ID: 1081937201

View in Genome Browser
Species Human (GRCh38)
Location 11:46913155-46913177
Sequence GCTCATCTGTGAGCAAGAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081937192_1081937201 27 Left 1081937192 11:46913105-46913127 CCTATTCCGCATGGGGAAACAGG 0: 1
1: 0
2: 0
3: 6
4: 86
Right 1081937201 11:46913155-46913177 GCTCATCTGTGAGCAAGAATGGG 0: 1
1: 0
2: 1
3: 17
4: 143
1081937195_1081937201 21 Left 1081937195 11:46913111-46913133 CCGCATGGGGAAACAGGGTGTCA 0: 1
1: 0
2: 0
3: 20
4: 198
Right 1081937201 11:46913155-46913177 GCTCATCTGTGAGCAAGAATGGG 0: 1
1: 0
2: 1
3: 17
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081937201 Original CRISPR GCTCATCTGTGAGCAAGAAT GGG Intronic
900718258 1:4158846-4158868 GCTGGTCTGTCAGCAAGAGTGGG + Intergenic
901379985 1:8866581-8866603 GCTCATCTGTGAGCTAGATTGGG - Intronic
907619863 1:55966195-55966217 GCTCATCTCTGAGACAGAAAGGG + Intergenic
908597730 1:65706678-65706700 CTTCATCTGTGAGGAAGTATAGG + Intergenic
910021976 1:82602663-82602685 GAGCATCTGTGACCAAGAAAAGG + Intergenic
910086009 1:83403542-83403564 ACTCATCTGTGAAAAAGAAAGGG + Intergenic
914354798 1:146875304-146875326 GCTGATCTGTGAGGAGGAAATGG - Intergenic
916229560 1:162527096-162527118 GTTCTTCTGTGATTAAGAATGGG - Exonic
917640275 1:176976842-176976864 GTTCATTTGTGAGCAAAGATGGG - Intronic
919619446 1:199848361-199848383 GCTCATCTGTGGGCAAGACCTGG - Intergenic
923339979 1:232998797-232998819 CCACATCTGTTAGCAAGAACTGG - Intronic
924643855 1:245858780-245858802 GCTCATCTGTGAAAAATAACGGG - Intronic
1063439106 10:6057720-6057742 GCTCATCCTTGGGCAAGAAGAGG + Intronic
1063648222 10:7907342-7907364 TCTCATCTGCCAGCAAGGATAGG - Intronic
1063691672 10:8293372-8293394 GCTCATCTATGAGCGATAACAGG - Intergenic
1064558735 10:16574315-16574337 GATCACCTGTGAACAAAAATTGG - Intergenic
1064694534 10:17952167-17952189 GCTCATCTCTGGGCCAGGATCGG + Intronic
1065806044 10:29394597-29394619 GCTCCTCTGGGAGCAAGGAGAGG - Intergenic
1069560125 10:69423343-69423365 GCTCATCTCTGGGCAGGAAATGG - Intergenic
1070200359 10:74198689-74198711 GCTCATCTAGCAGCAAGAAATGG - Intronic
1071921201 10:90352495-90352517 GCTCACGTGTCAGGAAGAATAGG - Intergenic
1072234803 10:93444509-93444531 GCTCATGTGAGTGTAAGAATGGG - Intronic
1073316301 10:102583225-102583247 GCTCTTCTGTGGACAAGAAATGG - Intronic
1075338640 10:121627536-121627558 TCTCATCTGTGAGCTAGAGCCGG + Intergenic
1081199316 11:40197441-40197463 GGTCATTTCTGAGCAAGAAAAGG - Intronic
1081937201 11:46913155-46913177 GCTCATCTGTGAGCAAGAATGGG + Intronic
1085046768 11:73358086-73358108 AGTCAGCTGTGAGCAAGAATGGG + Intronic
1086949161 11:92873665-92873687 GCTCTTCTTTGAGCAAGGAAAGG + Intronic
1090940410 11:131383001-131383023 GATCACCTGTGAGCAAGGATAGG - Intronic
1093514160 12:19965978-19966000 GCTCATCTCTGAGCATAAAATGG - Intergenic
1097307906 12:58089314-58089336 GCTCATCTGGCTGCAAGAATAGG - Intergenic
1099081699 12:78191656-78191678 GCTCTTCTCTGAGCAAAAGTAGG + Intronic
1102718543 12:114996177-114996199 TCTCATCTGAAAGCAGGAATGGG - Intergenic
1104247036 12:127053548-127053570 GCTCATCCCTGAGCCGGAATGGG + Intergenic
1108619132 13:52164027-52164049 GTTCATATCTGAGCAAGAACGGG - Intergenic
1108639904 13:52373454-52373476 GTTCATATTTGAGCAAGAATGGG - Intergenic
1109583576 13:64370925-64370947 GCTCCCCTGTGACCCAGAATTGG + Intergenic
1110477892 13:75939350-75939372 GCTCAGCAGTGAGCTAGAAGTGG + Intergenic
1111868299 13:93797606-93797628 GCTCCTCTGTAAGTAATAATGGG - Intronic
1111922689 13:94429067-94429089 GTTCATCTCTTAGAAAGAATTGG + Intergenic
1113459921 13:110474645-110474667 GATCATGTGTGAGCATGCATAGG - Intronic
1113560324 13:111273597-111273619 GCTCATATGAGAGCAGGAACGGG + Intronic
1113612156 13:111654785-111654807 CCTCAGCCGTGAGCAAGAAGAGG + Intronic
1113766678 13:112885906-112885928 GCTGCTCTGTGAGCAAGGCTTGG + Exonic
1117450760 14:55847311-55847333 GCTCATAAGTGAGTCAGAATTGG - Intergenic
1118062906 14:62160358-62160380 GCTCATCTGTGTTTAGGAATCGG - Intergenic
1122606353 14:102949209-102949231 GCTCATCTGTTAGTGAGAAGAGG - Intronic
1125151117 15:36533403-36533425 TCCCATCTGTCAGCAACAATGGG + Intergenic
1126681372 15:51205461-51205483 ACTCATCTGTGAGCTGGATTGGG - Intergenic
1129788289 15:78323423-78323445 CCTGCTCTGTTAGCAAGAATCGG + Intergenic
1129949694 15:79574867-79574889 GCTCATATGTGAGCAACACTTGG - Intergenic
1137591104 16:49694513-49694535 GCTCATCTGCAAGCAGGGATTGG + Intronic
1139537728 16:67588592-67588614 GCTCATCTGTGAGTCAACATTGG - Intronic
1139979222 16:70840228-70840250 GCTGATCTGTGAGGAGGAAATGG + Exonic
1140693998 16:77513743-77513765 GGTCATCTTTGACCAGGAATGGG + Intergenic
1143322359 17:6076380-6076402 GATCAGCTGTGAGCAAGAGTGGG + Intronic
1146983441 17:37188546-37188568 GCTCATATTTGAGAAAGAAGGGG + Intronic
1149342281 17:55699273-55699295 GCTCATCTGTGTTCAGGAATGGG + Intergenic
1149726276 17:58897732-58897754 GCTCAGCTATGTGCAAGATTAGG + Intronic
1150135291 17:62692095-62692117 GCTCAGCTGTGGGCAAGAGGAGG - Exonic
1151532047 17:74712818-74712840 GCTCACCTGAGAGCCAGAAGAGG + Exonic
1154412249 18:14147824-14147846 GCTCATCTCCGAGCACGTATGGG - Intergenic
1157530731 18:48418529-48418551 CCTCATCTGTGTGCAAGGAGTGG + Intergenic
1158420881 18:57292658-57292680 GCTCAACTTTAAGCAACAATAGG + Intergenic
1160227556 18:77023140-77023162 GACCATCTGTGAGCAACAACAGG + Intronic
1162700958 19:12514150-12514172 GCTCATCTGTGACCTGGAAGAGG - Intronic
1165090869 19:33387851-33387873 GATGTTCTGGGAGCAAGAATGGG + Intronic
1165335882 19:35169360-35169382 GCTCATCTGTGAGCCTGTGTGGG + Intronic
1165773710 19:38392748-38392770 TCTCATCTGTCAGCAAATATTGG + Intronic
1166368530 19:42289369-42289391 GGTCATCTGTGAGGAGGAAGGGG + Exonic
926175250 2:10585431-10585453 TTTCATCTATGTGCAAGAATTGG - Intronic
926333054 2:11841136-11841158 GCTCTGAAGTGAGCAAGAATGGG - Intergenic
928828945 2:35455481-35455503 GCTCTTCAGTTAGCAAGACTGGG + Intergenic
929210625 2:39353183-39353205 TCTCATCTATAACCAAGAATGGG + Intronic
931744161 2:65277377-65277399 GTTCCTTTGTGAGCAAGATTAGG - Intergenic
932567484 2:72918671-72918693 GCTCAGCTGGGAGAGAGAATTGG - Intronic
935374462 2:102380618-102380640 GCAGATATGTGAGCAAGAACAGG - Intronic
939081674 2:137670264-137670286 GCTCATCTATGAGTAGGAAAGGG - Intronic
940894509 2:159067609-159067631 GCTCATCTGTCACCAATCATGGG + Intronic
944013153 2:194999115-194999137 GTTCATTTGTGAGTAAAAATTGG + Intergenic
946884453 2:224209282-224209304 GCTCTTCCATCAGCAAGAATGGG + Intergenic
947103258 2:226644155-226644177 GCTCATCTGTGGGAGAGAAAGGG - Intergenic
947227749 2:227856718-227856740 TCTGAGCTGTGAGAAAGAATGGG - Intergenic
1171962091 20:31502222-31502244 ACACATCTGTGAGCAGGACTGGG + Intergenic
1175264006 20:57691769-57691791 GCTCCTCTGTGAGCATGAAATGG - Intronic
1176860760 21:14010433-14010455 GCTCATCTCGGAGCACGTATGGG + Intergenic
1179541328 21:42085053-42085075 GCTCACCTCTGAGCAGGGATCGG + Intronic
1182037331 22:27209557-27209579 TTTCAGCTGTGAACAAGAATGGG - Intergenic
1182480765 22:30607295-30607317 GGTGAGCAGTGAGCAAGAATCGG - Exonic
1183386212 22:37516251-37516273 GCACCTCTGTCATCAAGAATTGG + Exonic
1183786289 22:40030918-40030940 GCTGATGTGAGAGCAAGAAAAGG + Exonic
950155639 3:10719663-10719685 GCACATATGTGTGCATGAATGGG + Intergenic
952625230 3:35394974-35394996 GCTCACCTATGTCCAAGAATAGG + Intergenic
954123750 3:48516762-48516784 GCTCCTCTGTGGGCAAGATGGGG - Intergenic
957358800 3:79127216-79127238 CCACATCAGTGAGAAAGAATGGG + Intronic
958086413 3:88813861-88813883 ACTCTTCTGTGAACAAGAAAGGG + Intergenic
959110429 3:102116149-102116171 GGTGATCTCTGAGCAAGTATGGG + Intronic
962393278 3:134992076-134992098 GGTCACCTGTGAGGAAAAATTGG + Intronic
974392012 4:61283387-61283409 TCTCAACTGTGTTCAAGAATAGG + Intronic
974611121 4:64217757-64217779 ACTCACCTGTCAGCCAGAATGGG + Intergenic
984282545 4:177689283-177689305 TCCCATCTTAGAGCAAGAATTGG - Intergenic
985130286 4:186732298-186732320 GCTCATTGGTCAGCAGGAATTGG + Intergenic
985706194 5:1402810-1402832 GGTCATCTGTGACCAAGAGGAGG - Intronic
987217925 5:15757916-15757938 GCTCATCTGTAAACGAAAATAGG - Intronic
990527565 5:56643005-56643027 TCTCATCTATAATCAAGAATGGG + Intergenic
993036468 5:82762856-82762878 GCTCATCTGTGGGCCACACTTGG + Intergenic
993242404 5:85407646-85407668 GCTCATCTGTGACAAGGAAGTGG + Intergenic
995658840 5:114458404-114458426 GCTCATCAGTGAACATAAATTGG - Intronic
995832914 5:116373492-116373514 TCTCATCTGTGAGAAGGAGTAGG - Intronic
996927426 5:128844877-128844899 TCTCAGCTGTGAGAAATAATCGG - Intronic
999540661 5:152568743-152568765 GCTTATGTTTGGGCAAGAATAGG + Intergenic
1000208356 5:159084676-159084698 TCTCATGTGTGAGCAAGACTCGG + Exonic
1001408990 5:171496819-171496841 GCTCATTTCAGAGCAAGAGTTGG - Intergenic
1008478592 6:51960377-51960399 ACTCATCTGTTAGGTAGAATGGG - Intronic
1008556147 6:52674708-52674730 GCTCATCTGTGGCCGAGAAGTGG - Intronic
1009405410 6:63306250-63306272 GGTCATATCTGAGGAAGAATAGG + Intronic
1009994441 6:70882788-70882810 GGCCATCTGTGAGCAAGGAGAGG + Intronic
1010371133 6:75108580-75108602 GCTCCTCTGTGAGCAAATGTGGG + Intronic
1012327505 6:97940633-97940655 GTTCATCTGTGGGAAAGAAAGGG - Intergenic
1018522693 6:164668931-164668953 GCTCATCACTGATAAAGAATGGG + Intergenic
1019056114 6:169224689-169224711 GCTCAGCAGTGAGCATGAATAGG - Intronic
1020358945 7:7306410-7306432 GCTCACCTGTGGACTAGAATAGG - Intergenic
1021837623 7:24695958-24695980 GCTGAGCTGTGTGCCAGAATGGG - Intergenic
1021942139 7:25688364-25688386 GGTCATCTGCAAGCAAGAAAGGG + Intergenic
1022517326 7:30984249-30984271 GCTCCTCTGTGAGAAAGAGGAGG + Intronic
1022871406 7:34483739-34483761 GCCCATAGGTGAGCAAGAGTTGG + Intergenic
1023525532 7:41098674-41098696 GATCATCTGAGAGCCAGCATCGG - Intergenic
1027744524 7:82056785-82056807 CCTCATCTGTGAACAAGAAAGGG - Intronic
1028260597 7:88659445-88659467 CCTCTTCTGTGATGAAGAATTGG + Intergenic
1029601119 7:101563965-101563987 GCTCAGCTGTGAGCCAGGAGGGG - Intergenic
1031082601 7:117272929-117272951 GCTCATCTGAGAGGAAAAAGTGG + Intergenic
1034887898 7:154812505-154812527 GGTCATCTGTGACCCAGAAGAGG - Intronic
1035650313 8:1259073-1259095 GCTCGTCTCTGAAGAAGAATTGG + Intergenic
1036068325 8:5410242-5410264 GCTCATGCGTAAGCAAAAATAGG - Intergenic
1036791532 8:11724511-11724533 CCTCATCTCTGAGTAACAATAGG + Intronic
1038170945 8:25131445-25131467 GCATATCTGTGAGAGAGAATGGG + Intergenic
1038621492 8:29147504-29147526 GCTTATGTATGAGCACGAATTGG - Exonic
1039593490 8:38770128-38770150 GCTGCTCTGTGAGGAAGGATGGG - Intronic
1041836352 8:62220306-62220328 GCTTATATGTGAGCAAAAACAGG + Intergenic
1042119123 8:65465585-65465607 GTTCCTCTGAGAGCAAGAAAAGG - Intergenic
1042462525 8:69087050-69087072 GCTCAGCTGTAGCCAAGAATTGG + Intergenic
1046065289 8:109189356-109189378 CCTCATCTGTAAGAAAGAAATGG - Intergenic
1047925860 8:129682049-129682071 ACTCATCTGTGAGCCACAAAGGG - Intergenic
1048196003 8:132332260-132332282 TCTCATCTGAGAGCTAGAGTGGG - Intronic
1048305288 8:133279750-133279772 CCTCAGCTGTGTCCAAGAATAGG - Intronic
1048925249 8:139265607-139265629 GCTGATATGTGAGCCAGAATAGG + Intergenic
1050775142 9:9250309-9250331 TCTCATCTGTGAAGAAGTATAGG + Intronic
1051138974 9:13956909-13956931 GCTCATCTGTGGGCTAGGTTTGG - Intergenic
1053035462 9:34823708-34823730 GCTGCCCTGAGAGCAAGAATGGG + Intergenic
1058654147 9:107204420-107204442 TCTCATAGGTGAGCAAGAAAAGG + Intergenic
1058695774 9:107558016-107558038 GCACATCTGTGAGATGGAATTGG + Intergenic
1059012527 9:110477561-110477583 GATCATCTGAGAGTAAGAATGGG - Intronic
1059420031 9:114185079-114185101 GCACATCTGTTAGCAAGATTGGG - Intronic
1187220713 X:17323219-17323241 GCTTATCTTTGATCAAAAATAGG + Intergenic
1187709315 X:22038049-22038071 GCTCATATTTGAGCATGTATCGG + Intronic
1187959846 X:24558133-24558155 GTCCATTTGAGAGCAAGAATGGG + Intronic
1188327739 X:28826771-28826793 TAGCATCTGGGAGCAAGAATAGG - Intronic
1190192151 X:48286193-48286215 GCTCACCTGTGATCAGGAGTTGG + Intergenic
1194327726 X:92540843-92540865 TGTCATCTGTGAGCCAGAATGGG + Intronic
1195387338 X:104325563-104325585 GGTCATCAGTGAGCATGAAAAGG - Intergenic
1200636439 Y:5660061-5660083 TGTCATCTGTGAGCCAGAATGGG + Intronic
1202063235 Y:20910259-20910281 AATCATCTGTGTGCAACAATTGG + Intergenic