ID: 1081931654

View in Genome Browser
Species Human (GRCh38)
Location 11:46875685-46875707
Sequence CAGAGGAAGGAGAGGGTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2290
Summary {0: 1, 1: 2, 2: 17, 3: 267, 4: 2003}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081931646_1081931654 -10 Left 1081931646 11:46875672-46875694 CCTCAATTCGCTGCAGAGGAAGG 0: 1
1: 0
2: 2
3: 5
4: 97
Right 1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG 0: 1
1: 2
2: 17
3: 267
4: 2003
1081931643_1081931654 16 Left 1081931643 11:46875646-46875668 CCGATTGGCACCATTCAGGTCAG 0: 1
1: 0
2: 0
3: 7
4: 73
Right 1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG 0: 1
1: 2
2: 17
3: 267
4: 2003
1081931641_1081931654 26 Left 1081931641 11:46875636-46875658 CCAATGTATGCCGATTGGCACCA 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG 0: 1
1: 2
2: 17
3: 267
4: 2003
1081931644_1081931654 6 Left 1081931644 11:46875656-46875678 CCATTCAGGTCAGCAGCCTCAAT 0: 1
1: 0
2: 0
3: 22
4: 236
Right 1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG 0: 1
1: 2
2: 17
3: 267
4: 2003

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081931654 Original CRISPR CAGAGGAAGGAGAGGGTGGG GGG Intronic
Too many off-targets to display for this crispr