ID: 1081935869

View in Genome Browser
Species Human (GRCh38)
Location 11:46903666-46903688
Sequence CCTCCCTGGCCAACATCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 369
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 334}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081935869_1081935876 8 Left 1081935869 11:46903666-46903688 CCCTGGGATGTTGGCCAGGGAGG 0: 1
1: 1
2: 0
3: 33
4: 334
Right 1081935876 11:46903697-46903719 TAATGGTGGAATTAAAATGCTGG 0: 1
1: 0
2: 1
3: 26
4: 236
1081935869_1081935877 20 Left 1081935869 11:46903666-46903688 CCCTGGGATGTTGGCCAGGGAGG 0: 1
1: 1
2: 0
3: 33
4: 334
Right 1081935877 11:46903709-46903731 TAAAATGCTGGAGCCTCTTTAGG 0: 1
1: 0
2: 1
3: 28
4: 286
1081935869_1081935878 26 Left 1081935869 11:46903666-46903688 CCCTGGGATGTTGGCCAGGGAGG 0: 1
1: 1
2: 0
3: 33
4: 334
Right 1081935878 11:46903715-46903737 GCTGGAGCCTCTTTAGGATAAGG 0: 1
1: 0
2: 0
3: 6
4: 116
1081935869_1081935874 -9 Left 1081935869 11:46903666-46903688 CCCTGGGATGTTGGCCAGGGAGG 0: 1
1: 1
2: 0
3: 33
4: 334
Right 1081935874 11:46903680-46903702 CCAGGGAGGGCAAGAACTAATGG 0: 1
1: 0
2: 0
3: 15
4: 192
1081935869_1081935875 -6 Left 1081935869 11:46903666-46903688 CCCTGGGATGTTGGCCAGGGAGG 0: 1
1: 1
2: 0
3: 33
4: 334
Right 1081935875 11:46903683-46903705 GGGAGGGCAAGAACTAATGGTGG 0: 1
1: 0
2: 1
3: 12
4: 186

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081935869 Original CRISPR CCTCCCTGGCCAACATCCCA GGG (reversed) Intronic
900250331 1:1665468-1665490 CCTCTCTGGGCGACACCCCAGGG - Exonic
900367894 1:2318743-2318765 CCTCTCTGGCCAGCATGCCTGGG - Intergenic
900555368 1:3277584-3277606 TGTCCCTGGACAACGTCCCAGGG - Intronic
900798100 1:4721525-4721547 CGTCCCTGGCCAAGATTTCATGG + Intronic
900941768 1:5803432-5803454 TCTCCCTGGCAAACCTCTCATGG + Intergenic
900966132 1:5960005-5960027 CCTCCCTGGCCAGCAGAACAGGG + Intronic
902048367 1:13542691-13542713 CCAACCTGGCCAACATACCAAGG - Intergenic
902290046 1:15429460-15429482 CTTCCCTGCCCATGATCCCACGG - Exonic
902375605 1:16028707-16028729 CCTCCCTTTCCTACATCCCGAGG - Intronic
902380565 1:16050462-16050484 CCTCCCTTTCCCACATCCCAAGG - Intronic
903412975 1:23161824-23161846 CCAGCCTGGCCAACATAACATGG + Intronic
904136548 1:28316983-28317005 CCAGCCTGGGCAACATGCCAAGG - Intergenic
904500640 1:30910785-30910807 CCTCCCTGCCCATCTCCCCAAGG - Intergenic
904612634 1:31733801-31733823 CCTCCCTGGCCTCCCTGCCAGGG + Intronic
905459639 1:38114181-38114203 CCACCCTGGCCAACCACCAAGGG - Intergenic
906377207 1:45304842-45304864 CCACCCTGGCCTACATAGCAGGG + Intronic
906695092 1:47818164-47818186 CCTCCCAGCCCTCCATCCCATGG - Intronic
908258282 1:62319779-62319801 CCTCACTGGCCCACATCCGCTGG - Intergenic
911121501 1:94301594-94301616 CCCCCCTGGCCACCATACAAGGG - Intergenic
911375989 1:97052338-97052360 CCTCCCAGGACAACATGCCTTGG + Intergenic
913170865 1:116230989-116231011 GCTCCCTGGCCCTCCTCCCAGGG - Intergenic
913210353 1:116577277-116577299 CCTCCGTGGCCAACATCCGCTGG + Exonic
915241919 1:154529267-154529289 CCTGCCTGGCCAACATGGCGAGG - Intronic
915463911 1:156084886-156084908 CCTCCCTGGCCAAATCCCCAAGG - Intronic
915593769 1:156884888-156884910 CCTCACTCCCCAGCATCCCAGGG - Intergenic
915608155 1:156968043-156968065 CCACCCTGGCCATGATCACAGGG + Exonic
917065326 1:171086825-171086847 CCACCCTGGGCAACATAGCAAGG + Intergenic
918108107 1:181430516-181430538 CCTCCCTGTGCAAGTTCCCATGG + Intronic
920347573 1:205316543-205316565 CCTCCCTAGCCCACCTCCCTTGG - Intronic
920433569 1:205934278-205934300 CCTCCCCTTCCAGCATCCCAGGG - Intronic
921123022 1:212153080-212153102 CCAGCCTGGCCAACATAGCAAGG + Intergenic
922278080 1:224097745-224097767 CCAGCCTGGCCAACATAACATGG + Intergenic
922321345 1:224490441-224490463 CCCTCCTGGGCCACATCCCATGG - Intronic
922861063 1:228816845-228816867 CCAGCCTGGGCAACATCGCAGGG + Intergenic
922912767 1:229231498-229231520 ACGTCCTGGCCAAGATCCCAGGG - Intergenic
923246387 1:232136657-232136679 CCTCCCTCGCCTCCATCCCAGGG - Intergenic
923768769 1:236918295-236918317 CCGACCTGGCCAACATGGCAAGG - Intergenic
1064094982 10:12417563-12417585 GTTCCCAGGCCAACAGCCCAGGG - Intronic
1064465310 10:15574015-15574037 CCAGCCTGGCCAACATAGCAAGG - Intronic
1064728639 10:18306756-18306778 TCTCCCTGGCTGACTTCCCAAGG - Intronic
1065084915 10:22164590-22164612 CCTGCAAGCCCAACATCCCATGG + Intergenic
1066196997 10:33110192-33110214 CCACACAGGCCAACATCCTAAGG + Intergenic
1067683769 10:48455580-48455602 GCTCCCTGGCCCATGTCCCAGGG - Intronic
1067765162 10:49080382-49080404 CCTCCCTGGCCTAGGCCCCAGGG + Intronic
1068715366 10:60181617-60181639 CCAGCCTGGCCAACATGGCAAGG + Intronic
1069013809 10:63404437-63404459 CCTGCCTGGGCAACATAGCAAGG - Intronic
1070802096 10:79249835-79249857 CCTCCCTGCCCAACTACCCGGGG + Intronic
1070825884 10:79390534-79390556 CCTCCTTGGCCATGACCCCATGG + Intronic
1071110189 10:82146823-82146845 CCTCCCTGTACCACACCCCAGGG - Intronic
1071227339 10:83546058-83546080 CCTCCCTGTGCAAGTTCCCACGG + Intergenic
1071546575 10:86534564-86534586 CCTCCCTTCACAGCATCCCACGG + Intergenic
1071902789 10:90139095-90139117 CCTCTCTGGCCTACATCCATAGG + Intergenic
1072682690 10:97518038-97518060 CCTCCTTGGCCTGCTTCCCAGGG + Intronic
1072783640 10:98266548-98266570 CTTCCCTGGCCCAGACCCCAGGG - Intronic
1073321597 10:102619370-102619392 GTTCCCTGGGCAACAGCCCATGG - Intronic
1077510826 11:2961408-2961430 CCTGCCTGGCAAAAATCACAAGG + Intronic
1077516409 11:3004537-3004559 CCCCCATGGCCCACCTCCCATGG + Intronic
1077634722 11:3834672-3834694 CCTGCCTGGGCCACACCCCAAGG - Intronic
1077725466 11:4671013-4671035 CCTCCTCTGCCATCATCCCATGG + Intergenic
1078103646 11:8344960-8344982 CCTGCCTGGCAAAGACCCCAAGG + Intergenic
1078432281 11:11297493-11297515 CCTCCCTTGCCCACCTCCCTGGG + Intronic
1078958069 11:16226425-16226447 CCTCCCTGGGCAATGTGCCAGGG - Intronic
1080357802 11:31472014-31472036 TCTCCCTGGCCATTATTCCATGG + Intronic
1080815433 11:35751987-35752009 CCTTCCTGTCCTACATCCCATGG + Intronic
1080943210 11:36942684-36942706 ACTCACAGGCCAACATCTCAGGG - Intergenic
1081935869 11:46903666-46903688 CCTCCCTGGCCAACATCCCAGGG - Intronic
1081965108 11:47164704-47164726 CCTCCATGGCCACCAACCCGGGG + Exonic
1082664383 11:55956704-55956726 CCTCCCTGTGTAACTTCCCACGG + Intergenic
1084150089 11:67284071-67284093 CCTCCTTGGCCAACTTCCCTGGG + Intronic
1085028332 11:73253549-73253571 CCTGCCTGGGCAACATAGCAAGG - Intergenic
1085051163 11:73380985-73381007 CCTCCCGGGCCATAATCCCACGG - Intronic
1085295161 11:75427350-75427372 AATCCCTGGCCAAGATCCCCAGG - Intronic
1087789505 11:102391719-102391741 CCTCCCTCCCCAACAAGCCATGG + Intergenic
1089125619 11:116174597-116174619 CCCCCCTGCCCACCATCCCCTGG + Intergenic
1089585116 11:119505618-119505640 CCAACCTGGCCAACATAGCAAGG + Intergenic
1090286316 11:125502571-125502593 CCTCCCTCCTCAACCTCCCAAGG - Intergenic
1091303461 11:134522763-134522785 CACCCATGACCAACATCCCAGGG - Intergenic
1092060427 12:5546252-5546274 CTTCCCTGGCTATCTTCCCAGGG - Intronic
1093574138 12:20707058-20707080 CCTCCCTGGCCAATCTATCAAGG + Intronic
1094199259 12:27780219-27780241 CCTCCCGGGCCGCCATCCCTCGG + Exonic
1095678599 12:44948817-44948839 CTTCCCTGGGCAACATCCGCGGG + Intergenic
1096010756 12:48212473-48212495 CCTTCCTGGGCCACATGCCATGG + Intergenic
1099956994 12:89360657-89360679 CCTCCCTAACCAATTTCCCAGGG + Intergenic
1100611306 12:96194108-96194130 CCTCCCGGGCCAACTGCGCAGGG + Intergenic
1103017610 12:117507983-117508005 CCTCCCTTGTCATCTTCCCAGGG + Intronic
1103504717 12:121434338-121434360 CCAGCCTGGCCAACATGGCATGG + Intronic
1104972314 12:132537438-132537460 CCTCCCTGGCCCGTGTCCCAGGG + Intronic
1105819050 13:24063469-24063491 CTCCCCTGGCCCACATCCCTCGG + Intronic
1106030851 13:26001044-26001066 CCTCCCTGCCCTACAGCCCCTGG + Intronic
1106140498 13:27007091-27007113 CCTCCCTGCCCCTCACCCCATGG + Intergenic
1106481925 13:30143278-30143300 CCTCCCTGGCTTACTTCTCAGGG + Intergenic
1108773635 13:53735637-53735659 CCTCCCAGGCCAGCCTCCCGAGG - Intergenic
1112053699 13:95670635-95670657 CCTCCGTGGCCACCATCACTGGG + Intergenic
1113109478 13:106807041-106807063 CCTCCCTGGCCAGCTTGCCTTGG + Intergenic
1113564543 13:111311702-111311724 CCTCCCTGGGCACCACCCCTGGG - Intergenic
1117394292 14:55293377-55293399 CCAGCCTGGCCAACATGGCAAGG - Intronic
1120845223 14:89119352-89119374 CCTCCTCAGCAAACATCCCATGG + Intergenic
1122414640 14:101543018-101543040 CCTCTCTGGTCCACCTCCCAAGG + Intergenic
1122466513 14:101937541-101937563 CCAACCTGGCCAACATGGCAAGG + Intergenic
1122978418 14:105180626-105180648 CCTCCCTGGAAAAAACCCCAAGG + Intronic
1123055194 14:105566193-105566215 CCTCCCTGGCCCAGCTCCCCTGG + Intergenic
1123079643 14:105686037-105686059 CCTCCCTGGCCCAGCTCCCCTGG + Intergenic
1124079548 15:26478823-26478845 CCTGCCTGGGCAACATAGCAAGG - Intergenic
1125542921 15:40481541-40481563 CCTCCCTCCCCACCATCCCCTGG + Intergenic
1125717555 15:41827856-41827878 CCCCACTGGCCGGCATCCCAGGG - Intergenic
1125897665 15:43316151-43316173 CTTCCCTGGTTTACATCCCATGG + Intergenic
1126146301 15:45475888-45475910 CCAGCCTGGCCAACATGGCATGG - Intergenic
1127054447 15:55117181-55117203 CTCCCCTGGCCAAGATCCCCAGG + Intergenic
1127391094 15:58505780-58505802 CCACCCGAGCCAACATTCCAAGG + Intronic
1127712259 15:61611192-61611214 CCTTTCTGGCCAAAACCCCATGG - Intergenic
1129064427 15:72889297-72889319 CCTCCCTGGACAAGGTCCTAAGG - Intergenic
1129362076 15:75030242-75030264 CCACCCCAGCCAACATCTCAGGG - Intronic
1131225512 15:90621649-90621671 CCAACCTGGCCAACATAGCAAGG - Intronic
1131269827 15:90940317-90940339 CCTCCCTGGCCAGCACCACCAGG - Exonic
1132672260 16:1106686-1106708 CCTCCCTGGCCATCTTCCTCTGG + Intergenic
1132713626 16:1279956-1279978 CCTCCCTCGCCCACATCCACGGG + Intergenic
1132867361 16:2100117-2100139 CCACCCTGCCCAACCTCCCACGG + Intronic
1132951227 16:2563513-2563535 CCTCCCTAGGCAAAATCCCAGGG - Intronic
1132963123 16:2636657-2636679 CCTCCCTAGGCAAAATCCCAGGG + Intergenic
1133437367 16:5791455-5791477 CCCTCCTGGCCAAGATCCCAGGG - Intergenic
1133770627 16:8865559-8865581 CTTCCCCAGCCAGCATCCCATGG - Intronic
1134026805 16:10960470-10960492 CCTCTCTTGCCATCATCACAAGG + Intronic
1134524416 16:14932998-14933020 CCACCCTGCCCAACCTCCCACGG - Intronic
1134548485 16:15127943-15127965 CCACCCTGCCCAACCTCCCACGG + Intronic
1134712004 16:16331485-16331507 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134719861 16:16374778-16374800 CCACCCTGCCCAACCTCCCACGG - Intergenic
1134947565 16:18337107-18337129 CCACCCTGCCCAACCTCCCACGG + Intergenic
1134954824 16:18377209-18377231 CCACCCTGCCCAACCTCCCACGG + Intergenic
1135711360 16:24720202-24720224 CCACTCTGGCCAACATAACAAGG + Intergenic
1135857289 16:26023599-26023621 CCAGCCTGGCCAACATAACAAGG - Intronic
1138172519 16:54866379-54866401 CCAGCCTGGCCAACATAACATGG - Intergenic
1138172613 16:54866946-54866968 CCAGCCTGGCCAACATAACATGG + Intergenic
1138673743 16:58636021-58636043 CCTCCCTGGACATCCTCCCAGGG - Intergenic
1139443072 16:66978745-66978767 CCAGCCTGGGCAACATCGCAAGG + Intergenic
1139603420 16:68000815-68000837 CCTCTCTGTCCAACATTCCTGGG + Intronic
1139687611 16:68616586-68616608 CCTCCCTGGCCATCCTGCCCTGG - Intergenic
1139914747 16:70421104-70421126 CCTCCCCAGCCCACCTCCCAGGG - Intronic
1141635377 16:85311489-85311511 CCTCCCTCCCCAATGTCCCACGG - Intergenic
1141753719 16:85977160-85977182 ATTCCATGGCCAACATCACAAGG - Intergenic
1141901479 16:86993944-86993966 GCGCCCTGGACAACCTCCCAAGG + Intergenic
1142227891 16:88886309-88886331 CCTCCCACGCCACCCTCCCATGG - Intronic
1143634057 17:8154369-8154391 CCTCCCTGCCCCACATTCCGAGG - Intronic
1145252235 17:21302940-21302962 CCTCCCGGGCTCACCTCCCAGGG - Intronic
1146813544 17:35923698-35923720 CCTCCCTGGGCATCACCCCCGGG + Intronic
1147263058 17:39219926-39219948 CCTGCCTGGCCACCCTGCCAAGG + Intronic
1147305329 17:39559990-39560012 CCACCCTGGGCAACATAGCAAGG - Intronic
1147999630 17:44380181-44380203 CCTCCCTGGCCAGCCTCCGGGGG + Intronic
1148855049 17:50574497-50574519 CATCCCTGGCCACCACCTCAAGG + Intronic
1149526084 17:57356999-57357021 CCTCCCAGGCCAGCTGCCCAGGG + Intronic
1149528125 17:57373837-57373859 CCTCCCTGGCCATGTTGCCAGGG + Intronic
1149564221 17:57630047-57630069 CCTCCATGGCCTGCATCCCTGGG + Intronic
1150160479 17:62893931-62893953 CCTCAGTGGCTAACATCTCATGG + Intergenic
1150383201 17:64737152-64737174 CCTCCCTCGCCCACAACACACGG + Intergenic
1150692935 17:67380102-67380124 CCACCCTGGGCAACATAACAAGG - Intronic
1150996230 17:70320848-70320870 ACTCCCTGTCTAACATCCCTAGG - Intergenic
1151879509 17:76886641-76886663 CCTCCCTGGTCCACCTCCCTCGG - Intronic
1152628736 17:81400111-81400133 CTTCCCTGGCCACCCTCCCCCGG + Intronic
1153477213 18:5510197-5510219 CCTCCCTGGACTACATGTCATGG - Intronic
1154147535 18:11878761-11878783 CCAGCCTGGCCAACATAGCAAGG - Intronic
1154274304 18:12946888-12946910 CATTCCTGGCCAAAATCCAAAGG + Intergenic
1155020924 18:21896639-21896661 CCTCCCAGGCCTCCTTCCCAAGG - Intergenic
1155144555 18:23072301-23072323 CCTTCCTGGCCAAAATCTCCTGG + Intergenic
1155296608 18:24390494-24390516 CCAGCCTGGCCAACAGACCACGG + Intronic
1157587820 18:48816515-48816537 CTTCCCTAGCGACCATCCCATGG + Intronic
1160957946 19:1702717-1702739 CCACCCTGGCCAACGTAGCAAGG + Intergenic
1161199913 19:3008877-3008899 CCTCCCTACCCAGCATCCCTGGG - Exonic
1161859045 19:6784056-6784078 CCAGCCTGGGCAACATACCAAGG + Intronic
1162330007 19:10021956-10021978 CTTCCCAGGCCAAGTTCCCAGGG - Exonic
1162498135 19:11034898-11034920 CCTCCCTGCCCACCAGCGCATGG + Exonic
1162498226 19:11035278-11035300 CATCCCTGGCCCACATCGGAAGG - Intronic
1163547500 19:17948589-17948611 CCTCCCTGGCGCGCATCCCCAGG - Intergenic
1163811416 19:19434824-19434846 TCTCTCTGGACAGCATCCCATGG + Intronic
1164618693 19:29681301-29681323 CCTCCATGGCCCCCAACCCATGG + Intergenic
1165157185 19:33795943-33795965 GCTCCCTGGCCGCCCTCCCAGGG - Intronic
1165764587 19:38342883-38342905 CATGCCTGGACAACCTCCCAGGG - Intronic
1166032337 19:40141616-40141638 CCAGCCTGGCCAACATGGCATGG + Intergenic
1166698274 19:44866729-44866751 CCTCCCTGGGCAAAAGCCAAAGG - Intronic
1166883196 19:45941362-45941384 CCAGCCTGGGCAACATCGCAAGG - Intronic
1167304762 19:48701372-48701394 CCAACCTGGCCAACATGACAAGG - Intronic
1167509234 19:49887622-49887644 CCTCTCCGCCCAACCTCCCAGGG - Intronic
1168172060 19:54595778-54595800 GCTCCCTGGCCCACAGCCCCAGG + Exonic
1168561798 19:57390408-57390430 CCTCCCTTGACAACCTTCCATGG - Intronic
1168654374 19:58117142-58117164 CGTCTCTGTCCAAAATCCCATGG - Intronic
925429791 2:3781217-3781239 CCTTCCTGGCCAATAGGCCACGG + Intronic
925838339 2:7966817-7966839 CCTCCTTGCCCAACCTGCCAGGG + Intergenic
925957045 2:8977024-8977046 TCTCCCTGGCCTCCATCCCCAGG - Intronic
926449395 2:12983914-12983936 CTTCCCTGGACAACATCAGAGGG - Intergenic
926971118 2:18468472-18468494 CCTCCATGGCCACTACCCCAGGG - Intergenic
927869832 2:26616403-26616425 CCTCCCAGGCTCCCATCCCAAGG - Intronic
928376228 2:30776878-30776900 CCTGCCTGGCCACCAGCCAAGGG - Intronic
930041415 2:47128254-47128276 CCTCTATGGCCAATATCCCTGGG + Intronic
935937324 2:108200767-108200789 CCTCCCTGTGCAAGTTCCCATGG - Intergenic
936166081 2:110120792-110120814 CCGCCCTGGCCGCCCTCCCATGG + Intergenic
936455994 2:112674799-112674821 TCTCCCTGGCCCCCATCCCTGGG + Intergenic
937229785 2:120390865-120390887 CCGCCTTGGCCACCATCCCAGGG - Intergenic
937232634 2:120407029-120407051 CCTCCCTGACCCACACCCCATGG - Intergenic
937442208 2:121926183-121926205 CCTCCCTTCCCACAATCCCATGG + Intergenic
937521710 2:122720534-122720556 CCCCTCTGGCCACCCTCCCAAGG - Intergenic
937967182 2:127522209-127522231 CATCCCTGGCAAAGACCCCAAGG - Intronic
941848410 2:170154705-170154727 CCTCCCTGGTCAACATGGCAAGG - Intergenic
941853245 2:170205459-170205481 CCACCCTGGCTCACATCTCAGGG - Intronic
943044159 2:182838510-182838532 CCTCTCTGGTAAACATTCCACGG - Exonic
944532351 2:200679884-200679906 CCTGCCTGGGCAACATAGCAAGG + Intergenic
944709261 2:202321050-202321072 TCTCCCTCACCACCATCCCACGG + Intergenic
947463758 2:230324036-230324058 CCTCCCTGGCCCACTCACCAGGG - Intergenic
947472579 2:230412476-230412498 CCTCCCTGGCCCACTCACCAGGG - Intergenic
947573649 2:231255476-231255498 TCTCCCTGACCAAACTCCCAGGG - Intronic
947937083 2:234016497-234016519 CTTCCCTGGCCACTACCCCAGGG - Intronic
948137105 2:235644641-235644663 CCTCTCTTGCCAAGATCCCCTGG - Intronic
948840882 2:240648316-240648338 CCTCCCAGCAGAACATCCCAGGG + Intergenic
948880467 2:240854732-240854754 CCACCCTGGCCTGCATCTCAGGG - Intergenic
949042086 2:241854149-241854171 CCTCACTGGGCACCCTCCCAGGG + Intronic
1169434674 20:5575440-5575462 CCTCGATGGCCAACATCCAATGG + Exonic
1170742837 20:19073088-19073110 CTTCCCTGTCCCACATCTCATGG - Intergenic
1171226308 20:23444501-23444523 CCTGCCTGGCCCACATGACAGGG + Intronic
1172971458 20:38875858-38875880 CCTTCCTGGCCACGATCCCAGGG + Intronic
1173552396 20:43941730-43941752 TCTTCCTGTGCAACATCCCAAGG - Intronic
1177804166 21:25857468-25857490 TCCCACTGGCAAACATCCCAAGG - Intergenic
1177807631 21:25889595-25889617 CCGCCCTCCCCAACCTCCCAAGG - Intronic
1180958674 22:19752351-19752373 GCTCCCTGGCCAAGCCCCCAAGG - Intergenic
1181141396 22:20807820-20807842 CCACACTGTCCATCATCCCAAGG + Intronic
1181425700 22:22836905-22836927 CCTCCCTGCTCAACCTCCCAAGG + Intronic
1181695932 22:24592819-24592841 CCTCCCTGGCCGCCAGCCCAGGG + Intronic
1182122958 22:27798781-27798803 CCGCCCTGGCCCACGTCCCCGGG + Exonic
1182419898 22:30243897-30243919 CCTCCCTGGGCAACATCACCCGG - Exonic
1183126287 22:35784762-35784784 CCTCCCGGGGCAAAAGCCCATGG - Intronic
1183921668 22:41174318-41174340 CCTCCCACCCCAGCATCCCAAGG - Intronic
1183984385 22:41561595-41561617 CTTCCCAGCCCAACATTCCAGGG - Intronic
1184291140 22:43498741-43498763 CCACCCAGCCCAACATCCCCAGG + Intronic
1184658734 22:45955542-45955564 CCTTCCTGGCCAACCTTCCCTGG - Intronic
1184692273 22:46122788-46122810 CCGGCCTGGCCACCATCGCAGGG + Intergenic
1184700885 22:46171821-46171843 CCTCGCTGGTCCCCATCCCATGG - Intronic
1184748598 22:46471589-46471611 CCAGCCTGGGCAACATCGCACGG - Intronic
1185246773 22:49776897-49776919 CCACCCTGGCCAACCTCCCGGGG - Intronic
1185271306 22:49930382-49930404 CCTCCCTGTCTAACATGCCTTGG - Intergenic
1185338668 22:50282126-50282148 CCTTCCTGGGCACGATCCCATGG + Intronic
1185392555 22:50570517-50570539 GCTCCCTGGCCACCACCCCGTGG + Intronic
951195113 3:19814913-19814935 CCTGCCTGGCCATCATTCCCTGG - Intergenic
953872427 3:46638876-46638898 ACACCCTGGCAAAGATCCCATGG - Intergenic
954328563 3:49877093-49877115 CCTCCCAGGCCTGCATCCCTGGG - Intergenic
954640923 3:52097270-52097292 CCACCCTGGCCCAGATCCCCTGG + Intronic
954677381 3:52323386-52323408 CCTCCCTGGCCTAAAGCCTAAGG - Intronic
955643732 3:61114197-61114219 CTCCACTGGCCAACATCCCTTGG - Intronic
956884836 3:73548537-73548559 CCTCTCCAGCCCACATCCCAGGG - Intronic
960149131 3:114232738-114232760 CCTCTCTGGCCCCCAGCCCAGGG + Intergenic
961930604 3:130529061-130529083 CCAGCCTGGGCAACATCCCCAGG + Intergenic
962128276 3:132645796-132645818 CCTCCCTGGCAATCATATCAAGG + Intronic
962436595 3:135372606-135372628 CCTCCTTGTGCATCATCCCATGG - Intergenic
968655849 4:1778164-1778186 CCTGCCTGGCCAAGCCCCCAGGG + Intergenic
968821194 4:2852899-2852921 CCTGCCTGGGCAACATAGCAAGG - Intronic
969365161 4:6690007-6690029 CCTCACTGTCCCACATCCCAAGG + Intergenic
969554167 4:7894877-7894899 CCTCCCTGGAGATCAGCCCATGG - Intronic
970007226 4:11423428-11423450 GCTCCCTGGCTAACAGCCTAAGG + Intronic
971276189 4:25199338-25199360 CCTGCATAGCCAACTTCCCAGGG + Intronic
973260343 4:48157479-48157501 CCACCCTGTGCCACATCCCAAGG + Intronic
973270751 4:48260386-48260408 CCAACCTGGCCAACATAGCAAGG + Intronic
973964946 4:56152436-56152458 CCAGCCTGGACAACATACCAAGG + Intergenic
978582487 4:110246305-110246327 CCATCCTGGCTAACATCACATGG + Intergenic
978705874 4:111710586-111710608 TCTCCCTGGCCAACATAGCCAGG + Intergenic
980013668 4:127623536-127623558 CCTCCCTCGCCAACATTTCCGGG - Intronic
981089579 4:140718881-140718903 CCAGCCTGGCCAACATGGCAAGG + Intronic
981256946 4:142673013-142673035 GCACCCTTGCCAACATCACATGG + Intronic
982164813 4:152604872-152604894 CCTGCCAGGCAAACAGCCCATGG + Intergenic
983266312 4:165511886-165511908 CCAGCCTGGCCAACATGGCAAGG - Intergenic
983379104 4:166968572-166968594 CCTGCATGCCCAACATCACATGG - Intronic
984065793 4:175046194-175046216 CCTTCCTGGCATACATTCCATGG - Intergenic
984179712 4:176467143-176467165 GGTCCCTGGCGAGCATCCCACGG - Intergenic
984311620 4:178067973-178067995 CATCCCTGCCCCCCATCCCATGG - Intergenic
985113491 4:186569492-186569514 CCACCCTGAGCAACATCGCAAGG + Intergenic
985677358 5:1238932-1238954 ACTCCCTGCCCAGCATCCCGAGG + Intronic
985682834 5:1265433-1265455 CCTCCCTGGCCAGCACCCTCAGG + Intronic
986569611 5:9151584-9151606 CCTCCCTAGTTAACATTCCATGG - Intronic
988621503 5:32828277-32828299 CCCCACTGGCCTACATACCATGG - Intergenic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
991181254 5:63753525-63753547 CTTGTCTGGCCCACATCCCAGGG + Intergenic
992750254 5:79854713-79854735 CCTCCCTGCCCAGCAGCCCGGGG - Intergenic
994181825 5:96775842-96775864 CCCCACTGACCAACATCCAAAGG + Intronic
994197337 5:96935462-96935484 CCTCCGCGGCCAACCTCCCCAGG + Exonic
995111166 5:108429773-108429795 CCAGCCTGGCCAACATATCAAGG + Intergenic
998367082 5:141638470-141638492 CCTCCCTGACCAACAGACCCAGG + Intronic
1001394765 5:171409699-171409721 CCAGCCTGGCCAACATGGCAAGG - Intronic
1001560117 5:172663544-172663566 CAGCCCTGGCCCAAATCCCATGG - Intronic
1001717358 5:173827276-173827298 CCTCCTTGGTCAACATGGCAAGG - Intergenic
1001758220 5:174186850-174186872 CCTCCCTGCCCAAATTCTCAGGG - Intronic
1002793653 6:452968-452990 CTTGCCTTGCCAACATCCCCAGG - Intergenic
1002897667 6:1389098-1389120 CCTCCCTGGCCGCCCTCCCCAGG - Intergenic
1004224612 6:13774170-13774192 CCTCCCTGGCAACCACCCCAGGG - Intergenic
1005122869 6:22409971-22409993 CCTCCCTGCCCCTTATCCCAAGG + Intergenic
1006934231 6:37706014-37706036 CCTCCATGCCCACCATCCCAGGG + Intergenic
1006945096 6:37779522-37779544 CCTCCCAGGCCACCACCCCTGGG - Intergenic
1007425976 6:41746378-41746400 CCACCCAGGCCAACTTCCCGTGG - Intronic
1007720486 6:43882321-43882343 CCTCCCTGGAGAGCTTCCCATGG + Intergenic
1010044462 6:71425001-71425023 CCACCCTGGACAACATAGCAAGG - Intergenic
1010713654 6:79204431-79204453 CAGCCCTGGCCAGCTTCCCAGGG + Intronic
1011529722 6:88308500-88308522 CCACCCTGGCCAACATGGTAAGG - Intergenic
1011717014 6:90117091-90117113 TCTCTCTGGCCAACTTCTCAAGG + Intronic
1013042959 6:106454385-106454407 CCTCCCTGGCCAATATTACTGGG + Intergenic
1015823304 6:137285432-137285454 CCACCCTGGGCAACATAGCAAGG + Intergenic
1016417045 6:143843676-143843698 CCTCTCCGGGCCACATCCCAGGG - Intronic
1016684594 6:146866984-146867006 CCTCCCTGGCTAACACTCAAAGG + Intergenic
1018816562 6:167336948-167336970 CCTGATTGGCCATCATCCCAGGG - Intronic
1019015491 6:168876990-168877012 GTTCCCAGGCCAACATCTCACGG - Intergenic
1019030257 6:169004077-169004099 CCTCCCTGTGCAAGTTCCCATGG + Intergenic
1022738631 7:33100079-33100101 GCTCCCTGGCCAAGGTGCCAGGG - Intronic
1022979867 7:35594365-35594387 CCTCCCTGCTCACCTTCCCAAGG + Intergenic
1023038127 7:36150681-36150703 CCTCCCTCCCCATCATCCCCAGG + Intergenic
1023310042 7:38877058-38877080 CCTCTCTTGCCAATATCCCTTGG + Intronic
1023441903 7:40193160-40193182 CATGCCTGGGCAACATACCAAGG - Intronic
1023985784 7:45094608-45094630 CCACCCTGGCCAACACAGCAAGG + Intergenic
1024094577 7:45973771-45973793 CCCACCTGGCCAACAACCTAAGG - Intergenic
1024881826 7:54095426-54095448 CCTCCCTGGACCACCTTCCAGGG - Intergenic
1025224865 7:57149320-57149342 CCTCGATGGCCAACATCCAATGG + Intergenic
1027194367 7:76019497-76019519 CCACCCTGGGCAACATAGCAAGG - Intronic
1027241376 7:76331806-76331828 CCAGCCTGGCCAACATAACAAGG + Intronic
1027387952 7:77677124-77677146 CCAGCCTGGCCAACATGACATGG - Intergenic
1029287331 7:99474790-99474812 CCACCCTGGGCAACATAGCAAGG + Intronic
1029399921 7:100337576-100337598 CCTTCCCCACCAACATCCCAGGG + Intronic
1029458226 7:100681678-100681700 CTGCCCTGGCCTACAGCCCAGGG + Exonic
1029491710 7:100874328-100874350 CCTGCCTGGGCAACATAGCAAGG - Intergenic
1029539950 7:101176820-101176842 CCTCATTAACCAACATCCCAAGG + Intronic
1032082438 7:128866396-128866418 CTTCCCTGGCCACCATGTCACGG + Intronic
1032677054 7:134140897-134140919 CCTCCCTGCCCAGCTTCCCCAGG + Intronic
1034909957 7:154987737-154987759 CCTCCCTGTGCCAGATCCCATGG - Intronic
1034949008 7:155284559-155284581 CCTCCGTGTCCAAGCTCCCAGGG + Intergenic
1036564098 8:9923494-9923516 CCTCTCTGCCCCACACCCCAGGG + Intergenic
1037991507 8:23324439-23324461 CCACCCTGCCCAACCCCCCACGG - Intronic
1038262011 8:26003708-26003730 CCACCCTGGCCATGATCCCTGGG + Intronic
1038326419 8:26576475-26576497 CCTGCCAGGGCAACCTCCCACGG + Intronic
1038485796 8:27934344-27934366 CCTCCCAGGTCGAAATCCCAGGG - Intronic
1039279436 8:35967379-35967401 CCACCCTGGGCAACATAGCAAGG + Intergenic
1039630180 8:39102503-39102525 GCACCCTGGCAAACATCTCAGGG + Intronic
1039893949 8:41703024-41703046 CCAGCCTGGCCAACACTCCAGGG - Intronic
1039967154 8:42291728-42291750 CCAGCCTGGGCAACATACCAAGG + Intronic
1040816737 8:51515595-51515617 CCTCCCTCGTGAACATCTCACGG + Intronic
1041144510 8:54859804-54859826 CCTCCCTTGCCAGCAGCACATGG + Intergenic
1041296550 8:56362832-56362854 CCTCCCTGGCCACAGGCCCAAGG - Intergenic
1042655575 8:71091872-71091894 CCACCCTGTCCCACATACCAAGG - Intergenic
1047212849 8:122853853-122853875 CCTCACTGTTCAACATTCCAAGG - Intronic
1048715607 8:137265283-137265305 CTTCCCTTGCCAACATGCCTGGG - Intergenic
1049352398 8:142171210-142171232 ACTCCCTGGTCAGCACCCCAGGG - Intergenic
1049408176 8:142460857-142460879 ACTCCCTCGCCATCACCCCAGGG + Intronic
1049592513 8:143469018-143469040 CCTCCCTGGCCAGGCTCCCCAGG + Intronic
1052175657 9:25459774-25459796 CCTCCCTGACTAGCATCCTAGGG + Intergenic
1052995586 9:34550229-34550251 CCTCCCAGGGCACGATCCCAAGG + Intergenic
1053072186 9:35108007-35108029 CCTCTCTGGCCCCCAGCCCAGGG + Exonic
1053309425 9:37007045-37007067 CCTCCCTTGGCAACTTCCTAGGG - Intronic
1053382517 9:37660425-37660447 CCTTCCTGGTCATCATCCGATGG + Intronic
1056423968 9:86457723-86457745 CCTCCCTGGCCTACATCCCAGGG - Intergenic
1057271006 9:93651512-93651534 CCTGCTTGGCCAACATCCTTGGG - Intronic
1059451916 9:114376243-114376265 CCCCACTGGCCTCCATCCCAGGG + Intronic
1060895587 9:127215214-127215236 CCTCCCTGCCCCACAACCCTTGG + Intronic
1061203668 9:129151009-129151031 CCTCCATGGCCCATCTCCCAGGG - Intergenic
1061307304 9:129739575-129739597 CCTCCTTGGCCACCAGACCATGG - Exonic
1061504961 9:131026577-131026599 CCTCCCTGACCTGCAGCCCAGGG - Exonic
1061858435 9:133455697-133455719 CCTCCCAGGCACACAACCCAGGG - Intronic
1061918689 9:133770310-133770332 CTGCCCTGGCCCACTTCCCAGGG - Intronic
1062088847 9:134663439-134663461 CCGCCCTGGCCAACCTGGCAGGG + Intronic
1062248784 9:135583969-135583991 CTTCCCAGGCCAGCAGCCCAGGG - Intergenic
1062322087 9:135995071-135995093 CCTCCCTGGCCGCCACCCCCAGG + Intergenic
1062349089 9:136130408-136130430 CCTCCCTGTCCATCCCCCCAGGG - Intergenic
1185802029 X:3020088-3020110 CCAGCCTGGGCAACATACCAAGG + Intronic
1186437762 X:9557657-9557679 TCTCCCTGTCCAGCATCCAAAGG - Intronic
1188117865 X:26267383-26267405 CCACCCTGGCCAACACAACACGG + Intergenic
1194036980 X:88887022-88887044 CCTCTCTGGCCACCACCCCTGGG + Intergenic
1195687916 X:107602290-107602312 CCTCCCTGGGCAGCATGCCCAGG - Exonic
1195860064 X:109373969-109373991 CCTCCCTGGCCAACCCCACAGGG + Intronic
1198242528 X:134799765-134799787 CCAGCCTGGCCAACATAACATGG + Intronic
1199896354 X:152131057-152131079 GCACCCTTGCCAGCATCCCAGGG - Intergenic
1200226569 X:154420826-154420848 CCTCCCAGGGCACCCTCCCAGGG + Intronic