ID: 1081938135

View in Genome Browser
Species Human (GRCh38)
Location 11:46918590-46918612
Sequence CTGCGGCGCGGGGGGCGGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1787
Summary {0: 1, 1: 3, 2: 23, 3: 216, 4: 1544}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081938135_1081938150 3 Left 1081938135 11:46918590-46918612 CCGCCCCGCCCCCCGCGCCGCAG 0: 1
1: 3
2: 23
3: 216
4: 1544
Right 1081938150 11:46918616-46918638 CGGCCACCGCCACCGCGCCTGGG 0: 1
1: 1
2: 0
3: 26
4: 246
1081938135_1081938149 2 Left 1081938135 11:46918590-46918612 CCGCCCCGCCCCCCGCGCCGCAG 0: 1
1: 3
2: 23
3: 216
4: 1544
Right 1081938149 11:46918615-46918637 CCGGCCACCGCCACCGCGCCTGG 0: 1
1: 0
2: 32
3: 3421
4: 20254
1081938135_1081938157 25 Left 1081938135 11:46918590-46918612 CCGCCCCGCCCCCCGCGCCGCAG 0: 1
1: 3
2: 23
3: 216
4: 1544
Right 1081938157 11:46918638-46918660 GCCCGCCCCCAGCGCCGGCCCGG 0: 1
1: 0
2: 4
3: 77
4: 529
1081938135_1081938156 20 Left 1081938135 11:46918590-46918612 CCGCCCCGCCCCCCGCGCCGCAG 0: 1
1: 3
2: 23
3: 216
4: 1544
Right 1081938156 11:46918633-46918655 CCTGGGCCCGCCCCCAGCGCCGG 0: 1
1: 0
2: 3
3: 55
4: 534

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081938135 Original CRISPR CTGCGGCGCGGGGGGCGGGG CGG (reversed) Exonic
900091750 1:923866-923888 CCCCGGCGCGGCGGGCGGCGCGG - Intergenic
900091788 1:923987-924009 ACGCGGCCCGGGCGGCGGGGCGG + Intergenic
900091899 1:924341-924363 TTGGGTCGCGGGGGCCGGGGAGG - Intergenic
900095973 1:940298-940320 CCGCGGCGGGGCGGGGGGGGGGG - Intronic
900110108 1:1001717-1001739 CAGGGGCGCGGGGGGCTGCGAGG + Intergenic
900116029 1:1028323-1028345 GTGCAGGGCGGGGGGGGGGGGGG - Intronic
900191779 1:1355171-1355193 CAGCGGCGCGCGGGCCGGGGCGG + Intronic
900237680 1:1600312-1600334 CAGGGGCGCGGGGTGCGGGCAGG + Intergenic
900258060 1:1707379-1707401 CAGCGGCCCGGGGCGAGGGGAGG + Intronic
900344595 1:2204955-2204977 GTGGCGCCCGGGGGGCGGGGCGG - Intronic
900417281 1:2540926-2540948 CGGCGGCGGGGGGCGCGGGGGGG - Intergenic
900549101 1:3245053-3245075 CAGCATCGCAGGGGGCGGGGTGG + Intronic
901019766 1:6249711-6249733 CGGCGGCGCGGGCTGCCGGGGGG + Exonic
901050721 1:6424706-6424728 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
901050753 1:6424830-6424852 CTGCGGGCCGGGAGGCGGAGCGG - Exonic
901109851 1:6785674-6785696 CGGGGGCGCGGCGGGCGGGCGGG + Intronic
901199166 1:7457039-7457061 CGGCGGCGCAGGGGGCGGGGCGG - Intronic
901405036 1:9039765-9039787 CTGCGGCTCGGGAGCTGGGGAGG - Intronic
901433876 1:9234713-9234735 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
901462385 1:9399493-9399515 ACGCTGGGCGGGGGGCGGGGGGG + Intergenic
901659850 1:10792320-10792342 CCGGGGGGGGGGGGGCGGGGGGG - Intronic
901659857 1:10792328-10792350 GTGCGGGGCCGGGGGGGGGGGGG - Intronic
901839415 1:11944705-11944727 CTGCGGTGCTGGGGGAGGAGGGG - Intronic
901872839 1:12148209-12148231 CTGAGGCTCGGGGAGTGGGGGGG + Intergenic
901934516 1:12618373-12618395 CGACGGCGCAGGGGGAGGGGAGG - Intergenic
902315761 1:15617393-15617415 CGGCGGGGCGGGGCGCCGGGCGG + Intergenic
902319693 1:15652443-15652465 CTCCGGAGGGGGGGGGGGGGGGG + Intronic
902444390 1:16452769-16452791 GGGCGGGGCGGCGGGCGGGGGGG - Intronic
902772180 1:18651814-18651836 GTGGGGTGGGGGGGGCGGGGAGG - Intronic
902783121 1:18717020-18717042 CGGCGGAGCGCGGGGAGGGGCGG - Intronic
903078092 1:20787309-20787331 CCGCGGGTAGGGGGGCGGGGCGG - Intronic
903199163 1:21719190-21719212 CGGAGGGACGGGGGGCGGGGGGG + Intronic
903233864 1:21937337-21937359 CGGGGGCGGGGCGGGCGGGGAGG - Intergenic
903251086 1:22053252-22053274 TTGCGGCGGGGGTGGGGGGGCGG + Intronic
903310520 1:22451811-22451833 CCGCGGCGCGTGGGGCAGGTCGG + Intergenic
903324869 1:22563845-22563867 CCTCGGCCCGGGGGGCGGGGTGG + Intronic
903468398 1:23568214-23568236 GGGCTGCGCGGGGGGCGGAGAGG - Intergenic
903555128 1:24187419-24187441 CCCCGCCGCGGGGGGAGGGGGGG + Intronic
903573418 1:24322586-24322608 CGGCGGCCCGGGCGGCGCGGGGG + Intronic
903777071 1:25800161-25800183 GGGCGGGGCCGGGGGCGGGGCGG - Exonic
903777832 1:25804642-25804664 TTGCGGCGGGGGGGGGGGGGCGG - Intronic
903788402 1:25875971-25875993 CTCGGGAGCAGGGGGCGGGGTGG - Intergenic
903883734 1:26529670-26529692 CCGCGCCGCGGGGGCTGGGGCGG + Intergenic
903950544 1:26993810-26993832 CTGCGGCCCGGGGGCCCAGGAGG + Exonic
904037928 1:27568701-27568723 CCGCGGCGCGGGTGCCCGGGAGG + Intronic
904181416 1:28669026-28669048 CGGCGCCGCGGGGGGGTGGGGGG + Intronic
904190058 1:28736691-28736713 CTGGGGCGGTGGGGGCGGGGAGG + Intronic
904215403 1:28914786-28914808 CGGCGGCGCGGGAGCCGGGGCGG + Intronic
904236667 1:29121518-29121540 CTGCGACGCGAGGGTCGCGGCGG - Exonic
904252999 1:29237861-29237883 CTGCGCCCCGGGCGGCCGGGCGG + Intronic
904311600 1:29632820-29632842 CTGAGGGGCTGGGGGCTGGGAGG - Intergenic
904500167 1:30908636-30908658 CCGAGGCGCGGCGCGCGGGGCGG + Exonic
904618946 1:31764135-31764157 CGGGGGAGCGGGGGGCGGCGCGG - Intronic
904784192 1:32973197-32973219 CTACGGCGCAGGGGACGGGAAGG + Intergenic
904944241 1:34187767-34187789 GGGCGGCGGGGGGGGGGGGGTGG - Intronic
905145870 1:35886294-35886316 CTGGGGTAAGGGGGGCGGGGAGG + Intronic
905206194 1:36344090-36344112 CTGCCTCCCGGGGGGTGGGGGGG - Intronic
905399876 1:37693226-37693248 TTGGGGGGCGGCGGGCGGGGCGG + Intronic
905414378 1:37794379-37794401 CGGCGGCGGCGGGGGCGGCGCGG - Exonic
905449319 1:38046745-38046767 GCGCGGCGCAGGGCGCGGGGCGG - Exonic
905617154 1:39409033-39409055 CGGCGGCGCGGGGAAGGGGGAGG + Intronic
905773637 1:40654168-40654190 CAGCGGCGCGGGGGAGGGGCGGG - Intronic
905819626 1:40979644-40979666 CTGGAGGGCGCGGGGCGGGGCGG - Exonic
906128508 1:43442145-43442167 CGGGGGGGCGGGGGGCGGGTAGG + Intronic
906140513 1:43531291-43531313 CTGCCGCGGGGTGAGCGGGGAGG - Intronic
906317923 1:44800177-44800199 CTGCGCCCCGGGGCGCGGCGAGG + Intergenic
906325583 1:44843371-44843393 CGGCGCCGCAGGGGGCGGGGCGG + Intergenic
906627040 1:47333882-47333904 CGGCGCGGCGCGGGGCGGGGCGG - Exonic
906627131 1:47334236-47334258 CTGCCACGCGGGCGGCGCGGTGG - Intronic
906720008 1:47997455-47997477 ACCTGGCGCGGGGGGCGGGGGGG + Intergenic
906942816 1:50271303-50271325 GTGGGGGGCGGGGGGCGGGGTGG - Intergenic
907069180 1:51518929-51518951 CAGCGGCGCGGAGGGCGGCGAGG + Intronic
907080434 1:51617019-51617041 CGGGGCCGCAGGGGGCGGGGCGG - Intronic
907406242 1:54255150-54255172 CGGGGGGGCGGGGGGGGGGGTGG + Intronic
907812907 1:57889893-57889915 CTGGGGCGGGGGGGGGGGAGGGG + Intronic
908131198 1:61077132-61077154 CTGCGGCGGAGGGGGCAGGGAGG - Intronic
909533041 1:76702024-76702046 CAGCGGAGAGGGGGGTGGGGAGG + Intergenic
910237010 1:85047441-85047463 CGCCGGCGCGGGAGGCAGGGTGG + Intronic
910549723 1:88462684-88462706 GGGCGGCGCGGGGAGCGGGCAGG - Intergenic
910927266 1:92410137-92410159 CTGCTGGGCGAGGGGTGGGGTGG - Intergenic
910981223 1:92961509-92961531 CGGCCGGGCAGGGGGCGGGGAGG - Intronic
911081688 1:93939264-93939286 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
911146708 1:94559381-94559403 TTGCGGGGAGGGGGGCTGGGTGG + Intergenic
911150381 1:94592499-94592521 ATGTGGGGCTGGGGGCGGGGTGG - Intergenic
913477586 1:119253118-119253140 GTGGGGGGTGGGGGGCGGGGGGG + Intergenic
913485180 1:119327366-119327388 GTGCGGGGAGGGGGGCGCGGTGG - Intergenic
913521347 1:119648115-119648137 CTGCGGTGCGGGGCTCGGGCCGG - Intergenic
914043953 1:144076721-144076743 AGGCGGCGGGGGGGGAGGGGGGG - Intergenic
914044323 1:144078001-144078023 CCGCGGCGGCGGGGGGGGGGGGG - Intergenic
914133789 1:144882689-144882711 CGGCGGCGGGGGGGGGGGGAGGG + Intergenic
914246126 1:145886868-145886890 ATGCGGGGGCGGGGGCGGGGGGG - Intergenic
914255322 1:145957760-145957782 CAGCGGCGGCGGGGGCGGTGCGG + Exonic
915099811 1:153491169-153491191 GTGCTGAGTGGGGGGCGGGGAGG - Intergenic
915118707 1:153615587-153615609 CTGCGGTGGGGGGTGTGGGGAGG - Intronic
915302845 1:154961502-154961524 GGGCGGCGCAGGGGGCGGTGCGG + Exonic
915309350 1:154999585-154999607 CTGGGGGGCGGGGGGCGTGGGGG + Intergenic
915327071 1:155086105-155086127 CTGCGGGGTGGGGTGCGGGTGGG - Intronic
915359443 1:155277441-155277463 CGCCGGCGCGCGGGGCGGAGGGG - Intronic
915477446 1:156161262-156161284 CCGAGCTGCGGGGGGCGGGGAGG + Intronic
915495417 1:156279220-156279242 CTGGTGGGCGGGGGGTGGGGAGG - Intronic
915511335 1:156388537-156388559 CCGGGGCGCGCGGGGCGGCGCGG - Intergenic
915724529 1:158008149-158008171 CGGCAGCGAGGGGGGTGGGGAGG + Intronic
915794053 1:158708202-158708224 TTGTGGGGTGGGGGGCGGGGGGG - Intergenic
916666991 1:166975578-166975600 CGGAGGCGCGGGAGGCGGTGCGG - Intronic
916890258 1:169106615-169106637 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
917797535 1:178542752-178542774 CTGCAGCGCGCGGGGCCCGGCGG - Intronic
917963819 1:180166141-180166163 CTGGGGGGTGGGGGGCTGGGGGG + Intronic
917975868 1:180237208-180237230 ACTCGGCGGGGGGGGCGGGGAGG + Intronic
919599738 1:199607654-199607676 CTGGGGTGCGGGGAGGGGGGAGG + Intergenic
919667001 1:200301942-200301964 ATGCGGGGACGGGGGCGGGGGGG + Intergenic
919723644 1:200866985-200867007 GTGGGGGGCGGGGGGCGGGGAGG - Intergenic
919810375 1:201405519-201405541 CTGGGCAGCCGGGGGCGGGGGGG - Exonic
919822177 1:201480537-201480559 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
920135987 1:203769770-203769792 GTGCGGGGGGGGGGGCGGCGGGG + Intronic
920171238 1:204073580-204073602 CCGCGACGCGGCGGGCGGGCCGG - Intronic
920184595 1:204152088-204152110 CAGCGGCCCGCGGGCCGGGGCGG - Intergenic
920222217 1:204412046-204412068 CCGGGGCGGGGGGGGGGGGGGGG + Intergenic
920367728 1:205456922-205456944 GGGGGGCGCGGAGGGCGGGGTGG - Intergenic
920385659 1:205568959-205568981 CCGCGGCGGGGAGGGAGGGGCGG - Exonic
920409703 1:205749737-205749759 CAGCGGCGCGGGGCGGGGAGGGG + Intronic
920528482 1:206685273-206685295 CTGCGGCGGCGGGGCCGGGGCGG - Exonic
920733181 1:208507892-208507914 CTGAGGCGAGGGGGTAGGGGTGG + Intergenic
921156843 1:212445652-212445674 CTGCTGTGGGGGGGGCGTGGGGG - Intronic
921189823 1:212699605-212699627 GCGCGCCGCGGGGGGCGAGGAGG - Intronic
921355601 1:214281541-214281563 GGGCGGGGTGGGGGGCGGGGAGG + Intronic
921384041 1:214551738-214551760 CCGCGGCCCTGGGGGCCGGGAGG + Intronic
921509983 1:216016187-216016209 CTGCTGGGGGGTGGGCGGGGAGG + Intronic
922130474 1:222772243-222772265 GTGGGGGGCGGGGGGCGGGGGGG + Intergenic
922440717 1:225653217-225653239 GGGCGGTGCGGGGGGAGGGGAGG + Intergenic
922524540 1:226289831-226289853 CTCCGGGGGGGGGGGTGGGGGGG + Intronic
922539409 1:226407780-226407802 CCGCTGTGCGGGCGGCGGGGCGG - Intronic
922766393 1:228158678-228158700 CCGCGGCGCGGGGGCGGGGGCGG - Exonic
922958612 1:229625999-229626021 CGGCGGGGCGCGGGGCGCGGGGG - Exonic
923014061 1:230112368-230112390 CAGAGGCGCCGGGGGAGGGGGGG + Intronic
923126689 1:231040000-231040022 CTGAGCCGCGGGGGCCCGGGCGG - Exonic
923506461 1:234609781-234609803 CGGCGGGGCGGCGGGCGCGGCGG + Intergenic
923506506 1:234609905-234609927 GTGCGGGGCGGGGGGCGGGGAGG + Intergenic
923506597 1:234610263-234610285 CTTCGGCGCGCGGGGGGAGGGGG - Intergenic
923684136 1:236142388-236142410 CCGGGGCGCGCGGGCCGGGGCGG + Intergenic
923684146 1:236142408-236142430 CGGGGGCGCGCGGGCCGGGGCGG + Intergenic
924551688 1:245084060-245084082 CCGGGGCGCCGGGGGGGGGGCGG - Intronic
924820730 1:247487784-247487806 GTGGGGGGCGGGGGGCGGGGGGG + Intergenic
1062774672 10:135435-135457 GACGGGCGCGGGGGGCGGGGGGG - Intronic
1062932594 10:1362976-1362998 GGGCGGCGCTGGGGGCGCGGGGG - Intronic
1063115597 10:3069182-3069204 CTGCAGGGCGGGCTGCGGGGCGG - Intronic
1063184770 10:3640947-3640969 ACGGGGGGCGGGGGGCGGGGGGG - Intergenic
1063407872 10:5813676-5813698 AGGCGGCGCGCGGGCCGGGGTGG + Intronic
1063446545 10:6121499-6121521 ATGGGGCGGGGGGGGGGGGGGGG + Intergenic
1063624286 10:7675019-7675041 GTGTGGGGGGGGGGGCGGGGGGG - Intergenic
1063665582 10:8058518-8058540 CTTCGGCGGGGTGGGCGGGAAGG - Exonic
1063994969 10:11611173-11611195 GCGCCGCGCGGGGTGCGGGGAGG - Intronic
1064244311 10:13657137-13657159 GGGGGGCGCGGGGGGCGCGGGGG - Exonic
1064244316 10:13657146-13657168 CGGGGGTGCGGGGGGCGCGGGGG - Exonic
1064248534 10:13689195-13689217 TTGCGGGGGGGGGGGGGGGGGGG + Intronic
1064274196 10:13891771-13891793 CCGCGGCGGGGGCGGCGGCGGGG - Intronic
1064552777 10:16520443-16520465 GGGCGGCGGGGAGGGCGGGGAGG - Intronic
1064752400 10:18544391-18544413 CTGTGGAGGGCGGGGCGGGGGGG + Intergenic
1064900235 10:20287973-20287995 TTGCGGCGGGGGAGGGGGGGGGG + Exonic
1065100396 10:22325634-22325656 GTGCGGGGCGGCGGGCGGGCGGG - Intronic
1065177759 10:23095652-23095674 CTGCGCCTCGGCGGGCGGTGCGG + Exonic
1065589776 10:27252564-27252586 CGGCGGCGGCGGGGGCGGCGGGG - Intergenic
1065590384 10:27256815-27256837 CGGGAGCGGGGGGGGCGGGGCGG - Intergenic
1065727941 10:28684396-28684418 CGGCGGGGCAGGGGGCAGGGTGG - Intergenic
1066004459 10:31133962-31133984 CTGCGGGGGAGGGGGCGAGGAGG - Intergenic
1066065622 10:31759508-31759530 CTGCGGTGTGTGGGGCGGGGGGG - Intergenic
1066956350 10:42177326-42177348 CCGCGGCACGTGGGGGGGGGTGG - Intergenic
1066963967 10:42243671-42243693 CAGCGGCGGCGGGGGGGGGGGGG - Intergenic
1067343014 10:45419500-45419522 CTGCGGGGCTGGGGGAGGGCCGG - Intronic
1067711836 10:48656264-48656286 CTGGGGGGGGGGGGGCGGGGGGG + Intronic
1067826719 10:49579393-49579415 CTGCCGGGGGTGGGGCGGGGTGG + Intergenic
1067937483 10:50624032-50624054 CTGCGGCCGGGGGGGCGGGCCGG + Intronic
1067972811 10:50991711-50991733 CCGCGGCGGCGGGGGCGGGTCGG + Intronic
1068191069 10:53653943-53653965 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
1068697373 10:59982217-59982239 CTGGGGCGGGGGTGGAGGGGAGG + Intergenic
1069122280 10:64581910-64581932 CTGTGGTGGGGGGAGCGGGGAGG - Intergenic
1069887923 10:71635573-71635595 CTGCGGAGAGGAGGGAGGGGAGG + Intronic
1070027876 10:72649459-72649481 TTTTGGCGGGGGGGGCGGGGTGG + Intergenic
1070158336 10:73850416-73850438 CTGCGGTGGGGGGGGGCGGGCGG - Intronic
1070765427 10:79053516-79053538 TCGGGGGGCGGGGGGCGGGGAGG + Intergenic
1070800828 10:79243548-79243570 CGGCGGCGCGGGGGCCCGGGCGG - Intronic
1070984543 10:80677499-80677521 CTGGTGCGCGGGGGGGTGGGGGG - Intergenic
1071544853 10:86521557-86521579 CGGCGGCGCTCGAGGCGGGGAGG - Exonic
1071695298 10:87863523-87863545 CGGCGGCGGAGGGGGCGGGCAGG + Exonic
1071997553 10:91162972-91162994 CCGCGCCGGCGGGGGCGGGGCGG - Intergenic
1072188463 10:93062803-93062825 CTGGTGCGCGGCGGGCGGGCCGG + Exonic
1072241006 10:93495954-93495976 CAGCGGAGTGGGGGGGGGGGGGG - Intergenic
1072511508 10:96130467-96130489 CTGCCCCGCGGGGAGCGCGGAGG - Intronic
1073059303 10:100723975-100723997 CCGCGAGGTGGGGGGCGGGGCGG + Intergenic
1073249841 10:102114666-102114688 CTGGGGGGCGGGGGGCCGCGGGG + Intronic
1073460385 10:103662338-103662360 TGGCGGGGGGGGGGGCGGGGGGG + Intronic
1073732974 10:106312561-106312583 ATGCGGCGGGGGGGGGGGTGGGG + Intergenic
1073759241 10:106612390-106612412 CTGCGGGGGTGGGGGCGGGAGGG - Intronic
1073959809 10:108912646-108912668 CGGGGGGGTGGGGGGCGGGGGGG + Intergenic
1074086141 10:110210048-110210070 CGGCGGCCAGGGCGGCGGGGTGG - Intronic
1074095107 10:110304751-110304773 GTGTGGGGCTGGGGGCGGGGCGG + Exonic
1074121538 10:110497573-110497595 AAGCGCCGTGGGGGGCGGGGCGG - Intergenic
1074399044 10:113126744-113126766 CGGCGGCGCGGGCTGCAGGGCGG + Intronic
1074618307 10:115092938-115092960 CCGGGGCGCGGGGTGCGGGTGGG + Intergenic
1074686236 10:115964716-115964738 TTGCGGGGCGAGGGGCGAGGCGG + Intergenic
1075004536 10:118820530-118820552 CTGTGGGGCGGGGGCTGGGGAGG - Intergenic
1075032170 10:119030621-119030643 CTGCGGGGCGGCGGGCGGGCGGG - Exonic
1075099608 10:119496883-119496905 AGGGGGCGGGGGGGGCGGGGTGG - Intergenic
1075414966 10:122255808-122255830 CTCCGGGTTGGGGGGCGGGGGGG + Intergenic
1075690135 10:124388895-124388917 CTGCAGCGCGGGAGGTGGGGTGG + Intergenic
1075693756 10:124418790-124418812 CAGCGGCGGGGGAGGCGGGCGGG - Intronic
1075699795 10:124461934-124461956 CAGCGGCGCGGGCGGCGGCACGG + Exonic
1075801765 10:125159152-125159174 CGGCGCCGCGGAGGGCTGGGAGG + Intronic
1076035530 10:127196216-127196238 CTGCGGCGCGGGGGCCGGCCGGG - Intronic
1076372491 10:129964376-129964398 CGGCGGCGAGGGGCGCGGCGAGG - Intergenic
1076373913 10:129971358-129971380 CGTCGGCGCGGGGGCGGGGGGGG + Intergenic
1076395883 10:130136872-130136894 TGGCGGGGCGGGGGACGGGGCGG + Intronic
1076612812 10:131737010-131737032 CCGAGGCTCGGGGGCCGGGGGGG + Intergenic
1076653531 10:132006194-132006216 CTATGGAGCGGGGGGTGGGGTGG + Intergenic
1076678026 10:132158089-132158111 CTGCCGGGGGCGGGGCGGGGCGG - Intronic
1076722094 10:132397179-132397201 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1076746479 10:132517268-132517290 CAGCGGGGGGTGGGGCGGGGTGG + Intergenic
1076749890 10:132537420-132537442 CCGCGGCGCGGGGGGCGGGGCGG + Intergenic
1076792863 10:132786063-132786085 GCGGGGCGCGGGGGGCGGGCGGG + Intergenic
1076829909 10:132988985-132989007 CTGAGGCCCGGTGGGGGGGGGGG + Intergenic
1076878764 10:133230134-133230156 GCGGGGCGCGCGGGGCGGGGCGG + Intergenic
1076890701 10:133281831-133281853 CTGCGGCGCCGGCTCCGGGGTGG - Intronic
1076977912 11:189491-189513 CTGGGGGGCGGGGGGAGGCGCGG + Intronic
1077008316 11:369379-369401 GCGGGGCGCGGGGTGCGGGGCGG - Intergenic
1077008453 11:369726-369748 ATGCGGCGCGGGGCGGGCGGGGG + Intergenic
1077008504 11:369955-369977 GTACGGCGCGGGGGGCGCGGGGG + Intronic
1077008509 11:369964-369986 GGGGGGCGCGGGGGGCGCGGGGG + Intronic
1077008524 11:369991-370013 GGGCGGCGCGGGGGGCGCGGGGG + Intronic
1077010393 11:376834-376856 CTGCGGCCGTGGGGCCGGGGTGG - Exonic
1077018475 11:407183-407205 CGGCGGCGCAGGGGCGGGGGCGG + Intronic
1077048118 11:555130-555152 GAGAGGCGCGCGGGGCGGGGCGG + Intronic
1077063321 11:627033-627055 GTGGGGCCCGGGGGGCGGGCGGG + Intronic
1077076869 11:706023-706045 AGGCGGGGCAGGGGGCGGGGCGG + Intronic
1077079978 11:720928-720950 CGGGGTCGCAGGGGGCGGGGAGG + Intronic
1077143519 11:1035104-1035126 CTGGGCCGCGGTGGGCCGGGAGG - Intronic
1077152200 11:1077396-1077418 CTGGGGCGGGGGGGCCTGGGTGG + Intergenic
1077197140 11:1287415-1287437 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197151 11:1287443-1287465 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197168 11:1287485-1287507 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197197 11:1287569-1287591 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197208 11:1287597-1287619 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197224 11:1287639-1287661 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197235 11:1287667-1287689 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197263 11:1287751-1287773 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077197289 11:1287821-1287843 CTGCGGCGGGGAGGGTGCGGCGG - Intronic
1077228952 11:1450243-1450265 GGGCGGCTCGGGGGGCGGTGGGG - Intronic
1077250155 11:1557301-1557323 CGGGGGCGTGGGGGGCGCGGGGG + Exonic
1077285631 11:1764050-1764072 CGCCCGGGCGGGGGGCGGGGTGG + Intergenic
1077299540 11:1840675-1840697 CTGCTGCTGGGGAGGCGGGGTGG - Intronic
1077360347 11:2138000-2138022 CGGCGGAGCTGGGGGTGGGGTGG - Intronic
1077360858 11:2139567-2139589 CTGGGGCCCCGGGGGGGGGGCGG + Intronic
1077544948 11:3165184-3165206 CGGCGGCCCGGGGGGCGGCAGGG - Intronic
1077923115 11:6655905-6655927 CGGCGGCGCGGAGCGCGGGTGGG - Intergenic
1078066234 11:8081152-8081174 CTGCGGGGCGGGGCGGGGCGGGG + Intronic
1078190854 11:9091641-9091663 CCGGGGCTCGGGGGGCGGGCGGG - Intronic
1078774452 11:14381446-14381468 CTGCTCCGCAGCGGGCGGGGCGG - Intergenic
1079126037 11:17719445-17719467 CTGCGGGGCGGGGCTTGGGGGGG - Intergenic
1079132228 11:17753692-17753714 CCCCGGCGTGGGGGGTGGGGAGG + Intronic
1079338301 11:19590428-19590450 CTGGGGTGCGGGGAGCTGGGAGG - Intronic
1080034893 11:27700527-27700549 GCGGGGGGCGGGGGGCGGGGGGG - Intronic
1080045787 11:27806319-27806341 GAGCGGCGTGCGGGGCGGGGCGG - Intergenic
1081700062 11:45147043-45147065 CGCCGGCGCGGGGTGGGGGGCGG + Intronic
1081774049 11:45665698-45665720 GGGCGGCGCGGGGGGCGGGAAGG - Intergenic
1081774128 11:45665924-45665946 CCGCGGCGAGGGGCGCTGGGGGG - Intergenic
1081863529 11:46347518-46347540 CGGGGGCGCGCGGCGCGGGGCGG + Intronic
1081938135 11:46918590-46918612 CTGCGGCGCGGGGGGCGGGGCGG - Exonic
1082807536 11:57460373-57460395 CGGGGGGGAGGGGGGCGGGGTGG + Intergenic
1082916899 11:58446894-58446916 CTGGGGTGGGGGTGGCGGGGCGG - Intergenic
1083039029 11:59668773-59668795 CTGCGGGGCAGGGGGCGGGCTGG - Intronic
1083168387 11:60906271-60906293 CTGCGGCGCCCGGGCCGGGGTGG - Intronic
1083207537 11:61161544-61161566 CAGAGGCGCGCGAGGCGGGGCGG - Exonic
1083298964 11:61730356-61730378 CTGCAGCCCTGGGGGCGGGGTGG - Intronic
1083315926 11:61815157-61815179 GTGTGGGGCGGGGGCCGGGGCGG + Intronic
1083329819 11:61892104-61892126 CTGCAGCGCCGAGGGCGGAGGGG - Intergenic
1083334901 11:61916828-61916850 CTGCGGGGCCGGGGCGGGGGGGG + Intronic
1083432569 11:62621950-62621972 CTCGGGCGCGGGCGGCGGCGCGG - Exonic
1083442724 11:62687803-62687825 CTGCGGCTCGGGCGGCGGCTCGG + Exonic
1083477425 11:62923230-62923252 CTGCGGCTTGGGCGGCGCGGTGG + Intergenic
1083571366 11:63763734-63763756 CTGCGGGGCGGGGGCGGAGGCGG + Exonic
1083573130 11:63770322-63770344 CTGCGCTCAGGGGGGCGGGGGGG + Intergenic
1083659807 11:64246782-64246804 CCGCGGCGAGGGCGGCGGCGGGG + Exonic
1083743517 11:64723104-64723126 CCGCGGCGGGGCGGGCGGGCGGG - Exonic
1083766460 11:64843751-64843773 CTGTGGCGCCGGGGCCGGGGAGG - Intronic
1083766738 11:64844889-64844911 CTTCTGCGCGGGGCGCGGTGGGG + Intergenic
1083768711 11:64854641-64854663 CTACGGCGAGGGGGCCGGCGAGG - Exonic
1083816377 11:65134570-65134592 CGGCGGCGCGGGGCGCGGCGTGG + Intergenic
1083849088 11:65354962-65354984 GTGCGGAGCGGGAGGCCGGGCGG + Intronic
1083869370 11:65477499-65477521 CCCCGGCGCGGGGGCAGGGGAGG + Intergenic
1083886514 11:65575998-65576020 CTCCGGCGCGGGGCGGGGGCCGG - Intergenic
1084070117 11:66728309-66728331 AGGCGGCGCGGGGGGCGCGCGGG + Intronic
1084084194 11:66847418-66847440 CTCCGGGGTGGGGGGCAGGGGGG + Intergenic
1084151350 11:67289305-67289327 CGGCAGCGCGGGCGGCAGGGAGG - Exonic
1084174271 11:67415537-67415559 CTGACGGGCGGGGGGGGGGGGGG + Intronic
1084174324 11:67415731-67415753 CAGCGGCTCGGCGGGCGTGGCGG - Intronic
1084295914 11:68213396-68213418 CGGGGGCGCGGGGGGCGCGACGG - Exonic
1084474404 11:69380673-69380695 CTGCCGGGCGGGTGGCCGGGTGG + Intergenic
1084665322 11:70573265-70573287 CTGCAGCGGTGGGGGCGGGGGGG + Intronic
1084892698 11:72244287-72244309 CTTCGGGGTGGGGGTCGGGGCGG - Intronic
1085043925 11:73342797-73342819 CTGCCGCGTGGGGGAAGGGGCGG + Intronic
1085044012 11:73343105-73343127 CTGGGGCGGGGGCGCCGGGGTGG - Intronic
1085205832 11:74731371-74731393 CGGCGGCGCGGCGGCCGCGGAGG + Intronic
1085346026 11:75768708-75768730 CGCCGACGCGGCGGGCGGGGCGG - Intronic
1085522784 11:77147995-77148017 GTGGGGCGAGGTGGGCGGGGCGG - Intronic
1085561045 11:77473479-77473501 CTGGGGCGCGGGGGTGGGGACGG - Intronic
1085717992 11:78889907-78889929 CTGCGGGGCAGGGGTCGGGGCGG + Exonic
1085726923 11:78962279-78962301 CGGAGGGGAGGGGGGCGGGGAGG + Intronic
1086081053 11:82902387-82902409 CTGGGGCGGCGGGGGAGGGGGGG - Intronic
1086912415 11:92488448-92488470 TTGGGGGGCGGGGGGGGGGGCGG - Intronic
1086959724 11:92969752-92969774 CTGCTGCGAGGCGGGCGGGTGGG + Exonic
1086993424 11:93330585-93330607 CGGCGGCGCCGCGCGCGGGGAGG + Intronic
1087014622 11:93543236-93543258 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1087308040 11:96507006-96507028 CAGCGGGGGGGGGGGGGGGGGGG - Intronic
1088125404 11:106417971-106417993 CTACGGCGGGGGGGCAGGGGAGG - Intergenic
1088604087 11:111512426-111512448 CCGCGGGCCGAGGGGCGGGGCGG - Intergenic
1088648445 11:111937119-111937141 CTGCGGCCCGGGCGGGGGGGGGG + Intronic
1088764638 11:112963135-112963157 TTGCGGCGCGGGTGGCGGCCAGG + Intronic
1088932736 11:114368476-114368498 GGGTGGCGGGGGGGGCGGGGGGG - Intergenic
1089209455 11:116790555-116790577 CTGAGGCGCGCGGGGCTGGCGGG + Exonic
1089426635 11:118382411-118382433 CGGCTGGGCGGGGGGTGGGGTGG - Intronic
1089457721 11:118635065-118635087 CCGCGGGGCCGGGGGAGGGGGGG - Intronic
1089496436 11:118910595-118910617 GTGCAGGGCGGGGGGAGGGGAGG - Exonic
1089738414 11:120564973-120564995 CTGCGGGGGGGTGGGGGGGGTGG + Intronic
1090385539 11:126355865-126355887 CGGGGGCCCGCGGGGCGGGGCGG + Intronic
1091226047 11:133956936-133956958 CCGCTGCGCCGGGGCCGGGGAGG - Exonic
1091238562 11:134037384-134037406 CTGCGCCGCGGAGGGGAGGGCGG + Intergenic
1091241126 11:134053136-134053158 CGGGGGCGGGGGGGGGGGGGTGG + Intergenic
1091273088 11:134331829-134331851 CTGTCGGGGGGGGGGCGGGGCGG - Intergenic
1091286689 11:134412085-134412107 GCGGGGGGCGGGGGGCGGGGAGG + Intergenic
1091498380 12:991517-991539 CGGCAGCCCGGGGGGTGGGGAGG + Intronic
1091550056 12:1530288-1530310 AGGAGGCGCGGGAGGCGGGGCGG + Intronic
1091590001 12:1837219-1837241 CTGCCGCACGGTGGGAGGGGAGG + Intronic
1091616183 12:2052883-2052905 CTCCGGCGCGCCGGGCGGGCGGG + Intronic
1091718568 12:2795961-2795983 CTGCGGGGTGTGGGGCGGGGAGG + Intronic
1091807413 12:3366205-3366227 CAGCGGGGCGCGGGGCGGGCTGG - Intergenic
1091817500 12:3451037-3451059 CGGCGGGGGGGGGGGGGGGGGGG - Intronic
1091817503 12:3451040-3451062 TTTCGGCGGGGGGGGGGGGGGGG - Intronic
1091823255 12:3491743-3491765 CGGCGGCGCGGTGGTCCGGGTGG - Intronic
1091888068 12:4031253-4031275 CGGGGGCGCGGCGGGCGGGCGGG - Intergenic
1091915334 12:4269200-4269222 GCGAGGGGCGGGGGGCGGGGAGG + Intergenic
1092228967 12:6766514-6766536 CAGAGGCGCGCGGGGTGGGGCGG - Exonic
1092230300 12:6772443-6772465 CTGGGGTGCGGGGGGCGGGCCGG + Intergenic
1092244014 12:6852906-6852928 CTGGGGGGCGGGGGGAAGGGTGG - Intronic
1092378182 12:7973056-7973078 CCAAGGAGCGGGGGGCGGGGGGG - Intergenic
1092385367 12:8032682-8032704 GCGCGGCGCGGAGGCCGGGGAGG + Exonic
1092487442 12:8914666-8914688 CGGGGGCGCCGAGGGCGGGGTGG - Exonic
1092502836 12:9065152-9065174 CGGGGGCGGGGGGGGGGGGGGGG - Intergenic
1092615529 12:10212813-10212835 CTGGCGCATGGGGGGCGGGGCGG + Exonic
1092743268 12:11649960-11649982 CTGGAGCGCGCGGGGCGGGGCGG - Exonic
1092861910 12:12725668-12725690 GCGCGGCGCGCGAGGCGGGGAGG - Intergenic
1093662646 12:21774824-21774846 CTGGGGGGGCGGGGGCGGGGGGG + Intronic
1093728662 12:22543978-22544000 CTGAGGGGCTGGGGGCGAGGTGG + Intronic
1093894685 12:24562732-24562754 GTGCGGCGGGGGCGGGGGGGGGG + Intergenic
1094041113 12:26122623-26122645 CGGCGGCCCGGGGGGCGGCGCGG - Exonic
1094063827 12:26342491-26342513 CGGCGGTGGGGGGGGGGGGGGGG + Intronic
1095687364 12:45050988-45051010 CTGCGGCTCTGGGTGCGGTGCGG - Exonic
1095703771 12:45216582-45216604 CTGAGGCGCGGGGCGCGTGGTGG + Intronic
1095949272 12:47773162-47773184 GGGCGGCGCTGGGGGCGGGCCGG + Intronic
1095958534 12:47819722-47819744 GTGCCGCGCGCAGGGCGGGGCGG + Intronic
1096159859 12:49367403-49367425 AGGCGGCGGTGGGGGCGGGGCGG + Intronic
1096232443 12:49903930-49903952 CATCGGCGCGGGGGGAGGAGAGG + Intronic
1096396413 12:51269928-51269950 CCGGGGCGCGGGGCGCGGGCTGG - Intronic
1096470748 12:51874059-51874081 TGGTGGGGCGGGGGGCGGGGGGG - Intergenic
1096498347 12:52051322-52051344 CAAGGGCGCGGGGGGCGGTGCGG - Intronic
1096502011 12:52069952-52069974 CCGGCGCGCGGGGGGCGGTGCGG + Exonic
1096781447 12:53994529-53994551 AAGCGGCGCGCGGGGCGCGGCGG + Intronic
1096788911 12:54033338-54033360 CCGCGGCGCTGCAGGCGGGGCGG - Exonic
1096798009 12:54090664-54090686 TGGCGGGGAGGGGGGCGGGGCGG + Intergenic
1096946730 12:55414975-55414997 CGGGGGCGCCGAGGGCGGGGTGG + Intergenic
1097164610 12:57076947-57076969 CTGCGGGGCGGGGCGGGCGGGGG + Intronic
1097191198 12:57220386-57220408 GTGAGGCGCGGGGCGGGGGGCGG + Intronic
1097191203 12:57220391-57220413 GCGCGGGGCGGGGGGCGGGGGGG + Intronic
1097237484 12:57550020-57550042 CTGCAGCGCGAGGGGCGGAGAGG + Exonic
1097267798 12:57755761-57755783 CGGCGGCGCGGGCGGCGGCAGGG - Exonic
1097675914 12:62602758-62602780 TGGCGGCGCGGGGGGCGGCCTGG + Exonic
1097830715 12:64221974-64221996 AAGGGGCTCGGGGGGCGGGGCGG + Intronic
1097863895 12:64543445-64543467 GTGGGGAGCGGGGGGCGGGCGGG - Intergenic
1097889937 12:64767782-64767804 CTCCGGCGGGGGGGGGGGGAGGG + Intergenic
1098254799 12:68606091-68606113 CGGCGGCGGGGGGGGGGGGGAGG + Intergenic
1098425969 12:70366224-70366246 CTGCTGCGGACGGGGCGGGGCGG + Intergenic
1098550374 12:71755141-71755163 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1099191421 12:79565222-79565244 CGGCGGGGCGGGGGTGGGGGAGG - Intergenic
1099468915 12:83022361-83022383 CTGGGGCGGGGGGAGGGGGGAGG - Intronic
1099483357 12:83196213-83196235 CTGGTGGGCGGGGGGGGGGGGGG + Intergenic
1099713723 12:86264461-86264483 CTGCAGCGGGGGAGGCGGGGAGG + Intronic
1099979658 12:89583784-89583806 CTTTGGCGGGGGGGGGGGGGGGG + Intergenic
1100391477 12:94148996-94149018 GCGGGGCGCGGGGGGCGCGGCGG - Exonic
1100611422 12:96194412-96194434 CCGGGGCGCGCGGCGCGGGGCGG + Exonic
1101371962 12:104138341-104138363 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1101428362 12:104606160-104606182 CTCTGGGGCGGGGGGCGGGGGGG + Intronic
1101428364 12:104606162-104606184 CTGGGGCGGGGGGCGGGGGGGGG + Intronic
1101838399 12:108310950-108310972 CTCCTGGGCGGGGGGTGGGGGGG - Intronic
1102022185 12:109691425-109691447 CTGAGGGGGGGGGGGGGGGGTGG - Intergenic
1102025770 12:109713762-109713784 CTGGGCCGCGGGGGGCGGGCGGG + Intergenic
1102300356 12:111766892-111766914 CTGCCGCGCGGGGCGGGGAGCGG + Intronic
1102338434 12:112102691-112102713 CTCCATTGCGGGGGGCGGGGGGG - Intronic
1102371059 12:112382473-112382495 CCGCGGAGCGGTGGGCGGAGCGG - Intergenic
1102571664 12:113830567-113830589 CTGCGGGGCGGGGGGGGGGGGGG + Intronic
1102657031 12:114490673-114490695 CTGGGGAGCGGGGGGAGGGTGGG + Intergenic
1102924928 12:116819378-116819400 CGGCGGCGCGCAGAGCGGGGCGG + Intronic
1102952954 12:117042278-117042300 CTGGGGGGCTGGGGGAGGGGAGG - Intronic
1102962006 12:117099187-117099209 GGGCGGCGCGGGGACCGGGGCGG - Intronic
1103188444 12:118981105-118981127 CTTCTGCGTGGGGGGGGGGGGGG - Intergenic
1103294847 12:119877280-119877302 CGGCGGCGGGAGGCGCGGGGCGG - Exonic
1103474776 12:121210308-121210330 GGGCCGCGCGGGGGGCGCGGCGG + Intronic
1103534736 12:121626755-121626777 CTGCGGCTCGGGGGCGGGGCGGG - Exonic
1103562420 12:121799716-121799738 CTGGGGGGGGGGGGGTGGGGTGG + Intronic
1103623839 12:122204337-122204359 CCGCGGCTCGGAGGGCGGCGGGG + Intronic
1103704512 12:122864116-122864138 CTGAGGTGGGGGGGGGGGGGGGG - Intergenic
1103800645 12:123534640-123534662 CTCCTGCGTGGGGGGCGGGGAGG - Intergenic
1104376194 12:128267113-128267135 GGGCGGGGCCGGGGGCGGGGCGG + Intergenic
1104854333 12:131894966-131894988 CGGGGGCGCGGGGCGGGGGGTGG - Exonic
1104983407 12:132583663-132583685 CGGCGGCCCGGGGGGCGTGGGGG - Exonic
1104988552 12:132611260-132611282 CTGAGGCGGGGAGGGTGGGGAGG + Intergenic
1105058874 12:133129998-133130020 CAGGGGCGCGCGGGGCGGAGGGG - Intronic
1105539004 13:21298308-21298330 CTGCGGCGCAGGCGGCGGGTCGG + Intergenic
1105940834 13:25146444-25146466 CGGGGGTGGGGGGGGCGGGGAGG + Intergenic
1106057710 13:26254264-26254286 CTGCGGCGGGAGCGGCGGGGCGG - Exonic
1106250202 13:27977108-27977130 CTGTGTTGGGGGGGGCGGGGGGG + Intergenic
1106452425 13:29895052-29895074 CTACTTGGCGGGGGGCGGGGGGG + Intergenic
1106517128 13:30465288-30465310 CAGCCGGGCGGGCGGCGGGGCGG - Intronic
1107014028 13:35694892-35694914 CTGCGGGGGGGGGGGGGGGGGGG - Intergenic
1107654124 13:42574398-42574420 GTGCGGCGCAGGCGGCGGCGGGG - Exonic
1108198335 13:48017638-48017660 TTGTGGGGTGGGGGGCGGGGGGG + Intergenic
1108229556 13:48321385-48321407 CAGCGGCGCGCGGGGAGGCGGGG - Intronic
1108541528 13:51451808-51451830 CTGCCGAGCGGGGGAGGGGGTGG + Intronic
1108572826 13:51767775-51767797 CTGGGGCGGGGGGGGGGGGGGGG + Intergenic
1109025164 13:57146293-57146315 GTGGGGCGGGGGGGGGGGGGGGG - Intronic
1109078227 13:57865026-57865048 CTGTGGGGCGGGTGGTGGGGGGG + Intergenic
1110630265 13:77698452-77698474 CAGCAGCGTGGGGGGCGGCGAGG - Intronic
1111640374 13:90961920-90961942 GTGCGGTGGGGGGAGCGGGGAGG + Intergenic
1112059428 13:95722821-95722843 CGGCGGGGGGGGGGGGGGGGGGG - Intronic
1112059431 13:95722824-95722846 TTTCGGCGGGGGGGGGGGGGGGG - Intronic
1112216268 13:97434141-97434163 TGGAGGCGCGAGGGGCGGGGCGG + Intergenic
1112290675 13:98142601-98142623 CTGTGGCTCCGGGGGAGGGGAGG + Exonic
1112506990 13:99981403-99981425 CCGCGGCGGGGGCGCCGGGGCGG - Intergenic
1112507857 13:99985577-99985599 CGGCGGCGGGGCGGGCGGCGGGG + Exonic
1112984754 13:105434653-105434675 CTGAAGCAGGGGGGGCGGGGCGG - Intergenic
1113120040 13:106916436-106916458 GTGGGGCGGGGGGGCCGGGGGGG - Intergenic
1113541886 13:111115502-111115524 CTGCGGCCCGGGAGGCAGGCGGG - Exonic
1113874266 13:113584819-113584841 GTGCGGAGCGCGGGGCGGCGCGG - Exonic
1113914804 13:113863870-113863892 CTGCGGCGCGCGGCGCAGGGCGG + Exonic
1113946064 13:114044384-114044406 GCGGGGCGGGGGGGGCGGGGGGG - Intronic
1114271870 14:21105241-21105263 CTGAGGCGGGGGGCGCGGGGCGG - Intergenic
1114558853 14:23577393-23577415 CTGCTACGTGGGGGGCTGGGAGG - Exonic
1114612390 14:24051618-24051640 CTGGGAGGCGAGGGGCGGGGAGG - Intergenic
1114663487 14:24365985-24366007 CTCTGAGGCGGGGGGCGGGGGGG - Intronic
1115547270 14:34475439-34475461 ATGGGGCGGGGGGGGGGGGGGGG - Intergenic
1115754275 14:36517673-36517695 CGGCGGCGGCGGGGGCGGCGGGG - Exonic
1115761669 14:36582662-36582684 GTGCGGGGCGGGGTGCGGGGCGG - Intergenic
1115851837 14:37595396-37595418 CGGCGGGGCGGGAGGCGCGGCGG - Intronic
1115993336 14:39171492-39171514 CCGAGGCACGGGGGGTGGGGGGG + Intergenic
1116042918 14:39707458-39707480 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
1116318410 14:43428149-43428171 TTGTGGGGTGGGGGGCGGGGAGG - Intergenic
1116471944 14:45295599-45295621 GTGGGGAGCGGGGGGCGGGGAGG + Intergenic
1116505132 14:45668556-45668578 ATGCGGTGCGGGGAGTGGGGAGG - Intergenic
1116876121 14:50113786-50113808 CTTGGGGGCGGGGGGGGGGGGGG + Intronic
1116895515 14:50311972-50311994 CAGCAGCGCAGGCGGCGGGGAGG + Intronic
1116905097 14:50396678-50396700 GTGGGGCGCGGGGCGCGGGTTGG - Intronic
1117573571 14:57074170-57074192 CTGTGGGGCGGGGGGCAGGGGGG - Intergenic
1117802992 14:59464408-59464430 CAGCTGCGCGGGGTCCGGGGAGG + Exonic
1117837154 14:59819430-59819452 CTGTGGCCGGGGGGGGGGGGTGG - Intronic
1118005623 14:61562253-61562275 TTGCGGGGTGGGGGGTGGGGCGG - Intronic
1118006558 14:61568800-61568822 GTGCGCCGTGTGGGGCGGGGCGG + Intronic
1118030349 14:61812623-61812645 CTGCTGGGCGCGGGGCGGCGCGG + Intergenic
1118270507 14:64338633-64338655 CTGCGGGGAGGGGGACGGGGCGG - Intergenic
1118282734 14:64444105-64444127 CTGGGGGCTGGGGGGCGGGGCGG + Intronic
1118350995 14:64972357-64972379 CGGCGGCGCAGGGGAAGGGGCGG - Intronic
1118621841 14:67620556-67620578 CTCCAGCGCGGGAGGTGGGGAGG + Intronic
1118755895 14:68843560-68843582 CTGCAGGACGGGGGGCGGAGGGG - Intergenic
1119177545 14:72580313-72580335 CTGTGGCCCTGGGGTCGGGGTGG - Intergenic
1119357504 14:74019299-74019321 CCGCGGCGCGCGGGGTGGGGCGG - Exonic
1119438407 14:74612403-74612425 GTGCGGAGCAGGGGGCGGCGCGG + Intergenic
1119470950 14:74898812-74898834 CTGTGGAGCTGGGGGAGGGGAGG - Intronic
1119602051 14:75982798-75982820 CTCCGGAGCGGCGGTCGGGGAGG - Intronic
1120519610 14:85511224-85511246 ATGCGGGGGGGGGGGGGGGGGGG + Intergenic
1121145414 14:91578240-91578262 ATGGGGCGGGGGGGGGGGGGGGG - Intergenic
1121257871 14:92544411-92544433 CTGTGGGGGGGGGGGGGGGGTGG + Intronic
1121516497 14:94555769-94555791 GTGGGGGGTGGGGGGCGGGGGGG + Intergenic
1121711009 14:96039303-96039325 CGGGGGCGGGCGGGGCGGGGTGG - Exonic
1122066036 14:99175086-99175108 CCCGGGCGCGGGGGGCGGCGCGG - Exonic
1122221233 14:100240054-100240076 GTGCGGCGGCGGGGGCGCGGCGG + Intronic
1122230875 14:100305887-100305909 CCTCGGCGCGGGGGGCAGTGGGG + Intronic
1122415172 14:101546086-101546108 CTGCTATGCGGGGGGCGGGCGGG - Intergenic
1122444955 14:101761596-101761618 GAGCGGCGGGCGGGGCGGGGCGG + Intergenic
1122464060 14:101918482-101918504 CTGAGGGGTGGGGGGAGGGGTGG - Intronic
1122464091 14:101918550-101918572 CTGAGGGGTGGGGGGAGGGGTGG - Intronic
1122470752 14:101964499-101964521 CTGCGGCCGGCGGGGCGGGGCGG + Intergenic
1122620962 14:103057473-103057495 CTGCGGCGGCGGCGGCGGGGAGG - Intergenic
1122647869 14:103207208-103207230 CTGTGGCGCGGGGGAGGGGCGGG - Intergenic
1122660360 14:103290797-103290819 GTGCTGCCCGGGGGCCGGGGTGG + Intergenic
1122688849 14:103522248-103522270 CGGCTGCGCGGGGGGAGGGGGGG + Intronic
1122814447 14:104305589-104305611 CTGCTGCGGATGGGGCGGGGTGG + Intergenic
1122878065 14:104677937-104677959 CTGCTGCGTGGGGGCCGAGGCGG - Intergenic
1122916928 14:104863800-104863822 CTGGAGGGCGGGGGGGGGGGGGG - Intergenic
1122917315 14:104865174-104865196 GGGCGGCGCGGGGTGCGGCGCGG + Intergenic
1122940334 14:104978295-104978317 CTCCGGCGCACGGGGCGGGCGGG + Exonic
1122959423 14:105087667-105087689 CAGCGGCGGGGCGGGCGGGGAGG + Intergenic
1122975343 14:105168584-105168606 CCGCGGCGCGCGGGCCTGGGCGG + Exonic
1122978567 14:105181095-105181117 CGGGGGCGCGGGGGACGCGGGGG + Intronic
1122978630 14:105181323-105181345 CGTGGGCGCGCGGGGCGGGGCGG + Intronic
1123025065 14:105420320-105420342 CGGCCGCGGGGGTGGCGGGGGGG + Intronic
1123035519 14:105470276-105470298 CTGAGGGGCGGGCGGCGGGCTGG - Exonic
1123036689 14:105474615-105474637 CTCCGGCGCGAGGGGCCCGGGGG + Intronic
1123038713 14:105481729-105481751 TGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1123041958 14:105493949-105493971 CTGCTGCGGGGGGGTGGGGGTGG + Intronic
1123630663 15:22257945-22257967 CTGCGGCGCGGGGGGAGATGGGG + Intergenic
1124129541 15:26971692-26971714 CTGCGGCACGGCGGGCCGGGAGG + Intronic
1124239342 15:28017055-28017077 CTGGGGAGCGGGGGGCGGGGGGG + Intronic
1124385809 15:29207440-29207462 CTGCCGGTTGGGGGGCGGGGGGG + Intronic
1124458808 15:29870071-29870093 CTGGGCGGTGGGGGGCGGGGTGG - Intronic
1125030880 15:35075065-35075087 CTGGGGCGGGGTGAGCGGGGAGG - Intergenic
1125301026 15:38253079-38253101 CGGCGGCCGGGGGGGCGCGGGGG - Exonic
1125362358 15:38877406-38877428 CTGGGGCAGGGTGGGCGGGGTGG + Intergenic
1125445016 15:39745089-39745111 TGGCGGGGTGGGGGGCGGGGTGG - Intronic
1125814856 15:42575605-42575627 CAGAGGCGCGTGGGGCGGGCGGG + Intergenic
1125832630 15:42727684-42727706 CTGCTGCCCGGGGGGAGCGGAGG - Exonic
1125930174 15:43594378-43594400 CTGAGGCGCGGGAGGAGGCGGGG + Intronic
1125943342 15:43694210-43694232 CTGAGGCGCGGGAGGAGGCGGGG + Intronic
1126063876 15:44810345-44810367 CGGCGGCGGGGGTGGGGGGGGGG - Intergenic
1126340374 15:47634810-47634832 CTTCGGGGGTGGGGGCGGGGTGG + Intronic
1126736556 15:51737274-51737296 GTGCGGCTCGGGGTGCGGTGGGG - Intronic
1127184670 15:56465590-56465612 CTGCGGGGGGGGGGGGGGGGCGG - Intergenic
1127184671 15:56465593-56465615 CTTCTGCGGGGGGGGGGGGGGGG - Intergenic
1127326035 15:57896255-57896277 GTGCGGCGGGGGGGGGGGGGAGG - Intergenic
1127988744 15:64095851-64095873 CTTAGGCGCTGGGGGCGGGGCGG - Intronic
1128077316 15:64835778-64835800 CCACGGCGCGTGGAGCGGGGAGG - Intergenic
1128078235 15:64841631-64841653 CTGCGGCGGGGGAGGAGAGGGGG - Intergenic
1128139221 15:65286886-65286908 CGGCGGCGCGGCGGGAGGCGGGG - Intronic
1128140297 15:65295292-65295314 TTGGGGCGGGGGGGGGGGGGGGG + Intronic
1128153578 15:65377937-65377959 CAGCAGCGCGGGGGGCGCAGGGG + Exonic
1128547547 15:68578554-68578576 GTGTGGCGCGGCGGGCTGGGAGG - Intergenic
1128566073 15:68700986-68701008 CTGAGGAGCTGGGGGCGGGATGG + Intronic
1128683430 15:69667442-69667464 CGGCGGGGGGGGGGGGGGGGCGG - Intergenic
1128799566 15:70489088-70489110 CTGCCGCGCGGGGAGAGAGGTGG + Intergenic
1128841183 15:70853218-70853240 CTGCCTTGCGGGGGGCGGGGGGG - Intronic
1128841452 15:70854156-70854178 CTGCGACGAGGGGGCGGGGGCGG + Exonic
1129082388 15:73052410-73052432 CCGGGGCGGGGGGGGGGGGGCGG - Intronic
1129178896 15:73859277-73859299 CGGGGGTGGGGGGGGCGGGGGGG - Intergenic
1129208774 15:74053440-74053462 CTGGGGCGGGGGGGGGCGGGGGG - Intergenic
1129240028 15:74245567-74245589 CGGCGGGGCGGGGAGCTGGGTGG + Intronic
1129240075 15:74245734-74245756 CTGCGGCACGTGGGGCGGGAGGG + Intronic
1129262140 15:74374409-74374431 CTGCGGTGGAGGGGGCGGGGCGG + Intergenic
1129644413 15:77417451-77417473 ATGCGGGGCGGGGGGGGAGGGGG + Intronic
1129710650 15:77818969-77818991 CTGGGGCGCGGCGGGCCGGGAGG - Intronic
1129761305 15:78130798-78130820 CTGGGGGGCAGGGAGCGGGGAGG + Intronic
1129780137 15:78264590-78264612 GTCCGGCGCGGGGCGGGGGGCGG + Intronic
1129780141 15:78264595-78264617 GCGCGGGGCGGGGGGCGGGCGGG + Intronic
1129862521 15:78873410-78873432 TGGCGGCGGGGGGGGAGGGGCGG + Intronic
1130275159 15:82472585-82472607 CTGCGGGGGGGGGGGGGGTGTGG + Intergenic
1130467509 15:84199953-84199975 CTGCGGGGGGGGGGGGGGGAGGG + Intergenic
1130531036 15:84748307-84748329 CGGCGGCGGGTAGGGCGGGGCGG - Intergenic
1130531133 15:84748541-84748563 CTGCGGCTCCGGGGGCGGAGCGG - Intergenic
1130656469 15:85794935-85794957 CTTCGGGCCGGGAGGCGGGGCGG - Exonic
1130656519 15:85795067-85795089 GTGGGGGGCCGGGGGCGGGGAGG + Intergenic
1130923369 15:88367218-88367240 CTGAGGCTCAGGGGGTGGGGTGG + Intergenic
1131144348 15:90001683-90001705 CGGGGGCGCGGGGGGCGCGGGGG + Intronic
1131277404 15:90994034-90994056 CTGAGACGCTGCGGGCGGGGAGG + Intronic
1131366115 15:91842682-91842704 TTACTGGGCGGGGGGCGGGGGGG - Intergenic
1131486363 15:92824262-92824284 TTGCGGGGGGGGGGGGGGGGCGG + Intergenic
1131828850 15:96341700-96341722 CTGGGGCGCGGTGGGGAGGGCGG + Intergenic
1132014075 15:98300480-98300502 CAGTGGAGCGGGGCGCGGGGAGG - Intergenic
1132182634 15:99770662-99770684 TGGCGGGGCGGGGGGCGGGGGGG - Intergenic
1132320200 15:100919624-100919646 CCGCGGCCCGAGGGGCGCGGAGG + Intronic
1132365090 15:101251464-101251486 CGGCGGCCCGGCGGGCGGAGCGG - Exonic
1132398228 15:101489568-101489590 GGGGGGCGCGGGGGGCGCGGGGG - Exonic
1132398233 15:101489577-101489599 CGCGGGCGCGGGGGGCGCGGGGG - Exonic
1132480664 16:164872-164894 GGGCGGGGCGGGGCGCGGGGCGG + Intronic
1132480667 16:164877-164899 GGGCGGGGCGCGGGGCGGGGCGG + Intronic
1132480694 16:164930-164952 TCGCGGGGCGGGGCGCGGGGCGG + Intronic
1132480697 16:164935-164957 GGGCGGGGCGCGGGGCGGGGCGG + Intronic
1132498781 16:275747-275769 CGGGGGCGCGCGGGGCGGGGCGG - Intronic
1132519782 16:381847-381869 CGGCGGCGCGGGACGCGGGCCGG - Exonic
1132586041 16:706077-706099 CCGGCGCGCGGCGGGCGGGGAGG + Intronic
1132639248 16:970365-970387 CTGCGGGGCGGGGGGCGGCCTGG - Intronic
1132643136 16:987129-987151 CTGCCGCTCGGGGGTCCGGGTGG - Intergenic
1132644290 16:991715-991737 CTGCGGGGGGGGTGGGGGGGGGG - Intergenic
1132683442 16:1153014-1153036 CGGGGGCGGGGCGGGCGGGGGGG - Intergenic
1132683450 16:1153023-1153045 GGGCGGGGCCGGGGGCGGGGCGG - Intergenic
1132683478 16:1153080-1153102 CGGCGGGGGGCGGGGCGGGGCGG - Intergenic
1132683481 16:1153085-1153107 CTGAGCGGCGGGGGGCGGGGCGG - Intergenic
1132683683 16:1153655-1153677 CCGCGCCGCGGGAGGCAGGGCGG + Intronic
1132685060 16:1158791-1158813 CTGCGGGGCCGGGGGTGCGGCGG - Intronic
1132687699 16:1169156-1169178 CTGCGGCGGGGTGGGGGTGGGGG + Intronic
1132779518 16:1614818-1614840 CTGCGGCGCGCCGGGGGGCGCGG - Exonic
1132885095 16:2179021-2179043 GGGCGGGGCGGGGGGCGCGGCGG + Exonic
1132886417 16:2184175-2184197 GTGGGGGGAGGGGGGCGGGGGGG + Intronic
1132889330 16:2196308-2196330 CGGGGGCGCGGGGCGCGGGTGGG - Intronic
1132943632 16:2520560-2520582 CTGCGGGGCTGGGGACCGGGCGG + Intronic
1133028865 16:3000359-3000381 CTGGGGAGCAGGGGTCGGGGTGG + Intergenic
1133147829 16:3803257-3803279 CGGCGGGGAGGGGGGGGGGGGGG + Intronic
1133156564 16:3880467-3880489 CGGCGGAACGGGGGGTGGGGGGG - Exonic
1133188523 16:4116581-4116603 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
1133197862 16:4183875-4183897 CGTGGGCGCTGGGGGCGGGGCGG - Intergenic
1133232155 16:4371961-4371983 CGGCGGCGCAGGGAGCCGGGCGG - Exonic
1133244997 16:4442621-4442643 CAGCAGCTCCGGGGGCGGGGCGG + Intronic
1133292927 16:4734599-4734621 CTGCGGCGCGGCCCGAGGGGCGG + Exonic
1133356065 16:5137911-5137933 CTGCGGAGAGTGGGGCTGGGAGG + Intergenic
1133448570 16:5884440-5884462 GTGGGGAGCGGGGGGCGGGGCGG - Intergenic
1133784358 16:8963370-8963392 CGGCGGCGGCGGCGGCGGGGCGG + Exonic
1133899791 16:9963118-9963140 TTGTGGGGTGGGGGGCGGGGAGG + Intronic
1134163904 16:11915369-11915391 CAGCGGCGCGGGAGGCCGTGCGG - Exonic
1134250255 16:12569119-12569141 TTGCGGGGGGGGGGGGGGGGGGG + Exonic
1134441528 16:14302118-14302140 CAGCGGCCCAGGCGGCGGGGCGG - Intergenic
1134539570 16:15054119-15054141 CTGGGGCGCGGCGGGCAGGAGGG - Intronic
1134831528 16:17327613-17327635 CCGAGGCGGGGGGGGGGGGGGGG - Intronic
1135235901 16:20755777-20755799 CTGTGGGGTGGGGGGGGGGGAGG - Intronic
1135321869 16:21502544-21502566 CTGCGGTGGGGGGGGGGGGGGGG + Intergenic
1135517662 16:23149144-23149166 CGGCGGCGCGGGGGGCCCCGGGG - Exonic
1135821971 16:25692698-25692720 CGGCGGCGCGGGCGGCTGCGAGG - Exonic
1136111011 16:28063598-28063620 GCGCGGCGCGGGGGGCGTGCGGG + Intergenic
1136261774 16:29082239-29082261 CTGCGGCGCAGGAGCCGGGGCGG - Intergenic
1136349339 16:29696922-29696944 CTGGGGCGCAGGGAGCCGGGAGG - Intronic
1136399510 16:30010069-30010091 GGGCGGCGGGGGCGGCGGGGAGG - Exonic
1136414662 16:30095996-30096018 CTGGGGCGCGGGGGTGGGGGCGG + Exonic
1136428193 16:30183209-30183231 AGGGGGCGCGGGGGGCGCGGGGG - Intronic
1136453965 16:30370112-30370134 CGGCGGCGAGGGGGCCGCGGGGG + Exonic
1136460507 16:30407576-30407598 CCGCGGCTCCGGGGGCGGGGAGG - Exonic
1136768595 16:32812007-32812029 CCGCGGCGGCGGGGGGGGGGGGG + Intergenic
1137780774 16:51096028-51096050 CTGCGGGGTGGGGGCCGGGATGG + Intergenic
1138105714 16:54286224-54286246 CGGCGGCGAGGGCGGCGGCGAGG + Exonic
1138105875 16:54286936-54286958 ATCCCGCGCGCGGGGCGGGGCGG + Intergenic
1138390033 16:56663348-56663370 GTGCGGGGCGGGGGGGGAGGGGG - Intronic
1138398890 16:56730016-56730038 GGGCGGGGCCGGGGGCGGGGCGG - Intronic
1138515431 16:57533326-57533348 CTGGTGTGCTGGGGGCGGGGTGG - Intronic
1138591234 16:58000681-58000703 GGGCGGCGCGGGGGCCAGGGAGG + Intronic
1139234808 16:65326528-65326550 CTGCTGGTCGGGGGGCGGCGGGG - Intergenic
1139469448 16:67170484-67170506 CAGCTGCGGCGGGGGCGGGGCGG - Intronic
1139546628 16:67652858-67652880 CGGCGGCGGCGGGGGAGGGGCGG + Intronic
1139547003 16:67654072-67654094 CTGCCGGCCGGGGGGGGGGGGGG + Intronic
1139577564 16:67851649-67851671 CTGGGGCGGGGGTAGCGGGGAGG - Intronic
1139775013 16:69311475-69311497 CAGCGCCGCGGGGTGTGGGGCGG + Exonic
1139826624 16:69762400-69762422 CGCTGGCGCGGGGGGCGCGGTGG + Intronic
1139896220 16:70289741-70289763 GGGGGGCGGGGGGGGCGGGGGGG - Intronic
1140020381 16:71232892-71232914 TGGCGGCGGGGGGGGGGGGGGGG + Intergenic
1140043751 16:71426109-71426131 CTGGGGCGCGGGGGAAGCGGGGG - Intergenic
1140225143 16:73071021-73071043 CTGAAAAGCGGGGGGCGGGGGGG - Intergenic
1141289063 16:82700959-82700981 CCGGGGCGGGGGGGGGGGGGGGG - Intronic
1141538466 16:84699948-84699970 GCGCGCCGCGGGGCGCGGGGAGG - Intergenic
1141553180 16:84819807-84819829 CTGAGGCGCGGGCGCCGGGTGGG - Intergenic
1141553207 16:84819860-84819882 CTGCGGGGCGGGGCCGGGGGCGG + Intergenic
1141585019 16:85027973-85027995 GTGGGGCGAGGGGCGCGGGGAGG + Intronic
1141634114 16:85304586-85304608 CTGCCAAGCCGGGGGCGGGGGGG + Intergenic
1141682532 16:85553132-85553154 CTGGGGGGCGGGGCGGGGGGCGG - Intergenic
1141693006 16:85607059-85607081 CTGGGGTGGGGGGGGCGGGAGGG + Intergenic
1141713452 16:85713691-85713713 CTGAGGCCCTGGGGGCGAGGAGG + Intronic
1141831168 16:86510620-86510642 CGGCGGCGGGGGAGGCGGCGCGG + Exonic
1141839799 16:86567273-86567295 CTGCGGCCGGGGGAGCGAGGGGG - Exonic
1141910997 16:87058178-87058200 CCGCGGCGAGGGGGCCGGCGAGG - Intergenic
1141972403 16:87492636-87492658 CTGCGGCGCGGGGGGAGATGGGG - Intergenic
1141990200 16:87604920-87604942 CTGGGGCGCTGAGGGCCGGGCGG + Intronic
1142034260 16:87854065-87854087 CGGTGGGGGGGGGGGCGGGGGGG - Intronic
1142049935 16:87951611-87951633 CTGCGGCGCGGGCGGCCCGGCGG - Intronic
1142111476 16:88333824-88333846 CTGCGTGGCAGGGGGTGGGGGGG + Intergenic
1142130712 16:88430441-88430463 CTAGGGCGCCGGGGACGGGGTGG - Exonic
1142136241 16:88453208-88453230 CCGGAGCGCCGGGGGCGGGGCGG + Intergenic
1142151004 16:88512545-88512567 CTGGGGCCTGGGGGGCAGGGCGG - Intronic
1142179690 16:88662438-88662460 CCCCGGCGCGAGGGGAGGGGCGG + Intronic
1142212319 16:88814196-88814218 CTGAGGCGCCGTGGGCGAGGAGG + Exonic
1142212328 16:88814232-88814254 CTGAGGCGCCGTGGGCGAGGAGG + Exonic
1142230714 16:88899062-88899084 CTGTGGGGTGGGGGGTGGGGAGG - Intronic
1142240281 16:88941629-88941651 CTGCGGGGGGCGGCGCGGGGAGG + Intronic
1142313222 16:89326376-89326398 CTGCAGCGGGGTGGGGGGGGCGG - Intronic
1142313859 16:89330656-89330678 CTGGGGGGGGGGGGGGGGGGCGG + Intronic
1142359221 16:89618972-89618994 CTGCAGGGAGGGGAGCGGGGGGG - Intronic
1142359237 16:89619003-89619025 CTGCAGGGAGGGGAGCGGGGGGG - Intronic
1142359304 16:89619155-89619177 CTGCAGGGAGGGGAGCGGGGGGG - Intronic
1142359317 16:89619185-89619207 CTGCAGGGAGGGGAGCGGGGGGG - Intronic
1142359358 16:89619276-89619298 CTGCAGGGAGGGGAGCGGGGGGG - Intronic
1142359373 16:89619306-89619328 CTGCAGGGAGGGGAGCGGGGGGG - Intronic
1142359386 16:89619336-89619358 CTGCAGGGAGGGGAGCGGGGGGG - Intronic
1142374900 16:89701727-89701749 CCGTGACGCTGGGGGCGGGGCGG + Intergenic
1142413157 16:89926253-89926275 CTGCGGGGCGGGGCTGGGGGCGG + Intronic
1142413183 16:89926342-89926364 CTGCGGAGCCGCGGGCCGGGCGG + Intronic
1203070916 16_KI270728v1_random:1073773-1073795 CAGCGGCGGTGGCGGCGGGGGGG + Intergenic
1203144271 16_KI270728v1_random:1790001-1790023 TTGCGGTGCTGGGGGCAGGGTGG + Intergenic
1142465334 17:133956-133978 CTGGGGGGCGGGGGGAGGCGCGG + Intergenic
1142467394 17:144075-144097 GGGCGGGGCGGCGGGCGGGGCGG + Intergenic
1142467400 17:144087-144109 GGGCGGGGCGGCGGGCGGGGCGG + Intergenic
1142623750 17:1179981-1180003 CAACTTCGCGGGGGGCGGGGCGG + Intronic
1142682512 17:1558773-1558795 CTCTGGGGGGGGGGGCGGGGGGG - Intronic
1142752679 17:1998128-1998150 CGGCGGCGGAGGGGGCGGGGAGG + Intronic
1142762311 17:2049881-2049903 CCGCGGCTCGGGGCGCGGCGTGG + Intergenic
1142762359 17:2050051-2050073 CCGCGGGGGGGCGGGCGGGGCGG + Intergenic
1142785921 17:2222543-2222565 CGGGGGCGGGGGGGGGGGGGGGG + Intronic
1142840660 17:2626558-2626580 CTCCGCCTCGGGGGGGGGGGGGG - Intronic
1142854861 17:2723956-2723978 CGTCGGCGCGGGGGTGGGGGAGG + Intergenic
1142859033 17:2749734-2749756 GGGCGGGGCGGGGGGAGGGGAGG + Intergenic
1142980560 17:3668754-3668776 CGCAGGCGCGGAGGGCGGGGCGG + Intronic
1143078873 17:4366722-4366744 TTCCGCCGCCGGGGGCGGGGCGG - Intergenic
1143200908 17:5112352-5112374 CTGGGGCGTAGGGGGAGGGGAGG + Intronic
1143334476 17:6162107-6162129 GGGAGGGGCGGGGGGCGGGGAGG - Intergenic
1143390485 17:6556613-6556635 CGGCGGCGCGGGGGGTGGGGTGG - Intergenic
1143460489 17:7100683-7100705 CCACGGAGCGGGGGTCGGGGAGG + Intergenic
1143477667 17:7211815-7211837 CTGCGGCGGGGGGGGGGGGGGGG + Intronic
1143548751 17:7615645-7615667 ATGCGGGGTGGGGGGGGGGGTGG - Intronic
1143582650 17:7835745-7835767 GTGCGGCGCAGGGCGGGGGGTGG - Intergenic
1143635785 17:8163077-8163099 CTGCGGGGCGGGGGTCGTGCCGG + Intronic
1143677688 17:8447967-8447989 TTGCGGGGAGGTGGGCGGGGGGG + Intronic
1144116336 17:12096070-12096092 CGGCGGGGGGGGGGGGGGGGGGG - Intronic
1144116339 17:12096073-12096095 TGGCGGCGGGGGGGGGGGGGGGG - Intronic
1144565354 17:16354770-16354792 CTGGGGCGGGGGGGGGGGGGGGG - Intergenic
1144780746 17:17807243-17807265 AGGCGGTGGGGGGGGCGGGGGGG + Intronic
1144784363 17:17823666-17823688 GGGCGGGGCTGGGGGCGGGGCGG - Intronic
1144851685 17:18247128-18247150 CCGGGGCGCGGGGGGGGGGGTGG - Intronic
1145031317 17:19507365-19507387 TGGCGGCGCGGGGGACGCGGGGG - Intronic
1145063140 17:19744790-19744812 CGGGGGCGCGCGGGGCGCGGCGG + Intronic
1145237036 17:21215332-21215354 CTGCGGCGGGGTGGGAAGGGGGG - Intergenic
1145970033 17:28951099-28951121 CTGGGGGCCGGGGGGTGGGGGGG - Exonic
1145998242 17:29116727-29116749 CGGCGGGGGGGGGGGGGGGGGGG - Intronic
1145998246 17:29116730-29116752 TTCCGGCGGGGGGGGGGGGGGGG - Intronic
1146008421 17:29176838-29176860 CCGCCGCGCGGGGAGCCGGGCGG + Intronic
1146034088 17:29390826-29390848 CGGCGGCGGGGGGTGGGGGGGGG - Exonic
1146053305 17:29568653-29568675 GGGCGGCGCGGGCGGCGCGGGGG + Exonic
1146132635 17:30291964-30291986 CGGCGGCGGCGGCGGCGGGGAGG + Exonic
1146183351 17:30710340-30710362 CAGTGGCGCGGGGGATGGGGAGG + Intergenic
1146276168 17:31517183-31517205 AGGCGGTGCGGGGGGGGGGGCGG + Intronic
1146276171 17:31517188-31517210 GTGCGGGGGGGGGGGCGGTGGGG + Intronic
1146276181 17:31517200-31517222 GGGCGGTGGGGGGGGCGGGGGGG + Intronic
1146416238 17:32635684-32635706 CTCCGTCTCGGGTGGCGGGGGGG + Intronic
1146419032 17:32665199-32665221 GGGCGGGTCGGGGGGCGGGGAGG - Intronic
1146759113 17:35460668-35460690 CAGCGGGGCGGGGGCGGGGGCGG - Intergenic
1146911964 17:36653980-36654002 CAGCGGTGAGGGGGGCGCGGGGG + Intergenic
1147119018 17:38324594-38324616 ATGGGGTGGGGGGGGCGGGGCGG - Intergenic
1147258832 17:39197204-39197226 CTGCGGAGCGGGGAGGGGGCGGG - Intronic
1147314396 17:39612666-39612688 CTGCGGCGGGCGGGGAGGAGGGG - Intergenic
1147629098 17:41918665-41918687 GTGTCGCGCGGGGGGAGGGGAGG + Intronic
1147648910 17:42050788-42050810 CTGCCGCGCGTGGGGCGGCAGGG - Intronic
1147702510 17:42404788-42404810 GGGCGGCGCGGAGCGCGGGGAGG - Exonic
1147793235 17:43025789-43025811 CTCCGGGGGGGGGGGGGGGGGGG + Intronic
1147897449 17:43759875-43759897 GGCCGGGGCGGGGGGCGGGGGGG + Intergenic
1147971522 17:44220926-44220948 CTGCGCCGAGGCGGGCGGGCGGG - Intronic
1147987535 17:44315100-44315122 CAGACGCGCGGGGGGAGGGGCGG + Intronic
1148023522 17:44569052-44569074 CTCCGGGGGGGGGGGGGGGGGGG + Intergenic
1148090277 17:45019144-45019166 GCGGGGCGCGGGGGGCGGCGAGG + Intergenic
1148233456 17:45951688-45951710 TTGAGGCCCGGGGGGCGGGGTGG - Intronic
1148271759 17:46267003-46267025 CGGCGGCGCGGGCGGCGAGCCGG - Intergenic
1148323644 17:46771493-46771515 CGGGGGCGGCGGGGGCGGGGCGG + Intronic
1148601725 17:48899280-48899302 CTGGGGCGGCGGGGGCGGGGGGG + Intergenic
1148601734 17:48899289-48899311 CGGGGGCGGGGGGGGGGGGGGGG + Intergenic
1148619268 17:49022399-49022421 GGGCGGGGCGGGGGGCAGGGAGG - Intronic
1148760472 17:49997182-49997204 CTGCGGCGTTGGGGGCAGGAAGG + Intergenic
1148818576 17:50347222-50347244 CAGGGGCGCTGGGGGCAGGGAGG - Intronic
1148857386 17:50586231-50586253 CTGAGGCCCTGGGGGCGGGTGGG - Intronic
1149296283 17:55265044-55265066 CGCCGGCGCGGGGAGGGGGGTGG + Exonic
1149488973 17:57068406-57068428 CAGCGGTGCGGGGGTGGGGGGGG - Intergenic
1149626354 17:58083349-58083371 CGGCGGCGCGCGCGGCGGGGGGG + Intergenic
1149661869 17:58338296-58338318 CTGCGGCTCTGGGGAGGGGGAGG + Intergenic
1149805938 17:59618492-59618514 CGGCGGGGCGGGGGGTGGGGGGG + Intergenic
1150060583 17:62065369-62065391 CGGCGGCGGCGGCGGCGGGGGGG - Intergenic
1150069355 17:62138584-62138606 ATGCAGCGCGGTGGGCGGGCAGG + Intergenic
1150108507 17:62478895-62478917 GTGCGGCGCGGAGGGCGGGGGGG - Intronic
1150198302 17:63325064-63325086 GTGGGGGGCGGGGGGCGGGCAGG + Intronic
1150210418 17:63438470-63438492 CGGCCGGGCGGGGAGCGGGGTGG - Intronic
1150259158 17:63774252-63774274 CGGCGGCGAAGGGGGCGGAGAGG + Exonic
1150265060 17:63827024-63827046 GTGCGGAGAGGGGCGCGGGGTGG - Intronic
1150284242 17:63946463-63946485 TTGCGGCGGGGTGGGGGGGGGGG - Intronic
1150370330 17:64631958-64631980 TTGCGGGGGGGGGGGGGGGGGGG + Intronic
1150488911 17:65561344-65561366 CGTGGGCGCGGGGGGCGGGAGGG - Intronic
1150643456 17:66964587-66964609 CGGCGGCGGGGGAGGCGCGGAGG + Intergenic
1150785913 17:68162460-68162482 CTGCAGGGGCGGGGGCGGGGAGG + Intergenic
1151380007 17:73719411-73719433 GTGAGGCGGGGGAGGCGGGGGGG - Intergenic
1151453556 17:74213497-74213519 AGGCGGGGCCGGGGGCGGGGCGG + Exonic
1151559174 17:74861560-74861582 CGGCGGGGCGGGGGCGGGGGCGG + Intergenic
1151658136 17:75505074-75505096 CTGCGGCCAGGGGTGGGGGGCGG + Intronic
1151660460 17:75515711-75515733 CGGAGGGGCGGGGGGCGCGGGGG + Intergenic
1151783771 17:76265370-76265392 CGGCGGAGCGGGCGGCGGAGCGG + Exonic
1151876523 17:76870300-76870322 CTGCGGTCCGGGGGTCCGGGAGG + Intronic
1152110804 17:78356727-78356749 GCACGGGGCGGGGGGCGGGGGGG + Intergenic
1152120369 17:78414695-78414717 CTGCCGCGCCGGGGTGGGGGTGG + Intronic
1152175128 17:78782267-78782289 CGGGGGCGCGGGTGGCGCGGCGG - Exonic
1152357550 17:79814168-79814190 CTGCTGGGCGGGGGGGCGGGGGG - Intergenic
1152400957 17:80065804-80065826 CTGCGGCGCTGGGAGGGGAGAGG + Intronic
1152443507 17:80325675-80325697 CTGGGGCGCGGGGGGCTGGGGGG - Intronic
1152551953 17:81034626-81034648 CTGCGGGGCGGGGAGCGGCTCGG - Intergenic
1152552003 17:81034787-81034809 CAGCCGGGCTGGGGGCGGGGAGG - Intergenic
1152581196 17:81166247-81166269 GAGCGGCGCGGGGGAGGGGGGGG + Intergenic
1152609905 17:81310300-81310322 CAGCTGCGCAGGGGCCGGGGCGG + Intergenic
1152629471 17:81403847-81403869 CTTCGGCGGGGCGGGCGTGGCGG - Intronic
1152636543 17:81432732-81432754 CTGGGGCTCGGGGGGAGGGTGGG - Intronic
1152663199 17:81552441-81552463 CGGCGGTGCCGGGGGCGGGCCGG + Intronic
1152744159 17:82031544-82031566 CGGCCGCGCGGCTGGCGGGGCGG - Intergenic
1152748474 17:82051853-82051875 TTCCGGGGCGCGGGGCGGGGCGG - Intronic
1152783482 17:82236607-82236629 GTGCCCCGCGGGGGGAGGGGTGG + Intronic
1152834403 17:82519939-82519961 CGGCGGGGCCGGGGGCGGCGGGG + Exonic
1152870864 17:82752337-82752359 CGGCGGCGCGGAGCGCGAGGTGG + Exonic
1152911930 17:83010035-83010057 CTGCCCGGCGGGGGGCTGGGGGG + Intronic
1152923991 17:83079426-83079448 CGGGGGCGCGGGCGCCGGGGCGG - Intergenic
1153024110 18:657964-657986 CTGCGGGACGGGTGGCGGGAAGG + Exonic
1153052192 18:909458-909480 CGGCGGCGCGGGGGACGACGCGG + Exonic
1153480448 18:5542985-5543007 CTGCCGCGGTGGGGGTGGGGAGG - Intronic
1153480684 18:5543654-5543676 CTGCGCCGCGGCGGGCGGAGCGG + Intronic
1153488867 18:5628913-5628935 GCGCGGCGCGGGAGGTGGGGTGG - Intronic
1153805645 18:8706467-8706489 CCGCGGCGAGGGGCGCGGCGAGG - Intronic
1153872542 18:9334496-9334518 CTGCGGGCCGGCGGGCGGGCGGG + Intergenic
1153959947 18:10132094-10132116 CCGCGGCGGAGCGGGCGGGGCGG - Intergenic
1154303991 18:13217789-13217811 CGGCGGCGCGCGGAGCGGGCAGG - Intronic
1154966534 18:21363280-21363302 GTGGGGGGGGGGGGGCGGGGGGG - Intronic
1154968644 18:21384784-21384806 TTGCAGGGCCGGGGGCGGGGGGG - Intronic
1155257917 18:24014666-24014688 CTGCGGCGCGGCGTGGGAGGTGG - Exonic
1155284260 18:24272048-24272070 CAGCGGCGCTGGGGAAGGGGAGG - Intronic
1155388614 18:25308650-25308672 CTGTGGCGGGTGGGGGGGGGGGG - Intronic
1156204954 18:34875327-34875349 CTGCGGCGTGTGCGTCGGGGTGG - Exonic
1156495882 18:37524879-37524901 CTGGGGCGCGGGGGTCGCGGCGG + Intronic
1156717060 18:40024190-40024212 GTGGGGGGCGGGGGGTGGGGCGG - Intergenic
1158259107 18:55588152-55588174 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1158718276 18:59899885-59899907 CTGCGGGGCGGGGACAGGGGCGG + Intergenic
1159298224 18:66523898-66523920 CTCCGGGGGTGGGGGCGGGGGGG + Intronic
1159670136 18:71212503-71212525 CGGCGGGGGGCGGGGCGGGGCGG + Intergenic
1159670162 18:71212547-71212569 CGGGGCGGCGGGGGGCGGGGCGG + Intergenic
1159670165 18:71212552-71212574 CGGCGGGGGGCGGGGCGGGGCGG + Intergenic
1159670174 18:71212567-71212589 CGGGGCGGCGGGGGGCGGGGCGG + Intergenic
1159670177 18:71212572-71212594 CGGCGGGGGGCGGGGCGGGGCGG + Intergenic
1159798106 18:72867785-72867807 CGGCGGCGCCGGCGGCGGCGGGG + Exonic
1160427495 18:78788153-78788175 GTGGGGGGCGGGGGTCGGGGGGG - Intergenic
1160452425 18:78974407-78974429 CTGGCGCGGGGGGGGCGGGGCGG + Intergenic
1160453448 18:78980168-78980190 GCGCGGCGCGGGGCGCGGGGCGG - Intergenic
1160454847 18:78992959-78992981 CTGCGGCGCTGGCGCCGGGGCGG - Exonic
1160499184 18:79394121-79394143 CTGAGGAGCCGGGGCCGGGGCGG - Intergenic
1160548629 18:79679270-79679292 CCGCGGCGTGGGGTCCGGGGGGG + Intergenic
1160609249 18:80073178-80073200 GTGGGGGGTGGGGGGCGGGGGGG - Intronic
1160668433 19:344508-344530 CGGCGGCGCGGGGCGGGCGGGGG - Intronic
1160680577 19:410155-410177 CTGAGGCGGGGAGGGCAGGGAGG - Intergenic
1160691088 19:460937-460959 CTCGGGCTCGGGGGGCGCGGGGG + Exonic
1160719450 19:590826-590848 CTGCGGCGCGGCGGGTGGGGTGG + Intronic
1160726965 19:621619-621641 ATGCAGCGCGGTGGGCGGGCAGG + Exonic
1160738704 19:676325-676347 GGGCGGGGCGGGGCGCGGGGCGG - Intergenic
1160745359 19:708860-708882 GAGCGGGGCGGGGAGCGGGGCGG + Intergenic
1160763550 19:797530-797552 CTGCGGCGCGGGGAGGGCGGTGG - Intronic
1160766823 19:812545-812567 CGGCGGGGCCGGGGGCGGGCGGG - Exonic
1160776805 19:860432-860454 CGGGGGCGGGGGGGGAGGGGGGG - Intronic
1160789866 19:918396-918418 CAGGGGCGCTGGGGGAGGGGGGG + Intronic
1160792559 19:929404-929426 CTGCAGCGTGGGGGCCGCGGGGG - Exonic
1160795328 19:942649-942671 CTGCGGGGCAGTGGGAGGGGCGG - Intronic
1160841062 19:1147266-1147288 CCGCGCCGTGGGGGGCAGGGTGG - Intronic
1160844906 19:1161903-1161925 CCGCGGGGGGGGGGGGGGGGGGG + Intronic
1160863732 19:1248495-1248517 CAGGGGGGCGGGGGGCCGGGCGG - Intergenic
1160914552 19:1490418-1490440 CTATGGCGCCGGGGGCGGGTCGG - Intronic
1160930163 19:1566674-1566696 CTGCGGGGCGGGCGGGCGGGTGG - Intronic
1160947996 19:1652319-1652341 ACGCGGCGCGTGGGGGGGGGCGG + Exonic
1160991710 19:1862942-1862964 GTGGCGCGTGGGGGGCGGGGAGG - Intronic
1160991894 19:1863511-1863533 GCGCGGCGCGGCGGGCGGAGCGG + Exonic
1161014914 19:1978748-1978770 CTGGTGCGCGGCGGGCGGGGCGG + Exonic
1161014917 19:1978753-1978775 GCGCGGCGGGCGGGGCGGGGCGG + Intronic
1161022207 19:2015711-2015733 CTGCGGCGTGGGCGGGGGAGGGG + Exonic
1161063712 19:2227547-2227569 CTGCGGGGCGGGGGGCCGGAGGG + Intronic
1161101308 19:2423459-2423481 GTGGGGGGTGGGGGGCGGGGGGG + Intronic
1161216191 19:3096012-3096034 CTCCTGGGCCGGGGGCGGGGCGG + Intronic
1161265391 19:3361229-3361251 CTGCCCCGAGAGGGGCGGGGCGG + Intronic
1161266415 19:3366697-3366719 CTGGGATGCGGGGGGCGCGGGGG - Intronic
1161304161 19:3557613-3557635 CTGCGCCGGGCGGGGCAGGGCGG + Intronic
1161397450 19:4052205-4052227 CTGCGGCCAGGGAGGCAGGGTGG + Intronic
1161401512 19:4067706-4067728 CTGCGGGCCGCGGGGCGGGACGG + Intergenic
1161403282 19:4078263-4078285 CCGGGGCGGGGGGGGGGGGGGGG + Intergenic
1161450704 19:4343859-4343881 CGGCGGCGGCGGGGCCGGGGCGG + Exonic
1161476903 19:4491270-4491292 CTGCGCCGGGGGGGGTGGGGGGG - Intronic
1161482247 19:4516995-4517017 CAGCTGCGGTGGGGGCGGGGCGG - Intronic
1161519142 19:4713885-4713907 CTGCCGCGGGGTGGGTGGGGCGG - Intronic
1161612493 19:5250941-5250963 GGGCGGCGGGGGGGGGGGGGGGG + Intronic
1161633318 19:5370446-5370468 GTGAGGGGCGGGGGGTGGGGTGG - Intergenic
1161683352 19:5691465-5691487 CTGCCGGCCGAGGGGCGGGGTGG + Intronic
1161688951 19:5719829-5719851 CGGCGGCGCGGGGGGCAGCGCGG - Exonic
1161702926 19:5804955-5804977 CGGGGGCGGGGAGGGCGGGGAGG + Intergenic
1161963420 19:7535082-7535104 GTGCGGCCTGGGGGGTGGGGTGG + Intronic
1161998875 19:7730925-7730947 CTGCGGCGGGTGGTGCGGGGCGG - Intronic
1162007296 19:7788709-7788731 CTGCGGCGAGTGGGGCGGCGGGG + Intergenic
1162027753 19:7904076-7904098 CGGCGGCGTGGGGGAGGGGGCGG + Intronic
1162027787 19:7904179-7904201 CCGCAGCGGGGGGGGCGGAGAGG - Intronic
1162046738 19:8005325-8005347 CCGCGGCGGGCGGGTCGGGGCGG - Intronic
1162079030 19:8208219-8208241 CAGGGGCGCGGGGGGCGGGGCGG - Intronic
1162126532 19:8502465-8502487 CTGTGGAGGGGCGGGCGGGGGGG - Intronic
1162198503 19:9004215-9004237 CAGCGGCGTGGGCGGGGGGGTGG - Intergenic
1162405071 19:10468482-10468504 AAGTGGGGCGGGGGGCGGGGGGG - Exonic
1162490095 19:10986638-10986660 CTGGGGCGTGGGTGGCGGGGTGG + Intronic
1162741363 19:12775564-12775586 CTGCGCCTAGGGGGGCGGGGCGG - Intronic
1162932168 19:13962664-13962686 CGGGGGCGGGTGGGGCGGGGAGG + Exonic
1162954499 19:14090776-14090798 CGGCGGCGGCGGCGGCGGGGAGG - Intronic
1162964105 19:14147919-14147941 CTGGGGCGTGGGAGGTGGGGAGG + Exonic
1162975439 19:14205420-14205442 CAGTGGCGCGGGGGATGGGGAGG - Intronic
1163102573 19:15107325-15107347 GCGCGGGGCGGGGGGCGGGCGGG + Intergenic
1163135492 19:15308138-15308160 TTGCGGGGCCGGGGGGGGGGGGG + Intronic
1163135794 19:15310362-15310384 CTTCGGGGGGGGGGGGGGGGGGG - Intronic
1163154499 19:15432552-15432574 CGGCGGCGCGGGGGGTGCCGCGG + Intronic
1163424880 19:17235862-17235884 CTTCGGCGCAGGGGGCGGCGCGG - Exonic
1163427076 19:17245679-17245701 CCGTGGCGGGGGGGGAGGGGCGG + Exonic
1163513088 19:17747728-17747750 CCGCGGAGGGAGGGGCGGGGCGG + Exonic
1163530757 19:17847664-17847686 CTGCGGGGTTGGGGGTGGGGAGG - Intronic
1163591558 19:18196897-18196919 CTGGTGGGCGGGGGGGGGGGGGG + Exonic
1163606933 19:18280860-18280882 GGGCGGCGCCGGGGGCGCGGGGG - Exonic
1163635144 19:18434030-18434052 CTGGGGCGCGGGTCCCGGGGTGG - Intronic
1163672462 19:18636975-18636997 CCGAGACGCGGGGGGCGGGGCGG - Exonic
1163697963 19:18773523-18773545 CTGGGGCTCGGGGTGTGGGGTGG - Intronic
1163701875 19:18790213-18790235 CCCCGGGGCGGGGGGTGGGGGGG - Intronic
1163756651 19:19110546-19110568 CTGCAGGGCGAGGGGCGGGAGGG - Intronic
1163807057 19:19405834-19405856 CGGCGGCGCGGGCGGGCGGGCGG + Intronic
1164345934 19:27256964-27256986 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
1164456713 19:28413771-28413793 TTGCGGGGGGGGGGGGGGGGAGG + Intergenic
1164834583 19:31349386-31349408 CGGCGGAGCGCGGCGCGGGGGGG - Exonic
1165058518 19:33194117-33194139 CTGGAGCGCGGGGAGCGCGGCGG + Intronic
1165426411 19:35748331-35748353 CTGCGCCGCGCGGGGCACGGTGG - Intronic
1165479660 19:36055066-36055088 TGGTGGGGCGGGGGGCGGGGAGG - Exonic
1165668660 19:37655792-37655814 AGGCGTCGCTGGGGGCGGGGCGG - Intronic
1165748488 19:38245467-38245489 TCTCGGGGCGGGGGGCGGGGAGG - Intronic
1165862427 19:38916191-38916213 CTGTGCCGCTGGGGACGGGGTGG - Intronic
1165879469 19:39032177-39032199 CTCCGGCGCGGGGACCCGGGCGG + Exonic
1165924930 19:39320908-39320930 CTGCGGCTCGGGAGGGAGGGCGG - Intergenic
1166139590 19:40799083-40799105 CCGAGCCGCGCGGGGCGGGGCGG - Intronic
1166250419 19:41565534-41565556 AAGGGGGGCGGGGGGCGGGGGGG - Intronic
1166304142 19:41928133-41928155 CACCGGGGCGAGGGGCGGGGTGG + Intronic
1166304258 19:41928601-41928623 CGGCGGCGCGGGGGAGGGGGCGG + Intronic
1166547014 19:43639853-43639875 GCGGGGCGCGGGGGGCGGGGCGG - Intergenic
1166677483 19:44748631-44748653 CGGGGGGGCCGGGGGCGGGGAGG + Exonic
1166837659 19:45677284-45677306 CTGCGGCGGGGTGGGGGGGCGGG + Intronic
1166975086 19:46601218-46601240 CGGCGGCGCGCGGGCCGGGTGGG + Exonic
1167001188 19:46746494-46746516 TTGCGGCGGGGGAGGGGGGGGGG - Exonic
1167019049 19:46860983-46861005 CCTCGGGGCGGGGGGCGGGGAGG - Intergenic
1167118151 19:47500251-47500273 GAGCGGTGTGGGGGGCGGGGAGG - Intronic
1167258155 19:48443154-48443176 GGGCGGCGCGGGGGGCACGGGGG + Exonic
1167293165 19:48635557-48635579 GTGCGGCGAAGGGGGCGGGGCGG - Intronic
1167471268 19:49677588-49677610 CCGCTGCGCGGTGGGTGGGGAGG + Intronic
1167557226 19:50203831-50203853 CGGCGGCGAGGGAGGTGGGGGGG + Intronic
1167600308 19:50451116-50451138 CTGCCGCCCGGGAGGAGGGGTGG + Intronic
1167738690 19:51311720-51311742 CACCGGCCCGGGGGGCGGCGGGG - Intergenic
1168076535 19:53983169-53983191 GGGCGGGGCGGGGGGAGGGGAGG + Exonic
1168277029 19:55284255-55284277 CCGCGGAGCTGGGGGAGGGGGGG - Exonic
1168293868 19:55369620-55369642 GGGGGGCGCGGGGGGCGCGGGGG + Intronic
1168293873 19:55369629-55369651 GGGGGGCGCGGGGGGCGCGGGGG + Intronic
1168315197 19:55481999-55482021 CGGGGGCGGGGGCGGCGGGGCGG - Exonic
1168339125 19:55613809-55613831 CTGCGGCGGGGGCTGCGGCGGGG - Exonic
1168685984 19:58350013-58350035 CTGCGGGACCGGGGCCGGGGCGG + Intronic
1202683842 1_KI270712v1_random:31291-31313 CGGCGGCGGGGGGGGAGGGGTGG - Intergenic
925215625 2:2093299-2093321 CAGCGGAGCAGGGGGTGGGGCGG + Intronic
925984725 2:9206720-9206742 CGGCCGGGCGTGGGGCGGGGCGG - Intergenic
926077257 2:9951514-9951536 GAGCGGCGCGGGGCGGGGGGCGG - Intergenic
926089877 2:10043198-10043220 GGGCGGCGGGGGCGGCGGGGCGG - Intronic
926268195 2:11344721-11344743 GCGCGGTGCGCGGGGCGGGGCGG - Intronic
926299560 2:11592888-11592910 CCGCGGCGCTGGGCGCGGGCGGG - Exonic
926447787 2:12965352-12965374 GTGCGGGGTGGGGGGCGCGGTGG - Intergenic
926471072 2:13259217-13259239 AAGCGGGGGGGGGGGCGGGGAGG - Intergenic
926755165 2:16228512-16228534 CAGTGGAGCGGGGGGTGGGGCGG - Intergenic
926914401 2:17878684-17878706 CGGCGGCGAGGAGAGCGGGGTGG - Intronic
927181099 2:20447287-20447309 CTGCCGCGGCGGGGGCGGTGGGG - Exonic
927215854 2:20667449-20667471 CCGCGGCGCGGCGCGCGGCGCGG - Exonic
927471275 2:23379438-23379460 CTGTGGGGCGGGGGGGGGGGGGG + Intergenic
927471277 2:23379440-23379462 GTGGGGCGGGGGGGGGGGGGGGG + Intergenic
927472213 2:23385233-23385255 CGGCGGCGCGGGGGCTGGCGCGG - Exonic
927652426 2:24920410-24920432 ATCCGGCGCGGGCGGCGGGCTGG + Intergenic
928118853 2:28567050-28567072 CTTGGGGGCCGGGGGCGGGGAGG + Intronic
929033658 2:37671675-37671697 CTGCGGAGGGCGGGGCGGCGCGG + Exonic
929604697 2:43226651-43226673 CTGCGGCGGGGCGGGCGCGCCGG + Intergenic
929701845 2:44169106-44169128 CGGCGGCGTGAGGGGCCGGGCGG + Exonic
929920452 2:46167743-46167765 CAGGGGACCGGGGGGCGGGGTGG - Intronic
930011421 2:46941034-46941056 CCGCGGCGGGGGCGGCGGCGGGG + Intronic
930124351 2:47783895-47783917 GGGCGGGGCGGGGGGCGGGGTGG + Intronic
930577336 2:53166765-53166787 TTGTGGGGTGGGGGGCGGGGGGG + Intergenic
931005291 2:57843623-57843645 CTGGTTGGCGGGGGGCGGGGGGG + Intergenic
931052315 2:58428520-58428542 CGGGGCCGCCGGGGGCGGGGAGG - Intergenic
931517803 2:63059858-63059880 CTGCCGGGCCGGGGGCGGCGGGG + Intergenic
931893113 2:66697146-66697168 TTGCGGGGAGGGGGGTGGGGGGG + Intergenic
932017213 2:68042825-68042847 TTGCGGGGGGGGGGGGGGGGGGG + Exonic
932042971 2:68319467-68319489 CTGGAGCGCGAGGGGCGGAGAGG + Exonic
932632105 2:73353696-73353718 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
932893196 2:75613344-75613366 CTGCGGGGGGGGGGGGGGGGGGG + Intergenic
933316909 2:80726750-80726772 CTGCTGGGTGGGGGGTGGGGGGG - Intergenic
933325495 2:80831563-80831585 TTGGGGAGCGGGGGGTGGGGGGG - Intergenic
933654975 2:84879996-84880018 CCGCGACGCGGGGGTGGGGGGGG - Intronic
933657942 2:84905072-84905094 TAGTGGAGCGGGGGGCGGGGGGG - Intronic
933666855 2:84971274-84971296 CGGCGGCGGCGGCGGCGGGGAGG - Exonic
933791784 2:85888952-85888974 GAGCGGCGCTGGGGGCGGGTGGG - Exonic
934048682 2:88191784-88191806 CTGCAGGTCGGAGGGCGGGGTGG + Intergenic
934290536 2:91686977-91686999 CTGGGGCGGGGGGGGGGGGGGGG - Intergenic
934290538 2:91686979-91687001 CTCTGGGGCGGGGGGGGGGGGGG - Intergenic
934304580 2:91810366-91810388 CCGCGGCACGGTGGGCGGGGGGG - Intergenic
934328677 2:92042384-92042406 CCGCGGCACGGTGGGCGGGGGGG + Intergenic
934763897 2:96869934-96869956 CGGCGACGCGGGGGCAGGGGTGG - Exonic
934966825 2:98731004-98731026 CGGCGGCGCGCGGGGGCGGGAGG - Intronic
935349739 2:102142859-102142881 CTGGGGCGCGCGGGGCAGGCCGG - Exonic
935692683 2:105745085-105745107 CAGCGGCGCGGGTCCCGGGGCGG - Exonic
935746507 2:106194081-106194103 CGGCGCCGCGGTGGGCCGGGCGG - Intronic
936040678 2:109146886-109146908 TTGGGGCGGGGGGGGGGGGGGGG - Intronic
936126706 2:109794593-109794615 CGGCGGCGGCGGCGGCGGGGGGG + Intronic
936390773 2:112071298-112071320 CGGCGGCGGGGGGGCGGGGGGGG - Intronic
936976247 2:118224775-118224797 TTGCGGGGCGCTGGGCGGGGCGG - Intergenic
937045145 2:118847174-118847196 CGGCGGCCGGGGCGGCGGGGCGG - Exonic
937993166 2:127675194-127675216 GTGGGGCCCGCGGGGCGGGGTGG + Intronic
938017058 2:127876045-127876067 CAGCGGGTGGGGGGGCGGGGCGG - Intronic
938038138 2:128053515-128053537 CGGCGGCGGCGGGGGCGGGTAGG - Intergenic
938099191 2:128486614-128486636 CCGCGTGGCCGGGGGCGGGGTGG + Intergenic
938432593 2:131258764-131258786 TTGCGGGGGGGGGGGGGGGGTGG - Intronic
938449426 2:131403890-131403912 CTGCGGTGGGGGAGGCGGCGGGG - Intergenic
938451538 2:131425312-131425334 CGGCGGCTCGGGGAGCGAGGCGG - Intergenic
938453676 2:131444941-131444963 CGGCGGGGCGGGGAACGGGGCGG - Intergenic
938475982 2:131614067-131614089 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
938934379 2:136116290-136116312 AGGCGGCGTGGGGGGTGGGGTGG + Intronic
939420216 2:141957382-141957404 GTGGGGGGGGGGGGGCGGGGGGG + Intronic
939630876 2:144524560-144524582 TTGGGGGGCGGGGAGCGGGGGGG + Intronic
939788115 2:146541074-146541096 CTGTGGGGCGGGGTGGGGGGGGG + Intergenic
939969660 2:148644962-148644984 CGGCGGCGGGGCGGGCGGGGAGG - Exonic
939974436 2:148700480-148700502 ATGCGGGGCGGGGGGGAGGGGGG - Intronic
941951311 2:171160202-171160224 CCGGGGCGGGGGGGGCGGGGGGG + Intronic
942278962 2:174342289-174342311 GTGGGGCGCGGGGGGCGGCTGGG + Intergenic
942450998 2:176107939-176107961 TGGCGGCGCGGGTGGCGGCGGGG - Exonic
942459038 2:176157133-176157155 GCCCGGCGCGGGGGGCAGGGAGG - Intronic
943669863 2:190649084-190649106 CTGCGGCGCGCGGGCGGCGGCGG - Intronic
944060046 2:195563113-195563135 GTGGGGGGAGGGGGGCGGGGGGG - Intergenic
944060135 2:195563273-195563295 CGGGGGCGGGGGGGGCGGAGGGG - Intergenic
945241553 2:207681459-207681481 CCGCGGCGAGGGCGGCGGCGGGG - Intergenic
945254435 2:207791885-207791907 GTGGGGGGTGGGGGGCGGGGGGG + Intergenic
945437658 2:209838251-209838273 GTGCGGGGTGGGGGGTGGGGAGG - Intronic
945901801 2:215546444-215546466 TTGCGGGGCGGGGAGGGGGGAGG + Intergenic
946190917 2:218007551-218007573 CTGAGGCTCGGGGGGTGGGGGGG + Intergenic
946321832 2:218959141-218959163 CTGGGGGGTGGGGGGCGAGGTGG + Intergenic
946322470 2:218961804-218961826 CTGAGGCGCCGCGGCCGGGGTGG - Exonic
946330253 2:219004815-219004837 CTGGGGTGGGGGGGCCGGGGGGG + Intronic
946416428 2:219542225-219542247 CAACGGGGCGGGGGGTGGGGGGG + Intronic
946692277 2:222319040-222319062 CTGCGGCGGGCGGCGCGCGGAGG - Intergenic
946748236 2:222866762-222866784 CCGGGGCGGGGGGGGGGGGGGGG - Intronic
946748240 2:222866764-222866786 CCCCGGGGCGGGGGGGGGGGGGG - Intronic
946929448 2:224657326-224657348 TTGGGGCGGGGGGGGGGGGGGGG + Intergenic
947119168 2:226798871-226798893 CCCCGGCGCGGGGGGCGGCGTGG - Exonic
947399128 2:229714594-229714616 CTGCGGGGCGGGGCGGGGCGGGG + Intergenic
947702657 2:232247610-232247632 CTGCCGCGGGGGGGGGGGGGGGG + Intronic
947702661 2:232247613-232247635 CCGCGGGGGGGGGGGGGGGGGGG + Intronic
947748501 2:232521433-232521455 CTGGGGCACGGGGGGCAGGGTGG - Intronic
948002729 2:234581606-234581628 CTGAGGGGCTGGGGACGGGGAGG - Intergenic
948402063 2:237691897-237691919 ACGGAGCGCGGGGGGCGGGGCGG + Intronic
948645298 2:239400624-239400646 AGGCTGCGCGGGGCGCGGGGCGG + Exonic
948801756 2:240436324-240436346 CCGGCGTGCGGGGGGCGGGGAGG - Intronic
948854757 2:240724928-240724950 CGGCGGCGGGGGGGGGGGGGGGG + Intronic
948867225 2:240782307-240782329 GTGTGGCCCGGGGGGCGTGGGGG - Intronic
948953914 2:241272680-241272702 CTGCCGGGCGGGGGGGTGGGGGG - Intronic
949014748 2:241702643-241702665 CTGCGGCGCGGAGGCGGGGAGGG + Intronic
1168756771 20:324177-324199 CCGCGGCGCGGGGGGCGGGGTGG - Intergenic
1168766076 20:382029-382051 CTGCGGGGGGCGGGGCGGGGTGG + Intronic
1168855029 20:1002231-1002253 CGGCGGCACGGCGGGCGCGGGGG + Exonic
1168965088 20:1894251-1894273 CGGGGGCGCGGGGGGCGGGGGGG - Exonic
1169278487 20:4248870-4248892 CTCCAGCGCGGGCGGCGGCGGGG - Exonic
1169327431 20:4686907-4686929 CCGCAGGGCGCGGGGCGGGGAGG + Intronic
1169664504 20:8019406-8019428 CTGCGGCGTCCGGGGCGGGCGGG + Intronic
1169860543 20:10147088-10147110 CTGGGGTTTGGGGGGCGGGGGGG - Intergenic
1170150380 20:13221376-13221398 CTGCGGGGTCGGCGGCGGGGCGG - Intergenic
1170163955 20:13343572-13343594 CGGGGGCGGGGGCGGCGGGGCGG - Intergenic
1170578770 20:17682515-17682537 CGGCCGTGCGCGGGGCGGGGCGG + Intergenic
1170756806 20:19212488-19212510 CGGCGGCGCGGCGGGGGCGGCGG - Intergenic
1170908895 20:20543729-20543751 GTGGGGCGGGGGGAGCGGGGAGG + Intronic
1170969684 20:21105273-21105295 GTGGGGGGCGGGGGACGGGGGGG - Intergenic
1171392317 20:24809452-24809474 CTGCAGCGCGGGGAGATGGGCGG + Intergenic
1171447760 20:25216820-25216842 CTGCGGGGTGGGGTGGGGGGTGG + Intronic
1171452824 20:25248003-25248025 CGGGGCCTCGGGGGGCGGGGCGG - Intergenic
1171452843 20:25248051-25248073 CTGCGGCTCTGCGGGCGGGATGG - Exonic
1171473522 20:25390480-25390502 GCGCGGAGCGGGGGGGGGGGGGG - Intronic
1172118285 20:32584093-32584115 CCGCGGGGTGGGGGGGGGGGAGG - Intronic
1172662046 20:36574438-36574460 CTGGGGGGGGGGGGGCGGCGCGG + Intronic
1172698077 20:36835848-36835870 CAGCGGCGGCGGCGGCGGGGAGG - Intronic
1172840793 20:37901886-37901908 GCGGGGGGCGGGGGGCGGGGGGG + Intergenic
1172944092 20:38674558-38674580 CCGGGGCTCTGGGGGCGGGGTGG - Intergenic
1173166313 20:40689282-40689304 CTGGGGTGCGGGGGCCCGGGCGG + Intergenic
1173279776 20:41618109-41618131 CTGCGGCCTGGGGAGAGGGGCGG - Intronic
1173494334 20:43507866-43507888 CTCCGGCGGGGGGCGCGGGCTGG + Intronic
1173672110 20:44805991-44806013 CTGTTGGGCTGGGGGCGGGGTGG - Intronic
1173827605 20:46057659-46057681 CAGCGGCGGGGGGCGCGGCGAGG - Exonic
1173939068 20:46894763-46894785 CAGCGGCGCGGGGACCCGGGCGG + Exonic
1173972018 20:47160483-47160505 CGGTGGGGCGGGGGGCGGTGCGG + Intronic
1174246713 20:49187779-49187801 CTGGGGCGCAGGCGGGGGGGGGG - Intronic
1174378670 20:50142680-50142702 TTGGGGCGGGGGGGGGGGGGCGG - Intronic
1174607006 20:51768393-51768415 AGGCGGCGCGGGGGGCGCGGCGG - Exonic
1175210443 20:57350865-57350887 CGGGGGGACGGGGGGCGGGGGGG + Intergenic
1175210450 20:57350874-57350896 GGGGGGCGGGGGGGGCGGGGGGG + Intergenic
1175210485 20:57350926-57350948 GGGCGGCGCGGGGGGGCGGGGGG + Intergenic
1175210496 20:57350943-57350965 GGGGGGGGCGGGGGGCGGGGCGG + Intergenic
1175226984 20:57450495-57450517 GTGCGGGGTGGGGAGCGGGGGGG - Intergenic
1175267219 20:57710043-57710065 CCACCGCGCGGGGGCCGGGGAGG + Intronic
1175562279 20:59940340-59940362 CGGCGTCACGAGGGGCGGGGCGG - Intronic
1175709221 20:61206071-61206093 CTGGGGCTGGGGGGGGGGGGGGG - Intergenic
1175846271 20:62060538-62060560 CCGCGGGGCAGGGGGCAGGGAGG + Intronic
1175847475 20:62066121-62066143 CAGGGGCGCGGGCGCCGGGGCGG + Intergenic
1175911388 20:62406974-62406996 CTGGGGCGCGGGGGTCCTGGCGG + Exonic
1175943879 20:62550037-62550059 CTGCAGGGCCGGGGGTGGGGGGG - Intergenic
1175985150 20:62760870-62760892 CTGCGGCGAGGGTGGTGGGAGGG - Exonic
1176062640 20:63178995-63179017 CCGCGGTGCTGGCGGCGGGGCGG + Intergenic
1176080910 20:63272664-63272686 CTGCGGTCCGGGGCCCGGGGTGG + Intronic
1176084022 20:63287786-63287808 CGACGGCGGGGAGGGCGGGGAGG + Exonic
1176143209 20:63554089-63554111 CTGCGGCCCGGGGGCGGGGCGGG - Exonic
1176148081 20:63574272-63574294 GGGCGGGGCGGGGGGCGGTGAGG - Intergenic
1176221088 20:63969684-63969706 GGGCGCGGCGGGGGGCGGGGGGG + Intronic
1176234935 20:64049686-64049708 CGGCGGCGGGGCGGGCGGGCGGG + Intergenic
1176242129 20:64080033-64080055 GCGGGGCGCGGCGGGCGGGGCGG - Intergenic
1176242729 20:64082595-64082617 CTGCTGGGCAGGGGGCTGGGAGG + Intronic
1176247157 20:64102716-64102738 CCGCGGGGTGGGGGGCGGAGGGG - Intergenic
1176281596 20:64316661-64316683 TTGGGGCGCGGGGGTTGGGGAGG + Intergenic
1176281622 20:64316738-64316760 CAGCGGGGCGGGGCGCGGCGGGG + Intergenic
1176414523 21:6467209-6467231 CGCCGGCGCGGGGGCTGGGGTGG + Intergenic
1176549518 21:8215033-8215055 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1176555708 21:8253269-8253291 CGGCGGCGCGGGCGCAGGGGTGG - Intergenic
1176568443 21:8398067-8398089 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1176576355 21:8442297-8442319 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1176733306 21:10521276-10521298 CGGCGGGGCGGGGGGGGAGGGGG - Intergenic
1177157439 21:17513286-17513308 CTGCTGCAGGGGCGGCGGGGCGG + Intronic
1177792281 21:25734604-25734626 GGGCGGCGCGGGGGGCAGGGAGG - Exonic
1178513826 21:33229893-33229915 CGCCGGCGCGGGGGCGGGGGCGG - Intronic
1178592819 21:33925752-33925774 CTGTGGGGTGGGGGGAGGGGGGG - Intergenic
1178610389 21:34074003-34074025 CCGCCGGGCGGGGGGCGGGGCGG + Intronic
1178673823 21:34614652-34614674 CGGCCGCGCGCGGGGCGGGGAGG - Intronic
1178707431 21:34887232-34887254 CTGCGGGGGGTGGGGGGGGGCGG + Intronic
1178843329 21:36155969-36155991 TTGGGGCGCAGGGGGCGCGGCGG - Intergenic
1178922557 21:36748025-36748047 CAGGGGCGCGCCGGGCGGGGAGG - Exonic
1178948459 21:36966805-36966827 CTGCGGCGGGAGGGGCGGGGGGG + Intronic
1179209342 21:39312936-39312958 CTCCGGCGCGGGGGGGGCGGGGG + Intronic
1179626948 21:42654068-42654090 CTGGGGGGTGGGGGGTGGGGGGG + Intronic
1179690021 21:43075531-43075553 CGCCGGCGCGGGGGCTGGGGTGG + Intronic
1179786463 21:43733258-43733280 CCAGGGCGGGGGGGGCGGGGGGG - Intronic
1179794775 21:43776443-43776465 GCGCGGGGCGGGGCGCGGGGCGG + Exonic
1179794781 21:43776455-43776477 GCGCGGGGCGGGGCGCGGGGCGG + Intergenic
1179810283 21:43865467-43865489 TTGCGGCGCGGGGCCCCGGGCGG - Intronic
1179826281 21:43968217-43968239 CTGCAGGGCTGGGGGTGGGGTGG + Intronic
1179920678 21:44505565-44505587 CTGGGGGGGGGGGGGGGGGGAGG - Intronic
1180090400 21:45531144-45531166 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180090422 21:45531188-45531210 CCACGGGGCAGGGGGCGGGGAGG + Intronic
1180095467 21:45554000-45554022 ATGGGGCGCGGGGGACTGGGAGG - Intergenic
1180095878 21:45555196-45555218 GGGCGGCGCAGGGGGCGGTGGGG + Intergenic
1180095920 21:45555288-45555310 GGGCGGCGCAGGGGGCGGCGGGG + Intergenic
1180103032 21:45598759-45598781 CTGCGGCGAGGGGGGAGGGCGGG + Intergenic
1180104361 21:45608156-45608178 CTGCGGTGCGTGGGTCGGAGCGG - Intergenic
1180177809 21:46098647-46098669 CGGCGGGGCGGGGGGAGGAGGGG + Intronic
1180557043 22:16586332-16586354 CTGCGGCGGGGGGGTGGGGGTGG + Intergenic
1180614766 22:17120221-17120243 CGGCGGCGCGGGGGGCGGCCTGG - Exonic
1180650215 22:17370304-17370326 CGGCGGGGCCGGGCGCGGGGGGG + Intronic
1180731308 22:17984534-17984556 GTGGGGCGTGGGGGGTGGGGGGG - Intronic
1180801588 22:18634481-18634503 GCGCGGCGCGGGGGACGGCGCGG - Intergenic
1180843530 22:18970107-18970129 CTTCTGTGCAGGGGGCGGGGGGG + Intergenic
1180852831 22:19030020-19030042 GCGCGGCGCGGGGGACGGCGCGG - Intergenic
1180910694 22:19447874-19447896 CTGCGGCGCGCGCGGAGGGCCGG + Exonic
1181007501 22:20021013-20021035 CCGCGCAGCGAGGGGCGGGGCGG - Intronic
1181026612 22:20131127-20131149 CGACGGCGCTGTGGGCGGGGTGG - Intronic
1181068818 22:20320144-20320166 CGGCGGGGCGCGGGGCAGGGCGG - Intergenic
1181467576 22:23118470-23118492 CCGCGGGGGGTGGGGCGGGGCGG - Intronic
1181478007 22:23180502-23180524 CTGCGGCGCAGAGTGCGGGCCGG + Exonic
1181592659 22:23894670-23894692 CTGGGGGGCGGGGCGGGGGGAGG + Exonic
1181697914 22:24603114-24603136 GGGCGGGGCGGGGGGAGGGGAGG - Intronic
1181811097 22:25404612-25404634 CTGCCCGGAGGGGGGCGGGGGGG - Intronic
1182060198 22:27391741-27391763 GTGCTGCTCTGGGGGCGGGGGGG + Intergenic
1182576474 22:31276574-31276596 CCGCGGCGAGGGCGGCGGCGGGG - Intronic
1182697117 22:32205272-32205294 CTGTGGCGTGGGGGGCGGGTTGG + Intergenic
1183201475 22:36388006-36388028 CCGCGGCTCCGAGGGCGGGGCGG - Exonic
1183369181 22:37422935-37422957 CTGGGCCTCGGGGGGGGGGGGGG + Intronic
1183416807 22:37687260-37687282 CTGTGGGGCGGGTGGGGGGGGGG - Intronic
1183474176 22:38026816-38026838 CTGGGGGGCGGTGGGCGGTGTGG - Intronic
1183535665 22:38399086-38399108 ATGGGGCGGGGGGCGCGGGGAGG - Intergenic
1183535705 22:38399173-38399195 ACCCGGCGGGGGGGGCGGGGGGG + Intergenic
1183586388 22:38755558-38755580 CAGTGGCGCGGCAGGCGGGGCGG + Intronic
1183642441 22:39100827-39100849 AGCCGGGGCGGGGGGCGGGGAGG - Intronic
1183702212 22:39457234-39457256 CGGGCGCGCGGGGGGCGCGGAGG - Intergenic
1183740168 22:39664688-39664710 CTGCCGCGGGAGGGGCGGGCAGG - Intronic
1183856063 22:40636191-40636213 CTGTGCTGCGCGGGGCGGGGAGG - Intronic
1184086913 22:42270727-42270749 CGGCGGGGCGGGGCGCGCGGCGG + Intronic
1184152948 22:42649146-42649168 GTGGGGCGCGGCGGGCTGGGCGG + Intronic
1184236817 22:43187256-43187278 CGGAGGCGGGGGGGGCTGGGAGG - Intergenic
1184337399 22:43862035-43862057 CTGCGGGGCGGGGTGGGGTGGGG - Intronic
1184472138 22:44702145-44702167 CGGCGCCCCGGGGGGCGGGGCGG - Intronic
1184617150 22:45645904-45645926 TTGCGGAGGCGGGGGCGGGGCGG - Intergenic
1184663255 22:45975320-45975342 CTGCTGGGCGGGGGGTGGAGTGG - Intronic
1184759765 22:46537667-46537689 CCGCTGGGCCGGGGGCGGGGCGG - Intergenic
1185055321 22:48576040-48576062 GGGCGGCGCGGGGGGGGGGGGGG - Intronic
1185246484 22:49775862-49775884 GTTCGGCGAGGGGGGCGTGGGGG - Intronic
1185271073 22:49929529-49929551 CGGCGCCGCGTGGGGAGGGGCGG - Intergenic
1185313725 22:50170183-50170205 CTGCGTGGCGGGGGGCGGGGTGG + Intergenic
1185315660 22:50178196-50178218 CGGCGGGGCGGGGGCAGGGGCGG - Exonic
1185342902 22:50299602-50299624 CCGCGGGGCGTGGGGCTGGGGGG + Intronic
1185345631 22:50309385-50309407 CTGGAGTGCGTGGGGCGGGGAGG + Exonic
1185397554 22:50600661-50600683 CGGCGGCGCGGGGAGGGCGGCGG - Intronic
1185397587 22:50600753-50600775 CGCCGGCGCGGGGCGCGGCGAGG + Exonic
1185409498 22:50674542-50674564 CTCCGGCGGGGGGGAAGGGGGGG + Intergenic
1185413428 22:50697572-50697594 CGGCGGTGCGGGGGGCGCAGGGG - Intergenic
1203254405 22_KI270733v1_random:131355-131377 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1203262461 22_KI270733v1_random:176434-176456 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
949577780 3:5355585-5355607 CTGGGGCGGGGGGCGGGGGGAGG + Intergenic
949748689 3:7326042-7326064 CTTTGGGGCCGGGGGCGGGGAGG - Intronic
949938614 3:9136416-9136438 ACGTGGCGCGCGGGGCGGGGCGG - Intronic
949970201 3:9397522-9397544 GTGCGGGGCGGTGGGCGGAGAGG + Intergenic
950176219 3:10876735-10876757 GTGGGGCGGGGGGGGGGGGGCGG - Intronic
950177203 3:10883043-10883065 CAAGGGGGCGGGGGGCGGGGAGG + Intronic
950316346 3:12004742-12004764 CTGCGGCGCGGGCGCCGAGGCGG - Exonic
950400976 3:12768928-12768950 GCGGGGCGGGGGGGGCGGGGGGG + Intronic
950400983 3:12768937-12768959 GGGGGGCGGGGGGGGCGGGGGGG + Intronic
950530351 3:13549334-13549356 CGGCGGCGCGGGTGGAGGCGCGG - Intronic
950831572 3:15879914-15879936 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
951630657 3:24716521-24716543 CAGTGGGGAGGGGGGCGGGGGGG + Intergenic
951717389 3:25664258-25664280 CTGCGGCGCGGGAGCCGGCGTGG - Exonic
951717430 3:25664410-25664432 ATGGGGCGCGGGGGTCGGCGCGG - Exonic
952532846 3:34279880-34279902 CGGGGGGGGGGGGGGCGGGGAGG - Intergenic
952816588 3:37452388-37452410 CTGCGCCGAGGGGCGCCGGGAGG + Exonic
952867226 3:37862118-37862140 GCGCGGCGCGGGGGGCGCGGGGG - Intronic
953248505 3:41220412-41220434 CTTCGGGGAGGGGGGTGGGGTGG - Intronic
953319750 3:41961557-41961579 CTGGGGAGCGGGGGGGGGGGGGG - Intronic
953561402 3:43995910-43995932 CGTCGGCGCGGGGCGCGGAGGGG + Intergenic
953614483 3:44477754-44477776 CTCCGGTGCGGCGGGCGGCGGGG + Intergenic
953680670 3:45035926-45035948 CGGCGGGGCGGGGGCCGTGGGGG + Exonic
953705341 3:45226242-45226264 CCCCGGCGCCGGGGGCGGCGGGG - Exonic
953705379 3:45226353-45226375 CTGGCGAGCGGAGGGCGGGGCGG - Intergenic
953716180 3:45318912-45318934 ATGTAGGGCGGGGGGCGGGGTGG - Intergenic
953761294 3:45689331-45689353 CTGCGGGGCGGGGAAAGGGGTGG + Exonic
953761342 3:45689520-45689542 CTGAGGCGCGGCGGGCGGGGCGG + Intronic
954004217 3:47578863-47578885 CGGCGGCGCGGGAGGCGGGGAGG - Exonic
954198350 3:49009309-49009331 TTGGGGCGGGGGGGGGGGGGTGG - Intronic
954442687 3:50530440-50530462 TTGGGGCGCGGGCGGCGGCGGGG + Intergenic
954468872 3:50674952-50674974 CGGCGGCGCCGGGAGCCGGGCGG + Intergenic
954615640 3:51967603-51967625 CCGCGGCGCGCGGGGCGGGGCGG - Intronic
954779085 3:53046103-53046125 CCGCGGAGCTGGGGGTGGGGGGG - Intronic
954797814 3:53170434-53170456 CTGGCGCGCAGGGGGAGGGGAGG - Intronic
954864682 3:53718568-53718590 CGGGGGGGCGGGGGGTGGGGAGG - Intronic
955186058 3:56716601-56716623 GTTGGGCGGGGGGGGCGGGGGGG - Intergenic
955188019 3:56733323-56733345 GGGCGGGGCGGGGGGGGGGGGGG + Intronic
955228438 3:57079309-57079331 GGGCGGGGCCGGGGGCGGGGAGG + Intronic
955246271 3:57227810-57227832 CTGCGGCGGGCGGGCCGGCGCGG + Exonic
955554236 3:60118759-60118781 CTGAGGTGGGGGCGGCGGGGGGG + Intronic
955554243 3:60118768-60118790 GGGCGGCGGGGGGGGGGGGGTGG + Intronic
955769111 3:62371982-62372004 GTTCGGCGAGGGGGGCCGGGAGG - Intronic
955819016 3:62875793-62875815 CTGGGGCGTGGGGGGCGTGGGGG + Intergenic
956422462 3:69099121-69099143 CTGAGGGGCGGGGGGGGTGGGGG + Intronic
956675076 3:71725446-71725468 GCGGGGCGCGCGGGGCGGGGCGG - Intronic
956887445 3:73574451-73574473 CTGGGGTGGGGGGGGTGGGGAGG + Intronic
957752558 3:84440572-84440594 CTGCGGCCTAGGGGTCGGGGAGG + Intergenic
958141728 3:89570928-89570950 GTGGGGGGGGGGGGGCGGGGTGG + Intergenic
958711217 3:97719093-97719115 CCGCGGCGGGGGGGGTGGGGGGG - Intronic
959261116 3:104081664-104081686 CTGTGGTGGGGGGGGTGGGGGGG + Intergenic
959941650 3:112086987-112087009 CTGCGGCGAGGTGGGTGGAGGGG - Intronic
960096749 3:113696661-113696683 CGGCCGCGGGAGGGGCGGGGAGG - Intergenic
960586138 3:119322940-119322962 CTGCGGGGCGGGGGCAGGGCTGG - Intronic
960785734 3:121371617-121371639 CTGGGGCGTGGGGGGCAGTGTGG + Intronic
960829971 3:121835500-121835522 CTACGGGGCGGGGAGGGGGGAGG + Intronic
960977951 3:123194763-123194785 CGGCGGGGCGGGGCGGGGGGAGG - Intronic
961013395 3:123449803-123449825 GGGCGGCGCGGGGGGCGGGGAGG - Intergenic
961320098 3:126067094-126067116 GGCCGGGGCGGGGGGCGGGGGGG - Intronic
961612620 3:128152986-128153008 GGGGGGCGGGGGGGGCGGGGTGG - Intronic
961737068 3:129009003-129009025 TGGCGGGGTGGGGGGCGGGGCGG + Intronic
961858231 3:129893612-129893634 AGGCGGCGCGGGGGGAGGGTCGG - Intergenic
962156820 3:132956817-132956839 CAGGGGCGGGGGGGGCGGCGCGG - Intergenic
962277954 3:134030034-134030056 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
962301790 3:134250298-134250320 TCCGGGCGCGGGGGGCGGGGAGG + Intronic
962678211 3:137771423-137771445 AGGCGGCGAGGGGGGAGGGGAGG + Intergenic
963081923 3:141402472-141402494 TCGCGGGGCCGGGGGCGGGGCGG + Intronic
963091399 3:141486931-141486953 CGGGGCCGCGGCGGGCGGGGCGG + Intergenic
963091403 3:141486936-141486958 CCGCGGCGGGCGGGGCGGGGCGG + Intergenic
963637365 3:147815682-147815704 GTGGGGCGGTGGGGGCGGGGAGG + Intergenic
963827507 3:149970932-149970954 CGGCGGCGCGGGGGGAGGCGGGG + Exonic
963939706 3:151086337-151086359 CTGCGGGGCGCGTGGCGGCGGGG + Intronic
964358512 3:155871162-155871184 CAGCGGCGCGGGGGAGGCGGGGG - Intronic
965285456 3:166813755-166813777 GTGTGGGGCGGGGGGGGGGGTGG - Intergenic
965558133 3:170038072-170038094 CGGGAGCGCGCGGGGCGGGGCGG + Exonic
965592049 3:170370442-170370464 CTCCTGCTCGGGGGGGGGGGGGG - Intronic
965615214 3:170585853-170585875 CTGGGGCGCGGGGGGCGCGGAGG + Intronic
966119444 3:176506073-176506095 CTGCGGCGGGGCGGGGGGAGGGG + Intergenic
966182289 3:177197848-177197870 CCGCGGCGGTGGGGGCGGGGCGG - Intergenic
966350145 3:179024845-179024867 CTGGGGGCCCGGGGGCGGGGCGG - Exonic
966784235 3:183608965-183608987 AGGCGGCGGGGGGGGGGGGGGGG + Intergenic
966784238 3:183608968-183608990 CGGCGGGGGGGGGGGGGGGGGGG + Intergenic
966890861 3:184406520-184406542 GTGGGGTGCGGGGGGTGGGGGGG + Intronic
967033713 3:185631600-185631622 CTGCGGGGGGGGGGGGGGGAGGG - Exonic
967055407 3:185825360-185825382 CAGCGGCGCGGGGCGGGGAGGGG - Intergenic
967087290 3:186107661-186107683 CCGGGGCGCGGGTGGTGGGGGGG - Intronic
967684940 3:192408451-192408473 CTGGCGGCCGGGGGGCGGGGCGG + Exonic
967904130 3:194486892-194486914 CTACGTCGCTGGCGGCGGGGGGG - Intronic
968113040 3:196065409-196065431 AAGCGGGGCGGGGGGGGGGGGGG + Intronic
968199414 3:196739835-196739857 CGGCGGGGAGCGGGGCGGGGCGG - Exonic
968224841 3:196967139-196967161 CTGCGGGGCGGGAGGAGGGGAGG + Intronic
968450557 4:674151-674173 CTGCGGGGCGGGACACGGGGGGG + Intronic
968452459 4:681787-681809 CTGCGCCGCGGGAGGGGGAGCGG - Intronic
968514210 4:1009641-1009663 CTGGGACGTGGCGGGCGGGGCGG + Intergenic
968515008 4:1012105-1012127 GTGGGGCGCGGGGGCGGGGGCGG - Intronic
968585644 4:1414831-1414853 CGGCGGTGCGAGGGGCGTGGGGG - Intergenic
968653128 4:1767753-1767775 GCGGGGCGCGGGGCGCGGGGCGG - Intergenic
968661806 4:1801756-1801778 GGGCGGCGCGGGGGTGGGGGCGG + Intronic
968673077 4:1862700-1862722 CTGGGGAGTGGGGGGTGGGGGGG + Intergenic
968674719 4:1871352-1871374 CTGCGGCGGCGGCGGCGGGCGGG + Intergenic
968701179 4:2059007-2059029 CGTGGGAGCGGGGGGCGGGGCGG + Intergenic
968701378 4:2059657-2059679 TGGGGGCGCGGGGGGCGCGGCGG - Exonic
968879819 4:3293106-3293128 GTGCGGGGCCGGGGCCGGGGCGG + Intronic
969113363 4:4857067-4857089 CCGCCGCGGGGGGGGGGGGGGGG - Intergenic
969113366 4:4857069-4857091 CTCCGCCGCGGGGGGGGGGGGGG - Intergenic
969115004 4:4865962-4865984 CTGCGGCGCAGGGAGGGGGCGGG - Intergenic
969239156 4:5888095-5888117 CTGCGTCGCCGCGGGTGGGGCGG - Intronic
969239313 4:5888618-5888640 GTGGGGGGCGGGGGGCGGGGTGG - Intronic
969344684 4:6563479-6563501 CTGCGGGGCTGGGGGTGAGGCGG + Intronic
969379411 4:6783675-6783697 CTATGGCGCGGGGCGCGGCGCGG + Intronic
969436590 4:7192609-7192631 CAGCGGAGCCGGCGGCGGGGCGG - Exonic
969483299 4:7458196-7458218 CTGTGGGGCGGGGGGAGGCGGGG + Intronic
969498778 4:7540774-7540796 CCGGGGTGCGGGGGGCAGGGGGG - Intronic
969718903 4:8882299-8882321 CTGCAGCGGGTGCGGCGGGGAGG + Intergenic
969718908 4:8882308-8882330 GTGCGGCGGGGAGGGCGGGGAGG + Intergenic
969748244 4:9090736-9090758 CTGCGGGGAGTGGGGCTGGGAGG - Intergenic
969844822 4:9912139-9912161 CTGGGGTGGGGGGAGCGGGGAGG + Intronic
970333143 4:15004208-15004230 CTGCGGCGCCGCGGGCGGCGGGG - Exonic
970754887 4:19413875-19413897 GTGTGGCGGGGGGGGGGGGGGGG - Intergenic
971511369 4:27429495-27429517 CTGAGGGGCGGGGGAAGGGGAGG - Intergenic
972204787 4:36758964-36758986 CAGCGGAGCGGGGTGGGGGGTGG - Intergenic
972382914 4:38535989-38536011 CTGAGGCGGGGTGGGTGGGGAGG - Intergenic
972632877 4:40857186-40857208 CCGCGGCGGGCGGGGCAGGGAGG - Intronic
972671456 4:41216410-41216432 CCGCGGCGGCGGGGGGGGGGGGG + Intronic
972671459 4:41216413-41216435 CGGCGGCGGGGGGGGGGGGGGGG + Intronic
972671462 4:41216416-41216438 CGGCGGGGGGGGGGGGGGGGGGG + Intronic
972765857 4:42151949-42151971 GTGCGGCGCGAAGGGCGGCGGGG + Exonic
973199593 4:47485215-47485237 CTACGTCACGGAGGGCGGGGCGG + Intergenic
973613592 4:52659007-52659029 CTGGGGCGGCGGGGGCGGCGGGG - Intronic
973687988 4:53393766-53393788 CGGGGGCGGGGGGGGGGGGGGGG - Intronic
973764256 4:54149346-54149368 CCGCGGAGCAGGGGGTGGGGAGG + Intronic
976316011 4:83659754-83659776 CTGGGGGGCGGGGGATGGGGGGG + Intergenic
976400999 4:84607428-84607450 CTGAGGGGCGGGGGGAGTGGGGG - Intronic
976431299 4:84966169-84966191 CGGGAGCGCGGGGGGCGGGGAGG + Intronic
976600709 4:86935280-86935302 CGGCGGCGTCGGGGGCCGGGCGG - Intronic
976704543 4:88007520-88007542 CCGCGGCGCGCTGAGCGGGGAGG - Intergenic
976791243 4:88880775-88880797 GTGGGGGGCGGGGGGGGGGGGGG + Intronic
977471773 4:97452129-97452151 CAGCTGTGCTGGGGGCGGGGGGG - Intronic
977536553 4:98261362-98261384 CGGCGGGGGGCGGGGCGGGGCGG - Intronic
977719018 4:100217149-100217171 TGGCGGCACTGGGGGCGGGGAGG - Intergenic
978037094 4:104008678-104008700 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
978619042 4:110621565-110621587 GTGCGGCGCTGGGGGAGGGGAGG - Intronic
978619309 4:110622843-110622865 CTGCCGCGTGGGGGGGGGGCGGG - Exonic
978741872 4:112145811-112145833 CTGCGGCGCGGCCCGCGGGCCGG - Intronic
978795747 4:112705997-112706019 CTGCGGCGCAGGAGCCGGGGCGG + Intergenic
979122923 4:116926273-116926295 CGGCGGCGCGGGTGGCCTGGCGG - Intergenic
979547109 4:121951402-121951424 GTGCCGGGCGGGGGGCGGGAAGG - Intronic
979624111 4:122827037-122827059 CTGCCGGGCGGGAGGCTGGGGGG + Exonic
979674691 4:123398406-123398428 CCGCGGCGGGGAGGGCGAGGCGG - Intronic
979785679 4:124712792-124712814 CGGCGGGGCGGGGGCGGGGGCGG - Intergenic
979829502 4:125281886-125281908 GTGGGGCGCGGGGGGGGGGCGGG + Intergenic
980130363 4:128811619-128811641 CTGCGCCGCCCGGGCCGGGGTGG + Intronic
980321927 4:131290694-131290716 CGGTGGGGCGGGGGGGGGGGGGG + Intergenic
980321929 4:131290696-131290718 GTGGGGCGGGGGGGGGGGGGGGG + Intergenic
980698774 4:136395589-136395611 CCTCGGCGGGCGGGGCGGGGGGG - Intergenic
981713559 4:147732021-147732043 CTGCCGCGCGGGGGCCGGGCGGG + Intergenic
982033614 4:151325216-151325238 GAGAGGCGCGGGGGACGGGGCGG - Intronic
982157392 4:152535784-152535806 CGGCGGCTTGGGGGGCAGGGAGG - Exonic
982257639 4:153466263-153466285 GTGCGGCGCGGGGCGGGGCGGGG + Intergenic
982358267 4:154491877-154491899 CCGCTGCTCCGGGGGCGGGGCGG + Intergenic
982745678 4:159102925-159102947 CTGGCGGGCGGGGAGCGGGGAGG + Intergenic
982745986 4:159104008-159104030 CGGCGGCGCGGGGCCCGCGGGGG - Intergenic
982777385 4:159455753-159455775 CTGGGGGGCGGGGGGAGGGGGGG - Intergenic
983362953 4:166749486-166749508 GTGCGGTGGGGGGAGCGGGGAGG + Intronic
984771025 4:183436320-183436342 GTGGGGCGGGGGGGGGGGGGCGG + Intergenic
985550142 5:528668-528690 GAGCGGGGCGCGGGGCGGGGCGG - Intergenic
985550145 5:528673-528695 CGGGGGAGCGGGGCGCGGGGCGG - Intergenic
985576036 5:673894-673916 CTGCGGTGGGTGGGGCTGGGTGG - Intronic
985595179 5:784755-784777 GGGCGGGGCTGGGGGCGGGGCGG - Intergenic
985696612 5:1344649-1344671 CCGCGGGGCCGGGGGCCGGGCGG - Intronic
985714261 5:1446583-1446605 CGGGGGAGCGGGGGGCGGGGAGG - Intergenic
985760832 5:1747733-1747755 TAGCGGGGCAGGGGGCGGGGGGG - Intergenic
985877337 5:2609988-2610010 CTTGGGGGCGGGGGGGGGGGGGG + Intergenic
985926673 5:3024744-3024766 CTGGGGTGCGGGGTGCGGTGGGG - Intergenic
986152492 5:5140299-5140321 GTGCGGCGCGGGGGGCGGAGTGG - Intergenic
986263384 5:6168623-6168645 GTGCGGTGGGGTGGGCGGGGAGG + Intergenic
986321152 5:6633496-6633518 CGGCGGCGCGGGGGCAGGAGGGG - Exonic
986330681 5:6714138-6714160 CCGCGGCGGGGGCGGCCGGGCGG + Intergenic
986330710 5:6714228-6714250 CAGCAGCGCGGGGGGCAGCGCGG - Intergenic
986715540 5:10521179-10521201 CTGCTGTGGGGGGGGCGGGGGGG - Intronic
987084634 5:14457374-14457396 GGGCGGGGCGGGGGGGGGGGGGG - Intronic
987132418 5:14871874-14871896 CAGCGGCCCCGGGGGCGGGCTGG + Intergenic
987132482 5:14872053-14872075 CGGCGGCGCTGAGGGCGCGGCGG + Intergenic
987374028 5:17217870-17217892 CTGCGGGGCGGGGCGCGGCGCGG - Intronic
988075788 5:26352505-26352527 GTGGGGGGCGGGGGGTGGGGTGG - Intergenic
988509699 5:31854897-31854919 CCGCGGCGCGGAGGGAGGAGGGG + Intronic
990075579 5:51842926-51842948 CTGCGGGGGGGGGGGGGGGGGGG - Intergenic
991371610 5:65925708-65925730 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
991371611 5:65925711-65925733 CTGCGGCGGGGGCGGGGGCGGGG - Intergenic
991594447 5:68288485-68288507 CTGCCGGGCGGGGCGTGGGGCGG + Intronic
992067297 5:73120167-73120189 CGGCGGCGTGGGGGGCGCGGAGG - Intergenic
992320916 5:75612321-75612343 GGGCGGGGCGGAGGGCGGGGGGG - Intronic
992562819 5:77969000-77969022 TTGGGGCGGGGGGGGGGGGGGGG + Intergenic
992627576 5:78648922-78648944 GCGCGGCGCGCGGGGCGGGACGG + Intronic
992939918 5:81751432-81751454 GGGCGGCGCGGGGGGAGGGGTGG - Intronic
993733088 5:91445657-91445679 CTGCAGGGCGGGGGGGGGGGGGG - Intergenic
994092604 5:95822318-95822340 GTGCGGGGCGGGGGGTGTGGGGG - Intronic
994208822 5:97065047-97065069 GTGGGGGGGGGGGGGCGGGGGGG + Intergenic
994353872 5:98774012-98774034 CGGCGGCGCGGGCGCCGTGGCGG - Exonic
994353876 5:98774024-98774046 CTCCGGCGAGGGCGGCGGCGCGG - Exonic
994964948 5:106657285-106657307 ATGGGGCGGGGGGGGGGGGGCGG + Intergenic
995854066 5:116574580-116574602 TTTCAGGGCGGGGGGCGGGGTGG + Exonic
996379052 5:122845534-122845556 CAGCGGGGCGGGAGGCGGGGCGG + Exonic
996900586 5:128538279-128538301 CGGCGGGGCGCGGGGCGGGCCGG + Intronic
996948196 5:129094805-129094827 CAGCGGCGCCGGGGGCGCGGGGG + Exonic
997069385 5:130602251-130602273 ATGAGGTGTGGGGGGCGGGGGGG - Intergenic
997239059 5:132293990-132294012 CTGCCACGCGTGGGGCGCGGAGG - Intronic
997531110 5:134581748-134581770 CTGCTGCGAGGGGAGGGGGGTGG + Exonic
997584094 5:135034447-135034469 CGAGGCCGCGGGGGGCGGGGAGG - Intronic
997903880 5:137794983-137795005 GGGAGGGGCGGGGGGCGGGGCGG + Intergenic
998159877 5:139807351-139807373 CTCCTGAGCGGGGGGAGGGGGGG - Intronic
998170272 5:139868644-139868666 CTGAGGCCCGGGAGGTGGGGTGG - Intronic
998221614 5:140286594-140286616 TTGCGGGGGGGGGGGGGGGGGGG + Intronic
998250294 5:140547897-140547919 TTGCGGGGCGGGGGTAGGGGAGG + Intronic
998738001 5:145165002-145165024 CAGCGGCAAGGGGGGAGGGGAGG + Intergenic
999009555 5:148021052-148021074 GTGCGGTGGGGGGAGCGGGGAGG - Intergenic
999155628 5:149455620-149455642 CTGGAGGTCGGGGGGCGGGGTGG + Intergenic
999197320 5:149791197-149791219 GTCTGGGGCGGGGGGCGGGGTGG + Intronic
999300109 5:150485871-150485893 CCCCGGGGCGGGGGCCGGGGCGG - Intronic
999360604 5:150982977-150982999 CTGTGGGGTGGGGGGCGGCGGGG + Intergenic
1000124231 5:158227711-158227733 CTGTGGGGTGGGGGGTGGGGAGG - Intergenic
1000194048 5:158940761-158940783 CTGCGGGGGGGGGGGGGGGGCGG - Intronic
1001314710 5:170633737-170633759 GGGGGGGGCGGGGGGCGGGGCGG + Intronic
1001529928 5:172454554-172454576 GGGCGGTGCGGGGGGCGGGCCGG - Intergenic
1001529935 5:172454566-172454588 GGGCGGTGCGGGGGGCGGTGCGG - Intergenic
1001529941 5:172454578-172454600 GGGCGGTGCGGGGGGCGGTGCGG - Intergenic
1001529947 5:172454590-172454612 CGGCGGCGCGGGGGGCGGTGCGG - Intergenic
1001597646 5:172908294-172908316 CTGAGGCGGGGGCGGGGGGGGGG + Intronic
1001928652 5:175657737-175657759 CTGCGGGGCGGGGAGAGGGAAGG + Intergenic
1001959839 5:175873065-175873087 ATGCTGCGCTGGGGGAGGGGAGG - Intronic
1002006416 5:176238355-176238377 CGGCGGGGCGGGGCTCGGGGCGG + Exonic
1002029366 5:176416538-176416560 CTGCGGTGCGGGCGCCGCGGCGG + Exonic
1002105594 5:176878135-176878157 CAGCGGCGGGGGGTGAGGGGCGG - Intronic
1002186279 5:177456197-177456219 CTGCGGGGAGGGGCGGGGGGAGG + Exonic
1002189783 5:177472542-177472564 CTGGGGGGCGGGGTGAGGGGCGG + Intronic
1002211138 5:177600085-177600107 CGGCGGACCGGGGGGCGGGGCGG + Exonic
1002219964 5:177672282-177672304 CGGCGGGGCGGGGCTCGGGGCGG - Intergenic
1002349907 5:178576710-178576732 CTGGCGCGCGGGGCCCGGGGAGG - Intronic
1002351998 5:178589953-178589975 CTGCGGCGCGCGGGGCCGCCAGG - Exonic
1002591067 5:180291966-180291988 CGGCGGCGGCGGCGGCGGGGCGG - Exonic
1002691459 5:181053318-181053340 TACCGGCGCGGGCGGCGGGGCGG + Intronic
1002771275 6:292445-292467 GAGCGGCGGGGCGGGCGGGGAGG - Exonic
1002888081 6:1313004-1313026 GGGCGGCGCGGGGAGCGGCGAGG + Exonic
1002927251 6:1611579-1611601 CGGCGGCGCGGGGGCCGCGGGGG + Exonic
1003027038 6:2564340-2564362 CTGGGGCGAGGGGCGGGGGGAGG + Intergenic
1003099038 6:3163120-3163142 CCGCGGCGCAGGGGGAGGGCGGG + Intergenic
1003290626 6:4776153-4776175 CGCGAGCGCGGGGGGCGGGGTGG - Intronic
1003324297 6:5081128-5081150 CTTGGGCGGGGGGGGGGGGGGGG + Intergenic
1003465567 6:6376855-6376877 CAGCGGCGGGGTGGGTGGGGAGG - Intergenic
1003645587 6:7910829-7910851 CTCCGGGGCGGGGCGCGGGGCGG - Intronic
1004044630 6:12012254-12012276 GAGCGGGCCGGGGGGCGGGGGGG - Intronic
1004044747 6:12012611-12012633 CGGCGGGGCGGAGGGGGGGGGGG + Intronic
1004409388 6:15366503-15366525 GGGGGGCGGGGGGGGCGGGGGGG + Intronic
1004529374 6:16439358-16439380 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1005348325 6:24911098-24911120 CGGCGGAGCGGGCGGAGGGGCGG + Intronic
1005987563 6:30884216-30884238 CAGCGGCGCGGGCGGCTGGGCGG + Intronic
1006052133 6:31353357-31353379 CTGGGGCAGGGGGTGCGGGGAGG - Intronic
1006170119 6:32087610-32087632 GTGGGGCGGGGGTGGCGGGGCGG + Intronic
1006180714 6:32151945-32151967 CAGCGGCGGGGGGGGGGGGCGGG + Exonic
1006185570 6:32179887-32179909 CTCTGGCCCTGGGGGCGGGGTGG - Exonic
1006369177 6:33633739-33633761 CTTCGCCGCGGGGGCGGGGGCGG + Intronic
1006404381 6:33835725-33835747 TTGCGGGGGGGGGGGCGGGGGGG + Intergenic
1006404388 6:33835734-33835756 GGGGGGCGGGGGGGGCGGGGGGG + Intergenic
1006434095 6:34017266-34017288 CTGGGGCGTGGGGGGCGGCTTGG + Intergenic
1006498256 6:34439850-34439872 CTGCTGGGCGGGGGGGGGGGGGG - Intergenic
1006503489 6:34473216-34473238 AGACGGGGCGGGGGGCGGGGGGG + Intronic
1006512125 6:34527173-34527195 CTGCGCCGCGGGGCGGGGGGCGG + Intronic
1006523284 6:34584373-34584395 CTGCAGCTCAGGGGGCGGGGTGG - Intergenic
1006599692 6:35217222-35217244 CGGGGGGGGGGGGGGCGGGGGGG + Intronic
1006606218 6:35259606-35259628 CGGCGAAGCGGGGGGCGGGGTGG + Intronic
1006643028 6:35498037-35498059 CTGGGGCGCGGGGAGGAGGGGGG + Exonic
1006654252 6:35576672-35576694 CAGGGGCCCGGGGGGCGGGCGGG + Intronic
1006984179 6:38166618-38166640 CTGCTGTGAGGGCGGCGGGGAGG - Intergenic
1007363214 6:41373197-41373219 CTCCGGCGCGGGGGCTGGGGCGG - Intergenic
1007390445 6:41547151-41547173 CTGTGGCGCGGCGGGAGTGGGGG + Intronic
1007550738 6:42727869-42727891 GGGCGGCGTGGGGGGTGGGGTGG - Intergenic
1007598563 6:43067099-43067121 GTGCGGGGCGTGGGGTGGGGAGG - Intronic
1007656839 6:43455636-43455658 GTGCGTCGCGGGGGGGGGGATGG - Intronic
1007781400 6:44256970-44256992 CTGCAGCGGAGGGGGCGGGGAGG - Intronic
1007800508 6:44388150-44388172 CGGGGCCGGGGGGGGCGGGGGGG - Intronic
1008625208 6:53308883-53308905 AGGTGGGGCGGGGGGCGGGGAGG + Intronic
1009521737 6:64690828-64690850 CTGGGGTGGGGGGAGCGGGGAGG + Intronic
1010142153 6:72623248-72623270 CCGCGCTGCAGGGGGCGGGGAGG + Intronic
1010187301 6:73158141-73158163 GTGCGGGGGAGGGGGCGGGGCGG + Intronic
1010597172 6:77778132-77778154 GTGCGGGGCGGGGGGTGGTGGGG + Intronic
1010703324 6:79077829-79077851 CGGCGGCGCGCGGCGCGGGCCGG - Intronic
1011650763 6:89504126-89504148 GTGGGGGGCGGGGGGTGGGGGGG + Intronic
1012401412 6:98845242-98845264 CCGGGGCCCGCGGGGCGGGGCGG - Intergenic
1013057476 6:106597837-106597859 GTGGGGTGCGGGGAGCGGGGAGG - Intronic
1013230510 6:108157782-108157804 CTGCGGCGGGGGCGGCCGGGCGG - Intronic
1013230569 6:108158027-108158049 CTGCAGGGCCGGGGGCGCGGGGG - Intronic
1013491059 6:110646589-110646611 CAACGGCGGAGGGGGCGGGGAGG + Intronic
1013834507 6:114317787-114317809 ATGGGAGGCGGGGGGCGGGGGGG + Intronic
1014076174 6:117236897-117236919 CGGGGGCGGGGGGGGGGGGGCGG + Intergenic
1015625768 6:135180505-135180527 CTGGGCCGGGCGGGGCGGGGTGG + Intergenic
1015843049 6:137493493-137493515 CTGCAGCGCGGGCGGCGTGGAGG + Exonic
1016330256 6:142946518-142946540 GTGCGGCGCGCGGGGCGACGGGG + Intergenic
1016454556 6:144216815-144216837 CTGCGGGGCGGGAGGCGGCCGGG + Intergenic
1016737357 6:147493886-147493908 CTGAGGAGCGGGAGGAGGGGAGG - Intergenic
1016949474 6:149566320-149566342 CTTCGGCGGGAGGGACGGGGAGG - Exonic
1017168565 6:151433942-151433964 CTGAGGTGGGTGGGGCGGGGGGG - Intronic
1017470459 6:154733482-154733504 CTGCGGCCCGAGCGGCGGGGAGG + Exonic
1017478736 6:154827826-154827848 GGGCGGGGCGGGGGGGGGGGCGG + Intronic
1017705973 6:157123224-157123246 GGGGGGGGCGGGGGGCGGGGGGG - Intronic
1017738212 6:157381914-157381936 CCGCGGCTCGGGGGGCGGCCGGG + Exonic
1017891656 6:158644470-158644492 CCCCGGCGCGGGGGGCGGGAAGG - Intronic
1018020897 6:159761835-159761857 CCGGGGCGCGGGGCGCGGGGCGG - Exonic
1018020909 6:159761866-159761888 GCGGGGCGCGGGGCGCGGGGCGG - Exonic
1018368741 6:163148955-163148977 CTATGGCGGGGGGGGGGGGGGGG + Intronic
1018778997 6:167045352-167045374 GGGCCGCGGGGGGGGCGGGGAGG - Exonic
1018876778 6:167827576-167827598 CGGCGGCGCGGGGGGCGCGGCGG + Intronic
1018892803 6:167994936-167994958 TTGGGGGGCGGGGGGCGGCGGGG + Intergenic
1019347926 7:539677-539699 CTCCTGCGCCGGGGGTGGGGTGG + Intergenic
1019395755 7:816831-816853 CTGCGGGGCGCGGGACGGGCGGG - Intronic
1019402940 7:866716-866738 CGGTGGGACGGGGGGCGGGGGGG - Intronic
1019536297 7:1531254-1531276 CTGCGGGGGGCGGGGCGGGGCGG + Intronic
1019564672 7:1673488-1673510 ATCCGGGGCAGGGGGCGGGGAGG - Intergenic
1019707827 7:2504920-2504942 CTGTGGAGCCGGGGGGGGGGGGG - Intergenic
1019869983 7:3751442-3751464 CTTCGGCGGGGGGTGGGGGGAGG + Intronic
1019989550 7:4682244-4682266 CGGCGGCGCGGGGGGCGGGGAGG - Intergenic
1020023656 7:4883696-4883718 CGGCGGCGCAACGGGCGGGGCGG + Exonic
1020034786 7:4958457-4958479 CTGAGGCTCGGGGTGCGGTGGGG - Intronic
1020177891 7:5897556-5897578 CGACGGGGGGGGGGGCGGGGGGG + Intergenic
1020257243 7:6509091-6509113 CTGCGGCTGGGCGGGCGGGTGGG + Exonic
1020274308 7:6615530-6615552 CGGGGGCGCGGCGGGCGGGCAGG + Intergenic
1020274377 7:6615704-6615726 GGGCCGCGCGGGGGCCGGGGCGG - Exonic
1020324763 7:6965911-6965933 CTGCGGGGAGTGGGGCTGGGAGG + Intergenic
1020767973 7:12349075-12349097 GTGCGGTGCGGGGAGAGGGGAGG + Intronic
1021125904 7:16851059-16851081 AAGCGGCGTGGGGGGCTGGGGGG + Intergenic
1021510502 7:21427998-21428020 GCGCGGCGCGGGCGGCGGCGCGG - Intergenic
1021828057 7:24573766-24573788 CGGCGGCGCCGCGGTCGGGGAGG + Intronic
1021896356 7:25239687-25239709 CTGGGGGGCGGGGGGTGGGGAGG + Intergenic
1022048617 7:26643643-26643665 TGGCGGCGGGGGGGGGGGGGGGG + Intronic
1022097110 7:27147975-27147997 CTGCCGGGCGGGCGGCGGGCGGG - Intronic
1022112586 7:27240509-27240531 ATGCAGAGCTGGGGGCGGGGTGG + Intergenic
1022174753 7:27862350-27862372 CTGGGGCGGGGGAGGCGGGAGGG - Intronic
1022207709 7:28180106-28180128 CCGGCGCGCGGGGCGCGGGGCGG - Intronic
1022535976 7:31098695-31098717 CAGCGGGGCGGGGGGGGGGGGGG + Intronic
1022556995 7:31307993-31308015 CTGAGGGGCAGGGGGCGGAGAGG + Intergenic
1022628717 7:32065045-32065067 CGGCGGTGGGGGGGGGGGGGAGG + Intronic
1022919215 7:34995910-34995932 CGGCGGTGGGGGGGGCGGTGGGG + Intronic
1022973495 7:35537309-35537331 GGGCGGGGCGGGGGGCGGGGGGG + Intergenic
1022988816 7:35686807-35686829 CTGGGGGGGGGGGGGTGGGGGGG + Intronic
1023259272 7:38341812-38341834 GTGTGTGGCGGGGGGCGGGGGGG + Intergenic
1023638591 7:42237121-42237143 GTGCGGCGCGGGCGGCCGCGGGG + Intronic
1023743762 7:43303326-43303348 TTGGGGGGCGGGGGGTGGGGTGG - Intronic
1023991781 7:45132976-45132998 CTGGGGCCCGGGGGGCCAGGAGG + Intergenic
1024043800 7:45574415-45574437 CCGGGGCGCGGGGCGCGGGGCGG - Intronic
1024262271 7:47581738-47581760 TTGCGGCGCGTGGGGGGCGGGGG - Intronic
1024707191 7:51973182-51973204 CTGTGGCGGGCGGGGCGGGTGGG - Intergenic
1024965647 7:55020067-55020089 CTGCGGCTCCCGGGGAGGGGTGG + Intronic
1025028245 7:55535509-55535531 CTGCGGGGCGGGGGACTGGGAGG - Intronic
1026132352 7:67630968-67630990 CTGCGGGGAGGGATGCGGGGAGG - Intergenic
1026765164 7:73155455-73155477 AAGCGGCGGCGGGGGCGGGGCGG - Intergenic
1026968252 7:74453753-74453775 CAGGGGCGCGGGGCGCGGGGCGG + Intergenic
1027041637 7:74965210-74965232 AAGCGGCGGCGGGGGCGGGGCGG - Intronic
1027082005 7:75237159-75237181 AAGCGGCGGCGGGGGCGGGGCGG + Intergenic
1027111393 7:75442617-75442639 CTGCGGCGGGCCGGCCGGGGCGG - Intronic
1027222914 7:76225465-76225487 AAGGGGCGGGGGGGGCGGGGAGG - Intronic
1027232610 7:76281560-76281582 AGGCCGCGCGGCGGGCGGGGCGG + Exonic
1027233033 7:76282896-76282918 CGACGGGGCGGGCGGCGGGGTGG + Intronic
1027421090 7:78019277-78019299 CTGCGCCGGGGCGGGCGGGTTGG + Exonic
1027623538 7:80521555-80521577 GTGGGGGGTGGGGGGCGGGGGGG - Intronic
1029068041 7:97872175-97872197 CTGCGGTAGGGAGGGCGGGGCGG - Intronic
1029188297 7:98754940-98754962 GTGCGGGGGGGGGGGCGGGGGGG - Intergenic
1029390588 7:100271704-100271726 AAGCGGCGGCGGGGGCGGGGCGG + Intronic
1029496329 7:100897004-100897026 CGGCGGTGCGGGGCGCGGCGTGG + Intergenic
1029549742 7:101231457-101231479 CTGAGGCGGGGGAGGGGGGGTGG - Intergenic
1029566711 7:101343358-101343380 CTTTGGTGGGGGGGGCGGGGAGG - Intergenic
1029611657 7:101629819-101629841 CGGGGGGGCGGGGGGCGTGGTGG + Intergenic
1029640397 7:101816391-101816413 CGGCGGCGCGGGGCCCGGGGGGG - Intronic
1029708330 7:102286811-102286833 CGGCGGGGGCGGGGGCGGGGCGG + Intronic
1029730132 7:102433497-102433519 CGGCGGCCGCGGGGGCGGGGTGG + Intronic
1029731971 7:102444499-102444521 CTGGAGGGTGGGGGGCGGGGGGG - Intronic
1029738659 7:102479090-102479112 CCGGGGGGCGGGGTGCGGGGTGG - Intergenic
1029773730 7:102671820-102671842 CCGGGGTGCGGGGTGCGGGGTGG - Intergenic
1030033312 7:105388480-105388502 GGGCGGCCCGGGGGGAGGGGCGG - Intronic
1030262462 7:107580183-107580205 CTGCGGGGCGTGAGGCGGGGTGG + Intronic
1030491589 7:110241966-110241988 TTGTGGGGTGGGGGGCGGGGAGG + Intergenic
1030600157 7:111583400-111583422 GGGCGGGGTGGGGGGCGGGGGGG + Intergenic
1030772514 7:113491783-113491805 TTGTGGGGTGGGGGGCGGGGGGG + Intergenic
1031340857 7:120598564-120598586 GTGGGGCAGGGGGGGCGGGGCGG + Intronic
1031361827 7:120857368-120857390 CGGCGGGGCGGGGGCGGGGGCGG + Intronic
1031406255 7:121390845-121390867 GTGTGGGGCGGGGGGGGGGGGGG + Intronic
1031406257 7:121390847-121390869 GTGGGGCGGGGGGGGGGGGGGGG + Intronic
1031629727 7:124032547-124032569 CGGCGGGGCGGGGGTCGCGGTGG - Exonic
1031689217 7:124766343-124766365 CTGGGGGGCGAGGGGCGGGGCGG + Intergenic
1032263931 7:130357272-130357294 CTGTGGCAGGTGGGGCGGGGAGG + Intronic
1033097324 7:138442572-138442594 CTGGGGGGCTGGGGGCAGGGAGG - Intergenic
1033227385 7:139572766-139572788 CAGGGGCGGGGGGGGGGGGGGGG - Exonic
1033339219 7:140479083-140479105 CTGCGGCGCGGGAGGGAGGAGGG - Intronic
1033390712 7:140924798-140924820 CGGAGGAGCGGGGGGCGCGGGGG + Intergenic
1033406368 7:141074004-141074026 CTGCGGGGCGGGGAGGGGGCGGG + Intergenic
1033477184 7:141702172-141702194 CGCGGGCGCGAGGGGCGGGGCGG + Intergenic
1033586563 7:142778913-142778935 TTGGGGCGAAGGGGGCGGGGAGG + Intergenic
1033705571 7:143882644-143882666 CTGCGGGGGGGAGGGCAGGGCGG - Intronic
1034147155 7:148883889-148883911 CTGCGGGGCGGGGGGCGTGTGGG - Intronic
1034415169 7:150960858-150960880 TTGGGGGGCGGGGGGCGGTGGGG - Intronic
1034426914 7:151018769-151018791 CAGGGGCGCGGGGGGCGCAGCGG + Exonic
1034455533 7:151167894-151167916 TTGGGCCGCGGGGGGCGGGTGGG - Intronic
1034470399 7:151251719-151251741 CTGCGGCGCCGGGCGCCGGGCGG - Intronic
1034560621 7:151877322-151877344 CCGCGGCGCGGCGGGGGGCGAGG - Intergenic
1034620284 7:152451662-152451684 CTGCGGCGGGGGGCGGGGGGGGG - Intergenic
1034967074 7:155398240-155398262 GCGGGGGGCGGGGGGCGGGGGGG + Intergenic
1034967079 7:155398249-155398271 GGGGGGCGGGGGGGGCGGGGAGG + Intergenic
1035167460 7:157000085-157000107 GCGGGGCGCGGGGGGCGGAGCGG + Intronic
1035284063 7:157795152-157795174 CGGCGGGGTCGGGGGCGGGGGGG + Intronic
1035327677 7:158075491-158075513 CTGCTGCGTTGGGGGCGGGGAGG - Intronic
1035720933 8:1791400-1791422 GGGCGGGGCGGGGGGAGGGGGGG - Intergenic
1035725946 8:1824685-1824707 CTGCGGCGCGGGGGACAGCTGGG - Intronic
1035747925 8:1974603-1974625 CCGCGGCGCGGTGGGGCGGGTGG - Intronic
1036033412 8:4994809-4994831 ATGCGGGGAGGGGGGCGCGGGGG + Exonic
1036195316 8:6708609-6708631 CTGAGGCCCGGGAGGCGGGCGGG + Exonic
1036371301 8:8165030-8165052 CTGCGGGGAGTGGGGCTGGGAGG - Intergenic
1036562462 8:9908189-9908211 TTGCGGCATGGGGGGAGGGGAGG + Intergenic
1036723900 8:11201612-11201634 CTGCTGGGCGGGGGACCGGGGGG + Intergenic
1036739430 8:11347595-11347617 GTGCGCCGGGCGGGGCGGGGCGG + Intergenic
1036879602 8:12500614-12500636 CTGCGGGGAGTGGGGCTGGGAGG + Intergenic
1037150017 8:15626025-15626047 CTGTGGCGAGGGAGGCTGGGTGG + Intronic
1037886708 8:22599543-22599565 TGGGGGGGCGGGGGGCGGGGCGG - Intronic
1038017774 8:23529472-23529494 CTGAGGCGGGGGAGGCGGAGTGG + Intronic
1038444959 8:27596816-27596838 CTCTGTCTCGGGGGGCGGGGGGG + Intergenic
1038509563 8:28118877-28118899 ATGGGGCGTGGGGGGCGGGGCGG - Intronic
1038540495 8:28386322-28386344 CGGAGGCGCGGGGGGCGGGCGGG - Intronic
1038599923 8:28929930-28929952 TGGCGGGGCGGGGGGCGGGCGGG - Intronic
1038786150 8:30618276-30618298 CTCTGTCTCGGGGGGCGGGGGGG + Intronic
1039020370 8:33198077-33198099 CTGCGGGGTGGGGGGGCGGGGGG - Intergenic
1039415854 8:37393659-37393681 CAGGGGCGGGGTGGGCGGGGTGG - Intergenic
1039484409 8:37899628-37899650 CTGAGGCCGGCGGGGCGGGGCGG - Intergenic
1039518451 8:38152081-38152103 CTGAGTCGCGGGGGGGCGGGGGG + Intergenic
1039572808 8:38600899-38600921 CTCTGGCCCTGGGGGCGGGGTGG + Intergenic
1040039000 8:42897305-42897327 CTGGGGCGGGCGGGGCGAGGAGG + Intronic
1040280497 8:46039571-46039593 CTGAGGCGTGGGTGTCGGGGGGG - Intergenic
1040471260 8:47737635-47737657 CTCCGGCGACGTGGGCGGGGTGG + Exonic
1041099461 8:54381671-54381693 TTGCGGGGCGGGGGGGGGGTGGG + Intergenic
1041693701 8:60714414-60714436 GTGCGGGGCGGGGGGGGGGGGGG - Intronic
1042040128 8:64581063-64581085 CGGCGGCGGCGGCGGCGGGGTGG + Exonic
1042052150 8:64722737-64722759 TTGCGGCGGGGGGGGGGGGGCGG + Intronic
1042367480 8:67953173-67953195 AGCCGGGGCGGGGGGCGGGGGGG - Intronic
1042837878 8:73093412-73093434 TGGCGGGGCGGGGGTCGGGGTGG + Intronic
1042995497 8:74693604-74693626 CGGGGGCGGGGGGGGAGGGGTGG + Intronic
1043346239 8:79301182-79301204 GTGGGGCGGGGGGAGCGGGGAGG + Intergenic
1043388183 8:79768086-79768108 AGGAGGCGCGGGCGGCGGGGAGG + Intergenic
1043388200 8:79768154-79768176 TCGGGGCGCGCGGGGCGGGGAGG - Intergenic
1044335980 8:90985241-90985263 CGGCGGCGGGGGGCGAGGGGCGG + Exonic
1044335996 8:90985267-90985289 GCGAGGGGCGGGGGGCGGGGCGG + Intergenic
1044988542 8:97775781-97775803 CTGCAGCGGCGGGGACGGGGAGG - Exonic
1045068931 8:98479478-98479500 CTCCGTCTCGGGGGGGGGGGGGG + Intronic
1045086698 8:98694492-98694514 CTGGGGTGCGGGGAGTGGGGAGG - Intronic
1045098930 8:98825861-98825883 CGGCGCGGCCGGGGGCGGGGCGG - Intronic
1045122484 8:99053282-99053304 GTGGGGTGCGGGGAGCGGGGAGG - Intronic
1045255338 8:100515647-100515669 CTGAGGTGCGGGGGAGGGGGGGG + Intronic
1045277636 8:100721854-100721876 CTGCGGGGCCGCGGGCGGGCGGG + Exonic
1046776255 8:118167178-118167200 GGGGGGCGCGGGGGGCTGGGGGG - Intergenic
1047218024 8:122894645-122894667 ATGGGGTGCGGGGAGCGGGGAGG + Intronic
1047292287 8:123541109-123541131 CCGCGACGGGGGCGGCGGGGCGG + Exonic
1047361324 8:124172002-124172024 GGGCGGCGGGGGGGGGGGGGGGG + Intergenic
1047361327 8:124172005-124172027 CGGCGGGGGGGGGGGGGGGGGGG + Intergenic
1047987994 8:130256400-130256422 CTGGGGGGTGGGGGGCGGTGGGG + Intronic
1048234347 8:132675333-132675355 CTGCGGTGCGGAGGGCCGGGTGG + Intronic
1048633607 8:136271544-136271566 GTGTGGCGGGGGGGGGGGGGCGG - Intergenic
1048980916 8:139703150-139703172 CGGGGAGGCGGGGGGCGGGGAGG + Intergenic
1049004523 8:139846294-139846316 CTGCTGCGGGGGGTGGGGGGTGG - Intronic
1049103607 8:140597472-140597494 CTGGGGCGGGGGGGGGGGGGTGG - Intronic
1049422298 8:142522450-142522472 CTGCGGAGCTGGGCGCAGGGTGG - Intronic
1049502478 8:142974814-142974836 GCGGGGGGCGGGGGGCGGGGAGG - Intergenic
1049614043 8:143568652-143568674 CTGGTGCGCCGGGGCCGGGGCGG - Exonic
1049689785 8:143953444-143953466 CGGCGGCGGCGGCGGCGGGGCGG - Intronic
1049707374 8:144049174-144049196 GTGCAGCGCCGGGGGCGGGAAGG - Intergenic
1049720765 8:144114504-144114526 CTGAGGGCCGGTGGGCGGGGAGG - Intronic
1049762169 8:144336602-144336624 CCGCGGCGGCGGGGGGGGGGAGG - Intergenic
1049824823 8:144661896-144661918 ATGCGGAAAGGGGGGCGGGGTGG - Intergenic
1049828508 8:144685461-144685483 CGGCCGGGCGGGGGGCGCGGAGG - Intergenic
1050472373 9:6007411-6007433 CCGCGCAGCGGGGGCCGGGGCGG - Exonic
1050651845 9:7785309-7785331 GTGGGGCGGGGGGGGGGGGGGGG - Intergenic
1050651847 9:7785311-7785333 GTGTGGGGCGGGGGGGGGGGGGG - Intergenic
1051146202 9:14030198-14030220 CAGCAGCGGGGGGGGGGGGGTGG + Intergenic
1051265810 9:15307326-15307348 CAGCGGCGCGGCGTCCGGGGAGG - Exonic
1051306907 9:15719389-15719411 CGGGGGGGTGGGGGGCGGGGCGG + Intronic
1052051046 9:23850237-23850259 CGGGGGTGCTGGGGGCGGGGGGG - Intergenic
1052647340 9:31253864-31253886 CAGCGGAGCGGGTGGCGGAGCGG - Intergenic
1053240058 9:36487776-36487798 CCGCGGCTCCGGGGGCGGGAGGG + Intergenic
1053787613 9:41663787-41663809 TGGCGGGGAGGGGGGCGGGGCGG + Intergenic
1054160782 9:61670949-61670971 CTGGGACCCGGGGGGTGGGGGGG + Intergenic
1054175891 9:61875130-61875152 TGGCGGGGAGGGGGGCGGGGCGG + Intergenic
1054308522 9:63449485-63449507 CGGCGGTGGGGGGGGGGGGGGGG + Intergenic
1054308687 9:63450123-63450145 CCGCGGCACCGGGGGGGGGGGGG + Intergenic
1054407212 9:64773326-64773348 CGTCGGCGGGGGGGGGGGGGGGG + Intergenic
1054407255 9:64773455-64773477 TGGCGGCGGGGGGGGGGGGGGGG + Intergenic
1054407258 9:64773458-64773480 CGGCGGGGGGGGGGGGGGGGGGG + Intergenic
1054407727 9:64775086-64775108 CTGCGGCGGGGGGGGGGTGGGGG + Intergenic
1054440864 9:65258902-65258924 CGGCGGCGGGGGGGGGTGGGGGG + Intergenic
1054489413 9:65762585-65762607 CGGCGGCGGGGGGGGGGTGGGGG - Intergenic
1054489416 9:65762588-65762610 CGGCGGCGGCGGGGGGGGGGTGG - Intergenic
1054661648 9:67705678-67705700 TGGCGGGGAGGGGGGCGGGGCGG - Intergenic
1055611773 9:78031573-78031595 CGGCGGCTCGGGGGGCGAGGCGG - Intergenic
1056451534 9:86721734-86721756 CTCCAGAGCGGGGGGCGGTGGGG - Intergenic
1056585339 9:87924278-87924300 GTGGGGGGCGGGGGGCTGGGGGG + Intergenic
1056611542 9:88128662-88128684 GTGGGGGGCGGGGGGCTGGGGGG - Intergenic
1056643417 9:88389003-88389025 GGGCGGGGCGGGGGGAGGGGCGG + Intronic
1056799505 9:89681418-89681440 CTGGGGCCCGGGGGGGGCGGGGG - Intergenic
1056917791 9:90760242-90760264 CTGCGATGGGGGGGGGGGGGGGG - Intergenic
1056921464 9:90793031-90793053 GTGGGGTGCGGGGAGCGGGGAGG + Intergenic
1056925140 9:90828233-90828255 GGGCGGGGCGGGGGGGGGGGCGG - Intronic
1056992364 9:91423764-91423786 GCGCGGCGCGGGAGGCGGGCGGG + Exonic
1057146936 9:92764844-92764866 CGGCGGCGCGGGCGGGCGGGCGG - Intergenic
1057259945 9:93577492-93577514 CTGCTCCGCGGGGGTCCGGGAGG - Intronic
1057313507 9:93955412-93955434 CGGCGGCGCGGGGCGGGGCGGGG - Intergenic
1057432226 9:95004932-95004954 CGGCGGCGCGGGCGGGCGGGCGG - Intronic
1057489232 9:95508742-95508764 GCGCGGGGCGGGGGGCGGGTAGG - Intronic
1057489234 9:95508747-95508769 TCGCGGCGCGGGGCGGGGGGCGG - Intronic
1057490822 9:95517968-95517990 TGGGGGCGGGGGGGGCGGGGCGG + Intergenic
1057623310 9:96655346-96655368 GTTGGGCGCGGGGGGCGGGGCGG + Intergenic
1057883069 9:98807852-98807874 CCGGGGCGCGGGGTGCGCGGGGG - Exonic
1058005146 9:99906585-99906607 CTGCGGGGCGGGGGCGGGGGCGG + Intergenic
1058058553 9:100473256-100473278 CCGCGGCGAGGGGAGCGGGCGGG - Exonic
1058412312 9:104747632-104747654 CCCCGGCGCGGGAGGCGCGGCGG - Intergenic
1059440014 9:114301485-114301507 CTGTGGGGCGGGGCGTGGGGCGG + Intronic
1060192047 9:121599543-121599565 CGGCGGCGCCGGGGGAGGCGCGG + Intronic
1060209095 9:121699474-121699496 CGGCGGCGCGGGGGACCGGGCGG - Intronic
1060215574 9:121736536-121736558 CTGTGGGGTGGGGGGCGGGTGGG + Intronic
1060477919 9:123999598-123999620 CGGCGGCGGGCGGGGTGGGGAGG + Intergenic
1060803303 9:126558098-126558120 CGGGGGAGCGGGGGGGGGGGAGG - Intergenic
1060814318 9:126626773-126626795 CCGCGGGGCTGGGGGTGGGGCGG - Intronic
1060816611 9:126638470-126638492 CTGGGACGTGGGGGGCCGGGTGG - Intronic
1060855738 9:126914326-126914348 TGGCGGGGCGGGGGGGGGGGCGG - Intergenic
1060969576 9:127730472-127730494 CTGGGTCGCTGGGGGCTGGGCGG + Intronic
1061087054 9:128405463-128405485 CTGGGGCGTGGGGGGCTGGCAGG - Intergenic
1061102799 9:128504893-128504915 CTGCGGCGCGAGGTGAGCGGTGG + Exonic
1061317155 9:129803438-129803460 CGGCGCTGCGGGGGGCGCGGGGG + Intronic
1061494419 9:130963529-130963551 GTGCGGGGCGGGGGGGCGGGGGG + Intergenic
1061506016 9:131032243-131032265 CTGTGGGGTGGGGGGTGGGGGGG + Intronic
1061513685 9:131076265-131076287 CTGGGGCGCCGGGGCCAGGGGGG - Intronic
1061517081 9:131096373-131096395 CCGCGGAGCGGGTGGCGGGAGGG + Intergenic
1061529070 9:131196026-131196048 TTTTGGCGCGGGGGGGGGGGGGG - Intronic
1061542057 9:131282896-131282918 CGGCGTCGGGGTGGGCGGGGCGG - Intergenic
1061559513 9:131393898-131393920 CTGGGGCCAGGGGGGAGGGGCGG - Intergenic
1061721791 9:132556574-132556596 ATGGGGCTCGGGGGGTGGGGTGG - Intronic
1061824757 9:133251229-133251251 CGGCGGGGTGGGGGGCGGTGAGG + Intronic
1062022556 9:134326350-134326372 CTGCGGCGCCGGCGGGGGGGTGG - Intronic
1062043946 9:134416641-134416663 CTGCGGCGGGGGGCGGGGGAGGG - Intronic
1062153677 9:135034162-135034184 CAGCGGAGAGGGGGACGGGGTGG - Intergenic
1062230613 9:135479830-135479852 CGGCGGCGCGCGGGGAGGCGGGG + Exonic
1062460887 9:136662154-136662176 CTGCGGCCGGGGGTGTGGGGAGG - Intronic
1062461878 9:136665721-136665743 GGGCGGGGCCGGGGGCGGGGCGG + Intronic
1062537717 9:137028201-137028223 CAGCGGCGCGGCGGGCTGCGGGG - Intronic
1062574662 9:137200588-137200610 CGGGGGCGCGGGGCCCGGGGCGG - Exonic
1062617235 9:137403406-137403428 CTGCTGGGCTGGGGGTGGGGAGG - Intronic
1062628753 9:137454358-137454380 GTGCGGCGGGGGTGGGGGGGCGG - Intronic
1062629890 9:137458890-137458912 GGGAGGCGCGGGGCGCGGGGAGG + Intronic
1062686063 9:137814065-137814087 TTGTGGGGCGGGGGGCGGGGGGG - Intronic
1202779743 9_KI270717v1_random:24026-24048 CCGCGGCACCGGGGGGGGGGGGG + Intergenic
1203470806 Un_GL000220v1:114499-114521 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1203478627 Un_GL000220v1:158471-158493 GCGCGGGTCGGGGGGCGGGGCGG + Intergenic
1185503974 X:618952-618974 CTGCGTGGCTGGGGGCGTGGGGG + Intergenic
1185534600 X:850845-850867 GTGCGGTGCTGGGGGCAGGGTGG - Intergenic
1185568427 X:1114410-1114432 TTGTGGGGTGGGGGGCGGGGAGG - Intergenic
1185714452 X:2330070-2330092 CGGCGGGGGGGGGGGGGGGGGGG + Intronic
1185736636 X:2500890-2500912 CTGCGGCGCGGGCGGCCCTGCGG - Exonic
1186451142 X:9674684-9674706 CTGGGGGGGGGGGGGGGGGGGGG - Intronic
1186480741 X:9894854-9894876 CTGCGGAGAGGGGGAGGGGGAGG - Exonic
1186802372 X:13106114-13106136 GGGGGGCGGGGGGGGCGGGGGGG - Intergenic
1187078340 X:15959050-15959072 CTGCGGTGGTGGGTGCGGGGAGG - Intergenic
1187242038 X:17522491-17522513 ATGGGGCGGGGGGGGGGGGGCGG - Intronic
1187332649 X:18354723-18354745 CGGCCGCGCGGGGGGCGGGGCGG - Exonic
1188168595 X:26892899-26892921 CAGCAGCGGGGGGGGGGGGGGGG - Intergenic
1188650592 X:32627144-32627166 CTGGGGCGGGGGGGGGGGCGGGG - Intronic
1189324663 X:40105330-40105352 CTGCGGCGGCGGCGGCGGGGCGG - Intronic
1189461083 X:41243529-41243551 AGGCCGAGCGGGGGGCGGGGGGG + Intergenic
1189961278 X:46327082-46327104 GTGTGGCGGCGGGGGCGGGGTGG + Intergenic
1190324887 X:49200221-49200243 GGGCGGCGCGGGGCGCGGCGGGG + Exonic
1190368159 X:49716999-49717021 CGGGGGCGGGGGGGGAGGGGGGG - Intergenic
1190385345 X:49878893-49878915 CTGCGGGGCTGGGGGCCGAGCGG - Intergenic
1190708230 X:53048377-53048399 GGGCGGGGCGGGGAGCGGGGGGG - Intergenic
1190885786 X:54530149-54530171 CCGCGGGGGGGGGGGGGGGGGGG - Intergenic
1192033991 X:67544453-67544475 CTGGGCCGACGGGGGCGGGGGGG - Intronic
1192212523 X:69136959-69136981 ACGCGGCACTGGGGGCGGGGCGG - Intergenic
1192237620 X:69305988-69306010 CTCCAGCGCGGGAGGCGGGGCGG + Intergenic
1192393269 X:70753207-70753229 GGGCGGCGAGGGGGGCGGGGAGG + Intronic
1192428230 X:71095928-71095950 CCGGGGGGCGGGGGGTGGGGGGG + Intergenic
1192624768 X:72715361-72715383 CGGCGGCGGGGGAAGCGGGGGGG - Intergenic
1193360406 X:80573423-80573445 CTGCAGCACGGGGGCCAGGGTGG + Intergenic
1193513090 X:82430577-82430599 CTCCGGGGCGGGGCGGGGGGTGG - Intergenic
1195268111 X:103203616-103203638 CGGGGGGGGGGGGGGCGGGGGGG - Intergenic
1195275433 X:103276293-103276315 GTGCGGGGCGGGGAGGGGGGAGG - Intronic
1195940062 X:110160595-110160617 CTGGGGTGCAGGGGGTGGGGTGG + Intronic
1196804861 X:119574812-119574834 CCGAGGCGCGCCGGGCGGGGAGG + Intronic
1196819585 X:119692587-119692609 GAGTGGCGAGGGGGGCGGGGAGG - Intronic
1197021110 X:121690506-121690528 GTGGGGTGCGGGGAGCGGGGAGG - Intergenic
1197147337 X:123184782-123184804 GTGCGGGGCGGGGGGCGGGGCGG + Intronic
1197181698 X:123543789-123543811 TTGCGGGGTGGGGGGTGGGGTGG - Intergenic
1197672541 X:129293931-129293953 CTGTGGTGGGGGGAGCGGGGAGG + Intergenic
1197754432 X:129984096-129984118 CGGCGGCGGGGCGGGCGGGCGGG + Intronic
1197774541 X:130110742-130110764 AAACGGGGCGGGGGGCGGGGTGG + Intergenic
1197774636 X:130111061-130111083 CCGCGGCGGGCGGGCCGGGGCGG - Intergenic
1197806383 X:130402227-130402249 CGGTGGCGGGGGGGGTGGGGAGG - Intronic
1198099895 X:133414709-133414731 GTCCGGCGCAGGGGGCGGCGGGG + Intronic
1198321363 X:135521417-135521439 CGGCGGGGCGGGCGGCGAGGGGG + Intronic
1198369246 X:135974345-135974367 GTGGGGCGTAGGGGGCGGGGCGG + Intergenic
1198424031 X:136497162-136497184 ATGCGGCGCGAGGCCCGGGGAGG - Exonic
1198742073 X:139852449-139852471 ATGCGGGGGGGGGGGGGGGGGGG + Intronic
1198750534 X:139932920-139932942 CAGCGGCGCGAGGGTCGAGGGGG - Intronic
1198800227 X:140440119-140440141 ATGCAGGGCGGGGGGTGGGGGGG + Intergenic
1198809587 X:140521875-140521897 CAGGGGTGTGGGGGGCGGGGGGG + Intergenic
1199531161 X:148849368-148849390 CAGCGGGGGGGGGGGGGGGGGGG - Intronic
1199832977 X:151562857-151562879 CGGGGGGGCGGGGGGCGGGGGGG + Intergenic
1199832984 X:151562866-151562888 GGGGGGCGGGGGGGGCGGGGGGG + Intergenic
1200003114 X:153072220-153072242 CCGCGGCGCGAGGGGAGTGGGGG + Intergenic
1200004609 X:153077789-153077811 CCGCGGCGCGAGGGGAGTGGGGG - Intergenic
1200084828 X:153599020-153599042 CTGCAGCGCGGGGCCCGGAGGGG - Exonic
1200128468 X:153829207-153829229 CTCCGGGGCGGGGGCGGGGGCGG - Intronic
1200229437 X:154436842-154436864 CGGGCGCGCGCGGGGCGGGGCGG + Intergenic
1200239566 X:154486627-154486649 CGGCGGCGCGCGGCGGGGGGTGG - Exonic
1200886803 Y:8279564-8279586 TTGGGGCGAGTGGGGCGGGGCGG + Intergenic
1201959365 Y:19661663-19661685 AACCGGGGCGGGGGGCGGGGGGG + Intergenic