ID: 1081941991

View in Genome Browser
Species Human (GRCh38)
Location 11:46951046-46951068
Sequence CAGTTTCCTCAAAGAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 496
Summary {0: 1, 1: 1, 2: 6, 3: 52, 4: 436}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081941991_1081941997 26 Left 1081941991 11:46951046-46951068 CCCACTTTTCTTTGAGGAAACTG 0: 1
1: 1
2: 6
3: 52
4: 436
Right 1081941997 11:46951095-46951117 GGTCACTGAGCTAGTATGTCTGG 0: 1
1: 0
2: 0
3: 12
4: 120
1081941991_1081941995 5 Left 1081941991 11:46951046-46951068 CCCACTTTTCTTTGAGGAAACTG 0: 1
1: 1
2: 6
3: 52
4: 436
Right 1081941995 11:46951074-46951096 TAAGTTATATAACTTGTCCAAGG 0: 1
1: 3
2: 26
3: 268
4: 1323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081941991 Original CRISPR CAGTTTCCTCAAAGAAAAGT GGG (reversed) Intronic
902714400 1:18262471-18262493 CAGTTTCCTCATTGAAAAAATGG + Intronic
902768715 1:18633347-18633369 CAATTTCCTCACAGAAGATTGGG - Intronic
905514999 1:38556146-38556168 CAGATTCCTCAGAGGGAAGTCGG + Intergenic
906866444 1:49425905-49425927 CAGTTTCCTCAAAGATGACAAGG - Intronic
907487922 1:54789822-54789844 CAGGGTCCTCAAGGACAAGTAGG + Intronic
908119280 1:60970581-60970603 CAGATTCTTCACAGAAAATTTGG - Intronic
908291674 1:62673408-62673430 CAGTTTCATCAACTAAAAGCTGG + Intronic
908451433 1:64259625-64259647 AAGTTTTCTTGAAGAAAAGTAGG - Intronic
908821953 1:68096952-68096974 TTGTTCCCACAAAGAAAAGTTGG - Intergenic
908868752 1:68583354-68583376 CAGGTTTGTCAAAGAAAAGATGG - Intergenic
909748460 1:79128630-79128652 CAATATCCTCAAAGACAACTTGG - Intergenic
910585554 1:88875436-88875458 AATTTTCCTCAAATACAAGTAGG + Intronic
911195800 1:94994165-94994187 CGGTTTCCTCAACTGAAAGTAGG - Intronic
911946633 1:104118090-104118112 GAGATTCCACAAAGTAAAGTAGG + Intergenic
912341720 1:108922805-108922827 CAGATTTTTCAAAGAAAACTAGG - Intronic
912887036 1:113485487-113485509 CAATTCCATCAAAAAAAAGTGGG - Intronic
913511464 1:119566454-119566476 CAGTTTCCTCACAATAAAGTGGG + Intergenic
915301016 1:154951708-154951730 CAGTTTCCTCAGAGAAAGGGAGG - Intronic
915398601 1:155605908-155605930 CAGTGGCCTCAAAAACAAGTTGG - Intergenic
915695884 1:157740602-157740624 CAGTTTCCTCAACTATAAATGGG + Intergenic
916246954 1:162697777-162697799 CAGTTTTCTCATAGAAAAATAGG - Intronic
916608697 1:166368413-166368435 CAGTTTCCTCATCTAAAAGTGGG + Intergenic
916987839 1:170210469-170210491 CAGTTTCCTCATGGAAAAAATGG - Intergenic
917153529 1:171969842-171969864 CAGTTTCCTCTATGTAAAATGGG - Intronic
917644327 1:177015156-177015178 CCTTTTCCTCAAAGAATTGTTGG - Intronic
917680410 1:177360468-177360490 CAGCTTCCTCAAACCACAGTGGG + Intergenic
918088262 1:181263758-181263780 CAGTTTCCTCATCTGAAAGTGGG + Intergenic
918655656 1:187023012-187023034 CAGTTTCATCAAAGATCAGATGG - Intergenic
918693712 1:187515248-187515270 TTGTTTCCTCAAAGAAAATATGG - Intergenic
918740836 1:188128575-188128597 CAGTTTCCTCACAGGAAGGGTGG - Intergenic
919102689 1:193113279-193113301 CAGTTTCCACACAGAAGAGATGG + Intergenic
919198645 1:194321961-194321983 AAGTTTCCTCAAAGATAATATGG + Intergenic
919250751 1:195053782-195053804 CAGTTTCCTCATAGTAAAATGGG + Intergenic
919298991 1:195737313-195737335 TAGATTCCTTAAAGAAAAGCAGG - Intergenic
919504821 1:198385727-198385749 CAGTTTCCTCAGACATAAGGTGG + Intergenic
920398451 1:205662714-205662736 CACTTTCCTGACAGAGAAGTCGG + Intronic
920626747 1:207609941-207609963 CAGTTCTCTCAAAGTAAAATGGG - Intronic
920815136 1:209324242-209324264 CAGCTTCCTCAACTGAAAGTGGG + Intergenic
921348960 1:214216069-214216091 CAGTTTCCTCATACAAAAATAGG + Intergenic
922029143 1:221781291-221781313 CAGTTTCCCCAAAGTGAACTGGG - Intergenic
922088702 1:222375284-222375306 CACTTTCCTCTAAGGAAAATGGG + Intergenic
922194353 1:223346657-223346679 CAGTTTCCTCATATGAAAATAGG + Intronic
922384177 1:225065001-225065023 CAGTTTCCTCAAAGGTAAATTGG + Intronic
923419266 1:233796600-233796622 CAGTTTCCACAATGAGAAATGGG + Intergenic
1063810882 10:9705497-9705519 CAGATACCACAAACAAAAGTAGG - Intergenic
1064127551 10:12676610-12676632 CAGGTTCCTCATTGAAAACTGGG - Intronic
1065455521 10:25902856-25902878 TGGTTTCCTCATAGAAAAGAGGG + Intergenic
1066208739 10:33215592-33215614 GAGTTGCTTCAAAGAAAAATAGG - Intronic
1067288679 10:44925744-44925766 CAGTTTCCTCTATGTAAAGTGGG + Intronic
1067375508 10:45724556-45724578 CAGTTTCCTCAACTATAATTTGG + Intergenic
1067883321 10:50066182-50066204 CAGTTTCCTCAACTATAATTTGG + Intergenic
1068218179 10:54010233-54010255 CAGTTTCCTTACAGAAAAGCGGG + Intronic
1068262357 10:54599364-54599386 CAGTTTTCTCAAAGAGCAGATGG - Intronic
1068384336 10:56305720-56305742 CAGTTTCCTCATGTAAAAGCAGG + Intergenic
1068966825 10:62920452-62920474 CAGTTTTCTCATCTAAAAGTGGG - Intergenic
1069796885 10:71059348-71059370 CAGTTTCCTCACCTACAAGTGGG + Intergenic
1069990542 10:72312774-72312796 CAGTGTCCTTAAAAAAAAGTGGG - Intergenic
1070438338 10:76415511-76415533 CAGTTTCTTCCATAAAAAGTAGG + Intronic
1071050838 10:81447227-81447249 AAGTTTCTTGAAACAAAAGTTGG - Intergenic
1071161298 10:82748753-82748775 CAGTTTCCACACATTAAAGTGGG - Intronic
1071511879 10:86267202-86267224 CTGTTTCCTCAAATTGAAGTTGG - Intronic
1071971045 10:90907157-90907179 CAGATACCATAAAGAAAAGTTGG + Intronic
1072215093 10:93281202-93281224 CTGTTTTCTTAAAGAAAAGAGGG - Intergenic
1072506553 10:96073631-96073653 CAGTTTTCACATAGATAAGTAGG - Intergenic
1073427959 10:103467568-103467590 CAGTTTTCACACAGAAATGTTGG - Intergenic
1073803961 10:107075321-107075343 CCGTTTCATCATACAAAAGTTGG - Intronic
1074034812 10:109727806-109727828 CAGTTTCCTCACTGAAAACAGGG + Intergenic
1074369077 10:112884658-112884680 CAGTTTTCTCAATGAAAAAATGG - Intergenic
1074928585 10:118099917-118099939 CAGTTTCTTCAAAGAAATTTGGG + Intergenic
1075096570 10:119475267-119475289 CAGTTTCTCCTTAGAAAAGTTGG + Intergenic
1075461503 10:122619415-122619437 CAGTATCCGCACAGAAAAGCAGG - Intronic
1076152340 10:128172650-128172672 CAGCTTCCTGAAAGCAAAGGAGG - Intergenic
1076537781 10:131193623-131193645 CAGTTTCATCAGAGATCAGTTGG + Intronic
1078123168 11:8531202-8531224 CAGTTTCCTTTAAGCGAAGTTGG - Intronic
1078728102 11:13950330-13950352 CATTTTCATTTAAGAAAAGTGGG - Intergenic
1078997133 11:16713883-16713905 CATTTTTGGCAAAGAAAAGTTGG - Intronic
1079496881 11:21054035-21054057 CATTTTCATTACAGAAAAGTTGG + Intronic
1079567276 11:21898387-21898409 CAGATTCCTCAAATGAAAATGGG + Intergenic
1080100838 11:28457531-28457553 CAGTTTCCTCACTTAAAAGGGGG - Intergenic
1080207137 11:29743290-29743312 CAGTTTCCTGAAAACAGAGTAGG - Intergenic
1080561007 11:33462711-33462733 CAGTTTCCTTACATATAAGTTGG + Intergenic
1081244225 11:40744684-40744706 CAGTTTCCTCATAGTAAGATGGG - Intronic
1081941991 11:46951046-46951068 CAGTTTCCTCAAAGAAAAGTGGG - Intronic
1082183890 11:49155767-49155789 CATTTTCTTCAAAGTAAATTGGG - Intronic
1082935372 11:58651236-58651258 CAGATTTCTCAAAGAAAAGAAGG - Intronic
1083951578 11:65959455-65959477 TAGTTTCCTCATTGAGAAGTAGG - Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1085901162 11:80701497-80701519 CACTTTCCTCAATGTAAAATGGG + Intergenic
1085928320 11:81049952-81049974 CAGTTTCCTCATATATAAATGGG + Intergenic
1086178410 11:83919974-83919996 CAGGTTGCTCAAAGAACACTTGG + Intronic
1086649809 11:89274344-89274366 CAATTTCTTGAAAGAAAAGCAGG + Intronic
1086682468 11:89689582-89689604 CATTTTCTTCAAAGTAAATTGGG + Intergenic
1086788517 11:91003801-91003823 CAGTTTTCACAAAGAAAATAAGG + Intergenic
1087146554 11:94819090-94819112 CAGTTTACTCCTAGAAAGGTAGG - Intronic
1089320312 11:117621879-117621901 CAGTTTTCTGATTGAAAAGTGGG + Intronic
1089370477 11:117952115-117952137 CAGTGTCCTCAATGAAAAGCGGG + Intergenic
1090332934 11:125945533-125945555 TAGCTTCCTCACAGATAAGTGGG - Intergenic
1090618732 11:128542048-128542070 CAGTTTCCTAAAGGAAAATGGGG - Intronic
1090948503 11:131452097-131452119 CAGCTTCCTCGAAAAGAAGTGGG + Intronic
1091448226 12:556976-556998 CAGTTTCCTCAACTATAAGGTGG - Intronic
1091770280 12:3146959-3146981 CAGTTTCCTCATCGGAAAATGGG + Intronic
1092625025 12:10317616-10317638 CAGATTTATTAAAGAAAAGTAGG - Intergenic
1092790599 12:12067620-12067642 CCTTTTTCTCAAAGAAAAGAAGG + Intronic
1092856605 12:12680308-12680330 CAGTTTCCTCAGCTAAAATTGGG + Intronic
1093684057 12:22036453-22036475 AAATTTCCTGAAATAAAAGTGGG + Intergenic
1094009400 12:25791387-25791409 CATTTTAGTCAAAGAAAAGTGGG - Intergenic
1094266727 12:28568189-28568211 CAGTTTACTCATAGAAAACCAGG - Intronic
1094544617 12:31392970-31392992 CAGTTTCCTCAACTGAAAATAGG + Intronic
1094586637 12:31782987-31783009 CAGTTACATCATAGAAATGTGGG + Intergenic
1096204359 12:49708173-49708195 TGGTTTCCTAAAAGAAAAGGGGG - Intronic
1096239630 12:49952826-49952848 CAGTGTCCTCAAAGGACACTTGG - Intronic
1098213103 12:68186862-68186884 TACTTTCCTCAATTAAAAGTAGG + Intergenic
1098609752 12:72441900-72441922 AAGTTTACTCAAGGAAAAATGGG - Intronic
1100180180 12:92076903-92076925 CAGTTTCCTCAAAATAACTTTGG + Intronic
1100670933 12:96812098-96812120 CAGTTTCCTTATAGTAAAATGGG + Intronic
1101005905 12:100400463-100400485 CATTTTCCTCAGAGATAAGATGG - Intronic
1101135927 12:101742947-101742969 CAGTTCCCTCACTGATAAGTGGG + Intronic
1101306316 12:103531050-103531072 CATATTTCTCAAAGAAAAGGGGG + Intergenic
1102088530 12:110165204-110165226 CAGTTACCTAAAAGAACAGAAGG + Intronic
1102546755 12:113662956-113662978 CAGTTTCCTCATCTAAAAGATGG - Intergenic
1103054928 12:117811283-117811305 TAGTTTCCTGAAACAGAAGTGGG - Intronic
1103410597 12:120709211-120709233 CAGTCTTCTCTAACAAAAGTGGG + Intergenic
1104569837 12:129915562-129915584 CTGTTTCATCAAAAAACAGTAGG - Intergenic
1106064477 13:26331596-26331618 CAGCTTTGTCAAAGATAAGTTGG + Intronic
1106483632 13:30154922-30154944 CCGTTTCCTCACTGTAAAGTGGG - Intergenic
1107465064 13:40642072-40642094 CAGTTTCCTCATATACAAATTGG + Intronic
1108557160 13:51604991-51605013 CAGTTTCCTAGATGATAAGTGGG + Intronic
1108679765 13:52769530-52769552 CTGCTTCTTTAAAGAAAAGTTGG - Intergenic
1108923440 13:55706278-55706300 CAACTTCCTCTGAGAAAAGTGGG + Intergenic
1110008946 13:70307023-70307045 CAGTGTCCTTATAGAAAATTTGG - Intergenic
1111662481 13:91228557-91228579 CAGTTTCCTCAAACATAAATGGG - Intergenic
1112892381 13:104254064-104254086 CATTTTCCTCAAAAAAGAATGGG - Intergenic
1113595950 13:111532983-111533005 CAGCTGCCTCAGAGAACAGTGGG - Intergenic
1116196218 14:41729248-41729270 CAGTTTGTTCACACAAAAGTTGG + Intronic
1116631230 14:47336695-47336717 CACCTCCCTCAAAGAAAAGTAGG + Intronic
1116846907 14:49873126-49873148 CAATTTTCAAAAAGAAAAGTGGG - Intergenic
1117051371 14:51863312-51863334 CAGTTTCCTCATTGTAAAGAAGG + Intronic
1117102610 14:52365829-52365851 CAGTTTCCTCATATAAAAAGAGG + Intergenic
1117360713 14:54970947-54970969 CAGCTTTCTCAAAGATCAGTTGG - Intronic
1118542744 14:66847451-66847473 CAGCTTCCTCAAAATAAAATAGG - Intronic
1118640503 14:67788020-67788042 CAGATTCCTAAAAGGAAAGCAGG - Intronic
1118993075 14:70813225-70813247 CAGTTTCCTCAATTTTAAGTAGG + Intergenic
1119431791 14:74573255-74573277 CAGTGTCCTCATTGCAAAGTGGG + Intronic
1120662833 14:87270871-87270893 CATTTTCCCCAAAGAAAGGCAGG - Intergenic
1121351198 14:93174520-93174542 CAGTTTCCTCAACTGAAAATGGG - Intergenic
1121991178 14:98559196-98559218 CTGTGTGCTCAGAGAAAAGTGGG + Intergenic
1122269043 14:100560185-100560207 CAGTTTCCTCAAGGAGGAATGGG + Intronic
1123152079 14:106192254-106192276 CAGTTTTGTCAAAGAACCGTTGG + Intergenic
1123161587 14:106283455-106283477 CAGTTTTGTCAAAGAACAGGTGG - Intergenic
1123172195 14:106384661-106384683 CAGTTTTGTCAAAGAACTGTTGG + Intergenic
1123176713 14:106426476-106426498 CAGTTTTGTCAAACAACAGTTGG + Intergenic
1123213431 14:106783677-106783699 CAGTTTTGTCAAAGAATAGTTGG + Intergenic
1202947000 14_KI270726v1_random:37470-37492 CAGTTTTTTCAAACAACAGTTGG - Intergenic
1123400467 15:19980201-19980223 CAGTTTTGTCAAAGAACTGTTGG + Intergenic
1125069785 15:35540051-35540073 CAATTTACTCAAAGAAATTTGGG + Intronic
1125788393 15:42343203-42343225 CTCTTTCCTAAAAGAAAAGAAGG - Intronic
1125846383 15:42858638-42858660 CAGTTTGCTCTAAGAAGAGTTGG - Intronic
1126504263 15:49385358-49385380 CTGTTTCCTCAAACATAATTTGG + Intronic
1126758644 15:51948989-51949011 CAGTTTCCTCAATAAAAACAAGG + Intronic
1126892130 15:53217918-53217940 CAGTTTCCTCATACATAAGATGG + Intergenic
1127241155 15:57116087-57116109 CAGTTTCCTCAACTATAAGGTGG - Intronic
1128012876 15:64315207-64315229 CAGTGTCCTCAAGGAAGAGATGG + Intronic
1128254969 15:66189687-66189709 CAGTTTCCTCATGGAAAAGATGG + Intronic
1128851690 15:70964352-70964374 CATTTTCCTCAAAGTAAAATGGG + Intronic
1129289067 15:74549383-74549405 CAGTATCTACCAAGAAAAGTAGG - Intronic
1129385465 15:75193822-75193844 CAGTTTCCTCATTGAGAAGTGGG - Intergenic
1129691378 15:77715609-77715631 CAGTTTCCACAAAGAAATAATGG + Intronic
1129972838 15:79795461-79795483 CACTTTCCTCAAAGAGAACTTGG - Intergenic
1131453346 15:92564169-92564191 CAGGTTTTTTAAAGAAAAGTAGG - Intergenic
1131477428 15:92752131-92752153 CAGTTTCCCCAAAGTAAGGAAGG - Intronic
1133300484 16:4779485-4779507 CAGTTTCCTCACAGTAAAGTGGG - Intronic
1133412966 16:5583660-5583682 CAGTTTCCTCTCTGTAAAGTGGG + Intergenic
1133665011 16:7958368-7958390 AATTTTCCTAAAAGAAAAGTAGG + Intergenic
1133822372 16:9248134-9248156 CAATTGCCTCAATGAAAACTAGG - Intergenic
1134237395 16:12477949-12477971 CATGCTCCTTAAAGAAAAGTTGG + Intronic
1134895683 16:17884925-17884947 CAGTTTTCTGAAAAATAAGTTGG - Intergenic
1134915288 16:18064342-18064364 CAGTTTCATTAATGAAAATTAGG - Intergenic
1135159410 16:20080374-20080396 CCATTTATTCAAAGAAAAGTTGG + Intergenic
1135897521 16:26421303-26421325 CAGTTTCTTCATAGAATAGATGG - Intergenic
1136091579 16:27923983-27924005 CAGTCTCCTCAAAGTAAAATAGG + Intronic
1136695310 16:32075147-32075169 CAGTGTTGTCAAAGAAAAGTTGG - Intergenic
1136795809 16:33018404-33018426 CAGTGTTGTCAAAGAAAAGTTGG - Intergenic
1136874111 16:33835976-33835998 CAGTGTTGTCAAAGAAAAGTTGG + Intergenic
1137275945 16:46933536-46933558 CAGTCTCTTAAAAAAAAAGTGGG + Intergenic
1137537195 16:49336402-49336424 CATTTTCCTCAAAGAAGCCTGGG + Intergenic
1137932602 16:52603155-52603177 CAGTCTTCTCAAGGCAAAGTTGG + Intergenic
1139709776 16:68767032-68767054 CAGTTTCCTCATCCAAAAATGGG - Intronic
1140245965 16:73249780-73249802 CAGTTAACTCAAAGAAAAATGGG + Intergenic
1140911967 16:79462282-79462304 CAGTTTCCTCACCTAAAAATGGG - Intergenic
1141720561 16:85753024-85753046 CAGTTTCCTCAAAGGAGAACTGG + Intergenic
1203098066 16_KI270728v1_random:1280059-1280081 CAGTGTTGTCAAAGAAAAGTTGG - Intergenic
1142528268 17:560518-560540 CAGCCTCCTCAAGGAAAAGGAGG - Exonic
1145123515 17:20281592-20281614 CAGCTCCCTCAAGGAAATGTTGG - Intronic
1146406760 17:32545259-32545281 CAGTTTCCTCATATAAAAAATGG + Intronic
1146528510 17:33587721-33587743 CAGTTTCCTCAAACTCAAGGTGG + Intronic
1148171591 17:45525567-45525589 CAGTTTCCTCATTTAAAAATAGG - Intergenic
1148277780 17:46320839-46320861 CAGTTTCCTCATTTAAAAATAGG + Intronic
1148299987 17:46538694-46538716 CAGTTTCCTCATTTAAAAATAGG + Intronic
1148364431 17:47042982-47043004 CAGTTTCCTCATTTAAAAATAGG + Intronic
1149010487 17:51851428-51851450 CAGTTTCCTCACCCATAAGTGGG + Intronic
1149064208 17:52460821-52460843 CAGTATCTTCAAAGGAAAGAAGG + Intergenic
1149456157 17:56790258-56790280 CAGTTTCCTCATTTATAAGTTGG + Intergenic
1150041332 17:61864161-61864183 TAATTTACTCAAAGAAAAGGAGG + Intergenic
1150159076 17:62879053-62879075 CAGTTTCCTCATCGATAAATTGG - Intergenic
1150315000 17:64161484-64161506 CAGTTTCCAGAAAGAAAGGAAGG - Intronic
1150402517 17:64870603-64870625 CAGTTTCCTCATTTAAAAATAGG - Intronic
1151526483 17:74672569-74672591 TAGTTTCCTCAAATATAAGCTGG - Intronic
1151875548 17:76866193-76866215 CAGTTTCCTCAACTATAAGTGGG - Intergenic
1152242698 17:79168560-79168582 CAGTTTCCTCATGGACCAGTGGG - Intronic
1155149810 18:23113997-23114019 GAGTTTTCTCTAAGAATAGTTGG + Intergenic
1155849865 18:30760287-30760309 CATTTTCATAGAAGAAAAGTTGG + Intergenic
1156039352 18:32802873-32802895 CAGGTTACTCAAAGTATAGTGGG + Intergenic
1156721829 18:40079554-40079576 TATTTTCCTCAAAGAAGAATAGG - Intergenic
1156732912 18:40216786-40216808 CATTTTAAACAAAGAAAAGTTGG - Intergenic
1156788397 18:40943204-40943226 CAGTTTCCTCCAAGCCATGTAGG + Intergenic
1156899854 18:42288039-42288061 GAGTTTCCTAAAGGAAAAGTGGG - Intergenic
1157049336 18:44142753-44142775 CAGTCTCCACAAAGGAATGTAGG + Intergenic
1157208677 18:45722175-45722197 CAGATTCCTCAGTGTAAAGTGGG - Intergenic
1157304781 18:46509016-46509038 CAGTTTCCACCAAGAAAGGAAGG - Intronic
1157409030 18:47448364-47448386 AAATGGCCTCAAAGAAAAGTGGG + Intergenic
1157473093 18:48004603-48004625 CAGTTTCCTCACCTAAAAATGGG - Intergenic
1157829474 18:50843736-50843758 CAGTTTCCTCAATTATAAATAGG - Intergenic
1158339527 18:56450356-56450378 CAGTTTCCTCAAATGTAAGGTGG - Intergenic
1158776356 18:60585685-60585707 CATTTGCCTGAAAGAAAAGAAGG - Intergenic
1159413291 18:68109398-68109420 CAGTTTCCTGAAAGACAACTTGG - Intergenic
1160389036 18:78516517-78516539 CAGATTCCCAAAAGAGAAGTGGG + Intergenic
1162515119 19:11142925-11142947 CAGTTTCCCCAAGGAAGAGACGG - Intronic
1162846754 19:13398690-13398712 CAGTTTCCTCATAGGGAGGTTGG + Intronic
1166794099 19:45415829-45415851 CTGTTTCCTCACTGTAAAGTGGG + Intronic
925875729 2:8309758-8309780 CAGTTTCCTCACATGAAAATGGG + Intergenic
925980772 2:9175401-9175423 CAGTTTCCTCCCTGCAAAGTGGG + Intergenic
926524188 2:13955926-13955948 CAGTCTCCCCAATTAAAAGTTGG - Intergenic
926846305 2:17144331-17144353 CAGCTTCGTCAAAGATAAGATGG - Intergenic
926955380 2:18289281-18289303 CAGTTTTCTGAAAGGAAATTAGG - Intronic
927063948 2:19450681-19450703 CACTTTTCTCAAAGGAAAGAGGG + Intergenic
927436823 2:23073706-23073728 CAGCTTCCTCACTGTAAAGTGGG + Intergenic
928229748 2:29487619-29487641 CAGTTTCCTAATAGAAATATAGG + Intronic
928646797 2:33362856-33362878 CAGTTTACTCAATGATAAATTGG - Intronic
930382459 2:50648837-50648859 CAGTTTCCTCATAGAACTTTTGG + Intronic
930683344 2:54281049-54281071 TAGCTTCCTCAGAGAGAAGTTGG + Intronic
931341241 2:61402757-61402779 CAATTTCCTCAAAGAAAAGTGGG + Intronic
931853988 2:66282340-66282362 CAGTTACCTCTAAGAAAAGAAGG + Intergenic
933853570 2:86392188-86392210 CAGGTTCCTCAAAGATCAGATGG + Intergenic
934725109 2:96611554-96611576 CAGTTTGCTCCAAGAAATCTAGG - Intronic
935251813 2:101269017-101269039 CTGTTTCGTAAAAGAAAATTTGG - Intronic
935490821 2:103717507-103717529 TACCCTCCTCAAAGAAAAGTAGG + Intergenic
936252264 2:110875991-110876013 TGGAATCCTCAAAGAAAAGTGGG + Intronic
937188216 2:120066540-120066562 AAATTTCATCAAAGAAAATTAGG - Intronic
940009657 2:149039575-149039597 CAGTTCCCTTAAAGTAAAATAGG + Intronic
940330245 2:152466320-152466342 CATTTTCTTCAAAGATAAGGTGG - Intronic
940395355 2:153183752-153183774 CAGGTTTGTCAAAGAAAAGATGG + Intergenic
942076004 2:172357806-172357828 CAGTTTCCTTAAAGAAATCAAGG - Intergenic
942437423 2:175995581-175995603 CAGTTTCTACAAATAAAAGATGG - Exonic
942488960 2:176470609-176470631 CAATTTTCTCATAGAAAAATGGG + Intergenic
943765391 2:191655409-191655431 CAGTTTCCTCCTAGAAAAATGGG + Intergenic
943919321 2:193682438-193682460 CAGCTTTGTCAAAGATAAGTTGG + Intergenic
945238110 2:207651640-207651662 CATTTTTCTCAATGAAAAATAGG + Intergenic
945528823 2:210925143-210925165 AAGTTTCCTAAAACACAAGTTGG - Intergenic
946566468 2:220971264-220971286 CACTTTTTTCAAAGAAATGTGGG + Intergenic
946600919 2:221359067-221359089 CAGTGTCATAAAAGAAAATTAGG + Intergenic
946993006 2:225357195-225357217 CAGTTTGATCAGAGAAAAATGGG - Intergenic
1168911581 20:1452244-1452266 CAGTTTCCTCAACTATAAATTGG - Intronic
1169417612 20:5431384-5431406 CAGCTTCCACAAAGAAATTTAGG + Intergenic
1169969374 20:11252774-11252796 CATCTTCCTCAAAGTAATGTTGG - Intergenic
1170276631 20:14598577-14598599 TAGTTTCCTAAGAGAAATGTTGG - Intronic
1172689772 20:36782440-36782462 CAGTTTCCTCACAGCAAAATGGG + Exonic
1173144020 20:40509678-40509700 CAGATCCCTGGAAGAAAAGTTGG + Intergenic
1174122712 20:48278719-48278741 CAGTTTCCTCATCTATAAGTTGG - Intergenic
1177068119 21:16465259-16465281 CAGTTTCCTACCAGAAAAGTGGG + Intergenic
1177388572 21:20438072-20438094 CAGTTTTGTCAAAGACAAGATGG - Intergenic
1177994202 21:28075312-28075334 CTGTTTGATGAAAGAAAAGTTGG + Intergenic
1178249768 21:30991176-30991198 CCGTTTCCTTAAAGAATATTTGG + Intergenic
1178557212 21:33602836-33602858 CCTTTTCTTCAAAGAAAAGCAGG + Intronic
1178713478 21:34941983-34942005 CTGATTCCTCAAGGAAAACTAGG + Intronic
1179350914 21:40610214-40610236 CAATTTCCTCCCAGAAATGTGGG - Intronic
1179439706 21:41384391-41384413 CAGTTTCATCAAAAGCAAGTTGG + Intronic
1179982847 21:44905547-44905569 CAGTTTCCTCACTGTGAAGTGGG + Intronic
1180018952 21:45107810-45107832 CAGCTTCAACAAAGAAAAGATGG + Intronic
1182728245 22:32466022-32466044 GAGTTTCCTTAAGGTAAAGTGGG + Intergenic
1182734568 22:32522801-32522823 CAGTTTCCTCAGTGTAAAGGAGG - Intronic
1183369165 22:37422915-37422937 CAGTTTCCTCAATATGAAGTGGG - Intronic
949278334 3:2315373-2315395 CAGTTTCCCAAACGAGAAGTGGG + Intronic
949779412 3:7669301-7669323 CAGAGTCCTGAAAGACAAGTAGG + Intronic
950517816 3:13479301-13479323 CAGTTCCCTCAAGATAAAGTTGG + Intergenic
950577797 3:13843385-13843407 CAGTTTCCTCATTGAAAAAAAGG - Intronic
951419507 3:22467632-22467654 CAGTTTCCTCAATGGCAAATGGG - Intergenic
952146676 3:30540714-30540736 CAGTTTTGTCAAAGATCAGTTGG - Intergenic
952604417 3:35127502-35127524 CTGTTTCCTGAAAGAAGATTTGG - Intergenic
952644281 3:35637632-35637654 AATTTCCCTCAAAGAAAAATAGG + Intergenic
953212851 3:40891709-40891731 CAGTTTTCTGTAAGACAAGTGGG - Intergenic
953827627 3:46267859-46267881 CAGTTTTCTGAAAGAAAGGCAGG + Intergenic
954902846 3:54034740-54034762 CAGTTTCCTCAAACACAAATAGG + Intergenic
954948572 3:54448480-54448502 CAGTTCCCCCAAACGAAAGTAGG + Intronic
955238134 3:57157681-57157703 CATTTTCCTCAGATAAAAGGGGG + Intronic
955284639 3:57627504-57627526 CAGTTTCTCCAAAGACAAGAAGG - Exonic
955660096 3:61289625-61289647 AAGTTTCCTCAAGGAAAATAAGG - Intergenic
956095543 3:65712273-65712295 CAGTTTCCTCAGAGCATGGTGGG - Intronic
956361311 3:68450940-68450962 CAGTTTCCTCATTGTAAAATGGG - Intronic
956619126 3:71202924-71202946 AAGCTTCCTCGAAGAAAAGAGGG - Intronic
956665964 3:71642330-71642352 CAGTTTCCTCACTGAAAAGTGGG - Intergenic
957158193 3:76573248-76573270 CAGTTTCCTCTACAAAAACTGGG + Intronic
957255300 3:77828155-77828177 CAGATCCCCCAAAGAAAAGCAGG + Intergenic
957257912 3:77862631-77862653 CAGTTTCCTTAAAGATTAGCTGG + Intergenic
957310621 3:78513846-78513868 CAGTTTCCTCATATGTAAGTTGG - Intergenic
958116525 3:89226227-89226249 CAGTTTCCTCACATATAAATTGG + Intronic
960343270 3:116501288-116501310 CAGTTTTGTCAAAGAACAGATGG - Intronic
961981318 3:131082051-131082073 CACTTTCCTCCAAGCAAAGCAGG - Intronic
962107188 3:132403088-132403110 CAGTTTCCTCATCTAAAAATAGG - Intergenic
962330063 3:134470592-134470614 CAGTTTCCTCATTGAAAATGCGG - Intergenic
962424994 3:135261883-135261905 CAGTTTCCTCATCCAAAATTGGG - Intergenic
963270532 3:143281750-143281772 CAGTTTCTTTTAATAAAAGTAGG - Intronic
963344197 3:144074272-144074294 CACTTTCCTCAAAGAAAATTGGG - Intergenic
963399505 3:144779693-144779715 CACTTTGGTCAAAGAAATGTAGG - Intergenic
963691218 3:148505147-148505169 CAGGTTTCTCAAAGAACAGATGG + Intergenic
964002005 3:151786182-151786204 TGGTTTCCTCAAAGTAAAATAGG + Intergenic
964860771 3:161198511-161198533 CTGTTTACTTAAGGAAAAGTGGG + Intronic
965527703 3:169739164-169739186 CTGTTTCTACAGAGAAAAGTTGG + Intergenic
965680938 3:171250562-171250584 CAGCTAGCTCAGAGAAAAGTAGG + Intronic
966618156 3:181934453-181934475 CATTTTACTCAATGAAAAGGAGG + Intergenic
966663238 3:182439322-182439344 CAGTTTCCTCAATTAAAATGGGG - Intergenic
966732248 3:183161132-183161154 CAGTTCCCTCACTGAAAAATGGG - Intronic
967057835 3:185845152-185845174 CAGGTTCCTTATAGAAATGTGGG + Intergenic
967333106 3:188311942-188311964 TAGTTTCTTTAAAGAAATGTTGG - Intronic
967353357 3:188539911-188539933 CTGTTTCCTCATATAAAACTTGG + Intronic
967528046 3:190516425-190516447 CTGATTCTTCAAAGAAAGGTTGG + Intronic
967761071 3:193226942-193226964 CAGTGTTCTGAAACAAAAGTCGG + Intergenic
967803668 3:193693182-193693204 CATTTTCCTGACAGGAAAGTAGG - Intronic
968023418 3:195416639-195416661 CATTTTTCACAAAGAAAAATAGG + Intronic
971950279 4:33335697-33335719 CACTTTTCTCAAAGATCAGTAGG + Intergenic
972122200 4:35718304-35718326 CAATTTTCTCAAAGATCAGTTGG - Intergenic
972359410 4:38313788-38313810 CAGTTTCCTCATTGGAAAATGGG + Intergenic
972433657 4:39010625-39010647 CAGCTTCATCAAAGATCAGTTGG - Intronic
972811611 4:42594356-42594378 CATTTACCTGAAAGAAAACTGGG + Intronic
974786143 4:66621628-66621650 CAGTTTCCTCAAAAAAATGTAGG - Intergenic
975059451 4:69978980-69979002 CAGTTGACTTACAGAAAAGTGGG - Intergenic
975735291 4:77374545-77374567 GAGTTTCCTAAAAAAAAAGGGGG - Intronic
975847107 4:78536271-78536293 CAGTATCCTGAAACACAAGTAGG - Intronic
976286713 4:83377523-83377545 CATTTCCCTCAATGAAATGTTGG - Intergenic
977765303 4:100790615-100790637 CCGTTCCATCAAAGAACAGTTGG - Intronic
978469347 4:109046144-109046166 CAGTTTCCTCACTGAACAATAGG + Intronic
978676083 4:111317855-111317877 CAGTTTCATCCAAGAGAACTTGG + Intergenic
979935497 4:126689569-126689591 AAGTTACCTCATAGAAATGTCGG - Intergenic
980052483 4:128052194-128052216 CAGTTTCCTCATTTAAAAATGGG + Intergenic
980687770 4:136253003-136253025 CACTTTCGTCAAAAATAAGTTGG + Intergenic
981257258 4:142676698-142676720 CAGTTTTCTCAAAGATCAGATGG - Intronic
981792647 4:148556684-148556706 CAGTTTTCTCATAGAATTGTGGG - Intergenic
983433841 4:167685763-167685785 CAGTTTCCACAAATATAAGTTGG + Intergenic
983480381 4:168266186-168266208 CACTTTCCTCATTGTAAAGTGGG + Intronic
984068183 4:175076634-175076656 CTGTTTTCACAAAGCAAAGTAGG + Intergenic
984507023 4:180632816-180632838 CAGTTTCCTCAACTAAAAAATGG - Intergenic
985812685 5:2101691-2101713 CAGTTTCCCCAATGAAAAACGGG - Intergenic
986045160 5:4029759-4029781 GATTTTCCTCCAAGAAAAATTGG + Intergenic
986763829 5:10904756-10904778 CAGTTTCCTCATAGGAAAAATGG + Intergenic
987233845 5:15923230-15923252 CAGTCTTCTGAAAGAAACGTAGG + Intronic
988117961 5:26920652-26920674 CTGTTTGCTTGAAGAAAAGTGGG + Intronic
988158085 5:27480589-27480611 GAGGTTCTACAAAGAAAAGTAGG + Intergenic
988264771 5:28933810-28933832 CAATTTCCTCAAGGATGAGTTGG + Intergenic
989370250 5:40699172-40699194 CAGTTCCTTTAAAGATAAGTTGG + Intergenic
990007409 5:50960104-50960126 CAGTTTCCTGACTGCAAAGTGGG + Intergenic
990597067 5:57322714-57322736 CTGTTTGCTGAAAGAAAAGCAGG + Intergenic
990839228 5:60057116-60057138 TAGTTTCATCAAATATAAGTGGG - Intronic
990941945 5:61211307-61211329 CAGTTGACTCAAAGAAAATTTGG - Intergenic
991003467 5:61805616-61805638 CCCTTAGCTCAAAGAAAAGTGGG + Intergenic
991256071 5:64616401-64616423 CAGTTTCCTCATAGTAAAATGGG + Intergenic
992344291 5:75860793-75860815 CAGCTTTGTCAAAGAAAAGATGG - Intergenic
993542713 5:89172318-89172340 AAGTTTCCTCAAAGCATAATGGG + Intergenic
993719333 5:91306718-91306740 CAGTGTCCTGAAGGAAAAGGTGG - Intergenic
993977099 5:94496100-94496122 CAGTCCCCTCAAAGAGAGGTTGG + Intronic
994382308 5:99085629-99085651 GAGATTCTTCAAAGGAAAGTTGG + Intergenic
994691539 5:103025795-103025817 CAGTTTTCTCATAAAAAAGTGGG + Intronic
995026509 5:107429638-107429660 CAGTTTCCTCATATGTAAGTTGG + Intronic
995107612 5:108392730-108392752 CAGAGTCATGAAAGAAAAGTAGG + Intergenic
995687221 5:114783997-114784019 CAGTTTCCTCAACTATAAGATGG + Intergenic
996095962 5:119399552-119399574 CAGTCTCCTTAAAAAAAAATCGG + Intronic
996445504 5:123544570-123544592 CAATTTGTTCAAACAAAAGTAGG + Intronic
996856251 5:128010711-128010733 CAGTCTCTTCAAAGAAAGCTGGG + Intergenic
997403090 5:133617558-133617580 CAGTATCTTCAAAGAAGACTTGG - Intergenic
998562751 5:143186522-143186544 TGGTTTGCTCAAAGAAAAGCTGG - Intronic
998684495 5:144508445-144508467 CAGTTCCCGCACAGAAAGGTGGG + Intergenic
999355848 5:150929747-150929769 CAGTTTGCAAAAACAAAAGTAGG - Intergenic
999498209 5:152120838-152120860 CTGTTTCTTCAACTAAAAGTGGG + Intergenic
999808993 5:155110261-155110283 CAGTTTTCACACAGAAAAATGGG + Intergenic
1001010255 5:168091066-168091088 CAGTTTCCTCATAGTAAAATAGG + Intronic
1001122947 5:168995017-168995039 CAGTTTCCTTATGGAAAAATAGG - Intronic
1001661790 5:173398812-173398834 CAGTTTCCTCCAGGAAAACCCGG - Intergenic
1002160760 5:177312656-177312678 CAGCTTCCTCACAGAAGAGGAGG - Intronic
1002209813 5:177591955-177591977 CAGTTTCATCTATGAAAAGCTGG + Intergenic
1002851018 6:996423-996445 CAATTACCTCAAAGAAACGTAGG + Intergenic
1004286658 6:14327383-14327405 CAGTTTCCTTAGAGATAACTGGG - Intergenic
1004870486 6:19899328-19899350 CAGTTTACTCAAAAGAAATTTGG - Intergenic
1005134013 6:22545943-22545965 CAGCTTCCACAAAAAGAAGTAGG + Intergenic
1006819022 6:36875765-36875787 CAGCTTCCTCAAAGTAAAATGGG - Intronic
1007416744 6:41695506-41695528 CTGTTTCCTCCAGGAAAAATGGG - Intronic
1008271089 6:49490905-49490927 CAGTTCCATCAAAGAACACTGGG + Intronic
1008467648 6:51848480-51848502 CAGTTTCCTCAATGTAAAAATGG - Intronic
1008506668 6:52237354-52237376 CAGTTTCCTCAACTATAAGATGG + Intronic
1009219850 6:60970407-60970429 CCATTTCCTCAAAAAAAAATGGG + Intergenic
1009919082 6:70034322-70034344 GAGTTTTCTTAAAGAAAGGTTGG - Intronic
1010197727 6:73256745-73256767 CAGTTTCCTGATAGCAAAATGGG - Intronic
1010617127 6:78027321-78027343 CAGCTTAGTCAAAGAAAAGCTGG + Intergenic
1010926007 6:81747227-81747249 AAGTTTTCTGAAAGAAAACTAGG - Exonic
1011560535 6:88609377-88609399 CAGGTTCCTCATCTAAAAGTGGG + Intergenic
1011883099 6:92056921-92056943 CATTGTCCTCAAAGAAAACATGG + Intergenic
1011922740 6:92601407-92601429 CAGCTTTGTCAAAGAACAGTTGG - Intergenic
1012629791 6:101450927-101450949 CAGTTTCCTCAGAGTAAAACTGG + Intronic
1012888607 6:104873972-104873994 CAGGTTCGTCAAAGATCAGTGGG - Intergenic
1012928654 6:105294159-105294181 CAGTTTCTTCACAGATATGTAGG - Intronic
1014170905 6:118278133-118278155 CACTTTCCTCAAAGAAATTTAGG + Intronic
1015423930 6:133042486-133042508 CACTTCCCTCAAAGAAGAGAAGG - Intergenic
1015610210 6:135009153-135009175 CAGTTTCTCTAAAGAAATGTAGG - Intronic
1015989724 6:138925615-138925637 CACTTTCCAAAAAGAAAAGAGGG - Intronic
1016649417 6:146447219-146447241 CAGTATCCTCCAATAAGAGTTGG + Intergenic
1016759731 6:147723756-147723778 CAGTTCCCTCCAAGGAAAGATGG - Intronic
1017459318 6:154634382-154634404 AAGTTTCCTCAAAGATAAATTGG + Intergenic
1017715143 6:157205244-157205266 CAGTTTCTTGAAAGTAGAGTTGG - Intronic
1017873794 6:158506950-158506972 CTGTTTCCTGAAAGAACAGCAGG - Exonic
1019818156 7:3216659-3216681 CAGTTTCCTCATATAAAAGTGGG + Intergenic
1020451965 7:8329833-8329855 CAGTTTCCTCAAATATAAGTTGG - Intergenic
1020625800 7:10577976-10577998 CAGTTTTATTGAAGAAAAGTTGG - Intergenic
1021367871 7:19803722-19803744 CTGTTTCCTTACAGAAAAGAGGG + Intergenic
1021369696 7:19828181-19828203 CAGGTTGTTAAAAGAAAAGTAGG + Intergenic
1022493144 7:30836069-30836091 CAGTTTCCTCATCTATAAGTGGG + Intronic
1022589313 7:31646028-31646050 CAGTTTTCACAAAGAAAGGCTGG + Intronic
1022807230 7:33834547-33834569 CAGTTTCCTCATCTGAAAGTGGG - Intergenic
1023083845 7:36550474-36550496 CAGTTTCCTAATTTAAAAGTGGG - Intronic
1023528986 7:41133952-41133974 CAGTATCTTCAATGCAAAGTTGG - Intergenic
1023590972 7:41780174-41780196 CAGTTTCCTCAACTGTAAGTTGG + Intergenic
1024199570 7:47091805-47091827 CAGTTGCCTCTCAGAGAAGTGGG - Intergenic
1025738183 7:64173570-64173592 CTGTGTCCTCAAAGCAATGTTGG - Intronic
1027265651 7:76493938-76493960 CAGTTTCCTCTAATGAAAATGGG - Intronic
1027317021 7:76992055-76992077 CAGTTTCCTCTAATGAAAATGGG - Intergenic
1027363156 7:77430088-77430110 CAGTTTCATTAAATAAAAGCTGG - Intergenic
1027766761 7:82353730-82353752 CATTCTCCTCAAAGATAAGGTGG - Intronic
1028089781 7:86684277-86684299 CAGTTTCCTCAACTGAAAATAGG + Intronic
1028350159 7:89837080-89837102 CAGTTTCCTCATGGAAAAAATGG + Intergenic
1029014691 7:97303555-97303577 CAGTTTCCTCATAGGAATGTTGG + Intergenic
1029861295 7:103575174-103575196 CAGTTTCCTTAAATATAAATAGG + Intronic
1030100744 7:105943151-105943173 CTGCTTCCTCATCGAAAAGTGGG - Intronic
1031961342 7:127992907-127992929 GAGTTTCCCCAAAGAAAACTGGG - Intronic
1032756423 7:134895053-134895075 CAGTTCCCTCAGAAAACAGTGGG - Intronic
1033589112 7:142796038-142796060 CAGTTTCCTCATTGGAAAGATGG - Intergenic
1034729437 7:153372048-153372070 CTCTTTTCTCAAAGAAAAATGGG - Intergenic
1035295120 7:157862882-157862904 CAGTTTCCTGAAAGATGAGGGGG + Intronic
1036062174 8:5335564-5335586 CAATTCCCTGAAAGAAAACTAGG - Intergenic
1037536672 8:19831039-19831061 CAGTATACTCAAAGGAAAATAGG - Intronic
1038622601 8:29158009-29158031 CAGTGTGCTCAAAGAACAGATGG - Intronic
1042522621 8:69729986-69730008 CAGTTTCATAAAAGAAAAAGAGG + Intronic
1042632840 8:70839491-70839513 CACTTTCATCAAAGTAATGTTGG - Intergenic
1043789001 8:84438866-84438888 CAGTTTCGTCAAAGATCAGATGG + Intronic
1043806573 8:84679588-84679610 CAGTTTCATCAAAGAAGATAAGG - Intronic
1044059205 8:87613785-87613807 CAGTTTCCTTTCAGAAAACTGGG + Intronic
1044494957 8:92866306-92866328 TAGATTCCTCAAAGTAAATTGGG + Intergenic
1044811021 8:96062158-96062180 CAGTTTTGTCAAAGATCAGTTGG - Intergenic
1045763661 8:105641787-105641809 GAGTTTCCTTAATGAAATGTTGG + Intronic
1047708092 8:127523036-127523058 CAATTTGGTCAAAGAAAAATGGG + Intergenic
1047768308 8:128008407-128008429 CAGTTTCCTCATTGATAAATTGG - Intergenic
1047787521 8:128168230-128168252 CAGTTTCCTCAACATAATGTAGG + Intergenic
1048080537 8:131121837-131121859 AAGTTTCCCCAGAGGAAAGTGGG - Intergenic
1049056647 8:140242213-140242235 CAGTTTTCTCAAAAACAAATGGG - Intronic
1049315154 8:141962039-141962061 CAGTTTCCTCCTTGGAAAGTTGG - Intergenic
1049346135 8:142139734-142139756 CAGTTTCCTCAGTGTAAAATGGG + Intergenic
1049838712 8:144756091-144756113 CAGTTTTCACACAGAAAAGCGGG - Intronic
1050040947 9:1492882-1492904 GAGAGTCTTCAAAGAAAAGTTGG - Intergenic
1050597927 9:7222953-7222975 CTGTTTCCTCATTTAAAAGTTGG + Intergenic
1051796376 9:20876105-20876127 CAGTTTTCTCTAATAAAAGGAGG - Intronic
1051891024 9:21943139-21943161 CAGTGTTCTCAAAGGAGAGTTGG + Intronic
1052385775 9:27822263-27822285 CAGTCTTTTCAAAGAAAAATGGG - Intergenic
1054944849 9:70784672-70784694 CTGTTTCCTATATGAAAAGTAGG + Intronic
1055719334 9:79154096-79154118 CAGTTGACACAAAGACAAGTTGG - Intergenic
1056552288 9:87662106-87662128 CAGTTTTGTCAGAGAACAGTTGG + Intronic
1056890960 9:90491895-90491917 CAATTTCTTCAAAAAAAAATAGG - Intergenic
1057892226 9:98877886-98877908 CAGTTTCCTCACAGATTTGTTGG + Intergenic
1058234484 9:102472319-102472341 CAATTTCCTCAAAGCAAAATTGG - Intergenic
1058417291 9:104802305-104802327 CAGCTTCCTCTAATAAATGTTGG + Intronic
1058596682 9:106622687-106622709 CAGTTTCCTCATGGTAAAATGGG - Intergenic
1059605222 9:115827165-115827187 CAGTTTTGTCAAAGATCAGTTGG - Intergenic
1059910873 9:119042793-119042815 CAGTTTCCTCAAATATAAAATGG - Intergenic
1060119228 9:120972601-120972623 CAGTTTCCTCCTAGCAGAGTGGG - Intronic
1060965074 9:127707635-127707657 CAGTTTCCCCAAATATAAGTGGG + Intronic
1061206576 9:129167329-129167351 CAGTCTCCTCAAAGGAAGCTGGG - Intergenic
1062058421 9:134481466-134481488 CAGTTTGCTCAAAGCAAATTAGG + Intergenic
1185540427 X:898974-898996 CAGTTCCCTCAAAGAGCAGGGGG - Intergenic
1185632182 X:1523257-1523279 CAGTTTCCCCTAAGCAAAATGGG + Intronic
1186620247 X:11232928-11232950 CAGTTTCCAAAAATAAAATTAGG - Intronic
1188479363 X:30621611-30621633 CAGTTTTCTAAAAGAAAAACAGG + Intergenic
1190887020 X:54539332-54539354 CAGTTTCCTCAACTAAAACATGG - Intronic
1190938892 X:55021134-55021156 CAGATGCCTCAGAGAAATGTTGG + Exonic
1191080806 X:56507645-56507667 CAGTTCATTCAAAGAAAAGTTGG + Intergenic
1192171793 X:68860352-68860374 CAGTTTACTCATTGAGAAGTGGG - Intergenic
1192410686 X:70930178-70930200 CAGTTTCTTCATAAACAAGTAGG + Intronic
1192728231 X:73775293-73775315 CAGTTTCATCAAAGATCAGATGG - Intergenic
1194565968 X:95488257-95488279 TAATTTTCTCAAAGAAAAGAAGG + Intergenic
1194625214 X:96219372-96219394 CAGGTTTCTCAAAGATAAGATGG - Intergenic
1195465571 X:105175013-105175035 CAGTTTGCTCAAATTAAATTGGG + Intronic
1198219085 X:134583551-134583573 CAGTTTCCTCATATAAAATAGGG + Intronic
1199713732 X:150491191-150491213 CAGTTTCCTCATGCAAAAGGAGG - Intronic