAAGCATGGGAGG + Intronic
1050709924 9:8449926-8449948 TGTAAAACTGAAAACTTGGGAGG - Intronic
1052275567 9:26672069-26672091 TGTTATAGAGAAAAGGTGGGAGG - Intergenic
1052838150 9:33266540-33266562 TGGTAAGGAGAAAACATGTGAGG + Intronic
1053463635 9:38289394-38289416 TATTAAGGAGGAAACTTGAAGGG + Intergenic
1053465603 9:38305754-38305776 TGATAAGGAGAACACTTGAGTGG - Intergenic
1054795772 9:69300502-69300524 TGATAAGGAGAAAGCTGGAGTGG - Intergenic
1054862590 9:69968901-69968923 TTTTAAGGAGATATTTTGGGGGG + Intergenic
1055695052 9:78874343-78874365 TGTAAAGAAGAAAAATTGGCAGG + Intergenic
1057570203 9:96198596-96198618 TGCTAAGGAGAAAACAGGGCAGG + Intergenic
1057957155 9:99419638-99419660 TGTTGATGAGAAGGCTTGGGTGG + Intergenic
1059022907 9:110596260-110596282 TGTTAAGGAAAAGACCTGGTTGG - Intergenic
1059937317 9:119323949-119323971 TTTTCAGGTGAAAATTTGGGGGG - Intronic
1062104728 9:134748557-134748579 TGTCAATGACAAAACCTGGGCGG + Intronic
1062488618 9:136793255-136793277 TGGTCAGGTGGAAACTTGGGTGG - Exonic
1203689905 Un_GL000214v1:32530-32552 GGTTAAGGAGAGAACTGGTGTGG - Intergenic
1203646370 Un_KI270751v1:71523-71545 GGTTAAGGAGAGAACTGGTGTGG + Intergenic
1186492831 X:9987931-9987953 TGTTAATGAGAGAATCTGGGTGG + Intergenic
1186781126 X:12912987-12913009 TGTTTAGGTGGACACTTGGGCGG - Intronic
1187320831 X:18236314-18236336 TGTTAATGTGAAAAGATGGGTGG - Intergenic
1187828293 X:23354926-23354948 ACTTTAGGAGACAACTTGGGAGG - Intronic
1188131974 X:26447303-26447325 TATTAAGGATATAATTTGGGTGG + Intergenic
1188340960 X:29001093-29001115 TGTTAAGGAGAAAACCTTCCAGG - Intronic
1190542687 X:51495410-51495432 TGTGAAGGAGAAAACTAAAGGGG + Intronic
1192305888 X:69959008-69959030 TCTTTAAGAGAAAACTTCGGAGG - Intronic
1192385698 X:70666949-70666971 TGCTAAGGAGAAAACTAAGCAGG - Intronic
1195225262 X:102785644-102785666 TGTTAAGAAGAATAGTTGGCTGG - Intergenic
1197169709 X:123418276-123418298 TTTTAACTAGAAAACTTGGGTGG - Intronic
1198468492 X:136924630-136924652 TTTCAAACAGAAAACTTGGGTGG + Intergenic
1198953337 X:142098281-142098303 TGTTAAGCAGGAAACTGGCGTGG + Intergenic
1199718197 X:150522516-150522538 TGTTATAGAGAAAACTTGCATGG + Intergenic
1201327986 Y:12786308-12786330 TGTTAGGTATAGAACTTGGGAGG - Exonic
1202606778 Y:26645916-26645938 TGTTTTAGAGTAAACTTGGGTGG + Intergenic