ID: 1081943406

View in Genome Browser
Species Human (GRCh38)
Location 11:46965022-46965044
Sequence GAGTGCACAAATTTTAAGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 138}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081943406 Original CRISPR GAGTGCACAAATTTTAAGAC TGG Intronic
900133877 1:1105304-1105326 GAGGGCAGGAGTTTTAAGACCGG + Intronic
904504678 1:30941399-30941421 GAACACACAATTTTTAAGACAGG + Intronic
911826806 1:102497681-102497703 AACTGCACAAATTGTAAAACAGG + Intergenic
912051764 1:105538685-105538707 GGGTGCTCAATTTTTATGACTGG + Intergenic
917495546 1:175537213-175537235 GAGAGCACATGTCTTAAGACAGG - Intronic
920266018 1:204723509-204723531 GAGTGCAAAAAACTAAAGACAGG - Intergenic
922951258 1:229559674-229559696 TAGAGCAGAAATTTGAAGACAGG + Intergenic
923983911 1:239357832-239357854 AAGGGCACAGAGTTTAAGACAGG - Intergenic
1066251085 10:33633340-33633362 GAGTGCCCAAGTTTTAAAAATGG + Intergenic
1066587917 10:36958361-36958383 GAGCCCTTAAATTTTAAGACAGG - Intergenic
1066977985 10:42386782-42386804 GAGAGCCCAAATTTTTAGAAGGG + Intergenic
1072806372 10:98426096-98426118 GAGTGCAGGAATTTAAAAACTGG - Intronic
1073670685 10:105584258-105584280 GAGTGGACAAATGTTAATCCTGG - Intergenic
1074889025 10:117720016-117720038 GGGTGCACAAATTCTAAGGTAGG + Intergenic
1080280779 11:30554422-30554444 CAGAGCAAAAATTTTAAAACAGG - Intronic
1080296371 11:30734012-30734034 AAATGCACACATTTTAAAACAGG + Intergenic
1081943406 11:46965022-46965044 GAGTGCACAAATTTTAAGACTGG + Intronic
1083673113 11:64310880-64310902 GGGTGCACAAAGTTTAAGATTGG - Intronic
1085473928 11:76777024-76777046 GAATCCACAAATTTGAAGATAGG - Intergenic
1087193392 11:95280306-95280328 GATTGCACAAAATTCAAGATGGG + Intergenic
1092960298 12:13590788-13590810 GAGTGGGCAAATTATAAAACTGG - Intronic
1093046570 12:14453412-14453434 AAGTCCACAAGTTTGAAGACAGG - Intronic
1093355499 12:18161944-18161966 GAATGCAGAACTTTTAAGAACGG - Intronic
1093368563 12:18335416-18335438 CATTACACAAATTTTAAGAAAGG - Intronic
1095182595 12:39163332-39163354 CAGAGTACAAATTTTGAGACAGG - Intergenic
1098890023 12:76000607-76000629 GAATGCACAAATGATAAGAAAGG - Intergenic
1100573315 12:95863518-95863540 GAGTGAACAAATTCAAACACTGG - Intronic
1105011304 12:132758821-132758843 AAGTACACAACTTTTGAGACTGG + Intronic
1107170703 13:37339740-37339762 AAGGGCACAAAATTTTAGACAGG - Intergenic
1107850391 13:44566508-44566530 GAATACATAAATTTTAAGAGTGG - Intronic
1108999569 13:56780658-56780680 GAATGTATAAATTTTAAGATAGG + Intergenic
1109807618 13:67465085-67465107 GAGGGAACAAAATTTCAGACAGG - Intergenic
1109960920 13:69629273-69629295 GTATGAACAAATGTTAAGACTGG + Intergenic
1109970498 13:69761811-69761833 GAGTGCAGAACTTTTAATAATGG - Intronic
1110047269 13:70845790-70845812 AAGTGCACAAAATGTCAGACAGG - Intergenic
1116240984 14:42342161-42342183 AAGTTGACAAATTTTAAGGCTGG + Intergenic
1117704902 14:58455068-58455090 GAATCAACAAACTTTAAGACAGG - Intronic
1120534513 14:85677231-85677253 GGGTGCTTAAATTTTAAGACTGG + Intergenic
1125351164 15:38769027-38769049 GAATGCAGAACTTTTAAGGCAGG - Intergenic
1127334618 15:57971429-57971451 ATGTACACAGATTTTAAGACAGG + Intronic
1127638113 15:60890369-60890391 GAGTACACAAATTTTAAATAAGG + Intronic
1130239478 15:82173655-82173677 AAGTACACACATTTTAAGAGAGG - Intronic
1135606547 16:23830826-23830848 GAATGCACAAATTTAAATATAGG - Intergenic
1137299184 16:47130383-47130405 GAGGGCTCATATTTTAAGAGGGG - Intronic
1137785111 16:51132132-51132154 AAGAGCCCAAACTTTAAGACTGG + Intergenic
1138306148 16:55977280-55977302 GAGTGCAGAACTTTTAATAACGG - Intergenic
1141013250 16:80423224-80423246 GAGTGTAAAAATTTCAAAACCGG + Intergenic
1142717339 17:1754472-1754494 GGGGGCACAAGTTTTAAGTCAGG - Exonic
1146247626 17:31303608-31303630 GGGGGCACAAATTTTAAAACTGG - Intronic
1148435452 17:47680859-47680881 GAGAGCAGAACTTTTAAAACTGG + Intronic
1151107851 17:71638718-71638740 GAGTACTCAACTTTTAAAACAGG + Intergenic
1156956386 18:42969862-42969884 AAGTGCACAAATTTTGATACTGG - Intronic
1158393537 18:57062469-57062491 GAGTGCAGGAAATTCAAGACAGG - Intergenic
1162864820 19:13537808-13537830 GAGTGCACCAGTTTATAGACAGG - Intronic
1167874654 19:52401683-52401705 AGGTTCACAAATTTTAAGAAAGG + Exonic
925695067 2:6567809-6567831 TATTGCACAAATTTTAAAAAGGG + Intergenic
927034331 2:19157849-19157871 GAAGGCACAAATTTTTACACTGG - Intergenic
930795659 2:55387443-55387465 GAGTGAAAAAATTTTAAACCAGG + Intronic
938662532 2:133502530-133502552 GACTGAATAGATTTTAAGACTGG - Intronic
939434283 2:142153795-142153817 GATGGCTAAAATTTTAAGACAGG - Intergenic
939743825 2:145944846-145944868 GAGTTCATAAATTATAACACAGG - Intergenic
940617408 2:156066541-156066563 GGGGACACAAATTTTAAGGCAGG - Intergenic
945538885 2:211057411-211057433 GAGTGCATAAATTTTTGGAAAGG - Intergenic
947063339 2:226191555-226191577 GTGTGCACATATTTTAAAACAGG + Intergenic
1169881655 20:10353261-10353283 GGGAGCAAAAATTTAAAGACAGG + Intergenic
1170480789 20:16763124-16763146 CAGTGCATCAATTCTAAGACAGG + Intronic
1171055863 20:21905448-21905470 AAGTTCCCAAATTTGAAGACAGG + Intergenic
1171942075 20:31340518-31340540 GTGATGACAAATTTTAAGACTGG - Intergenic
1177258789 21:18701313-18701335 GAGGGCTCAAATTTAAAGAGTGG - Intergenic
1177432221 21:21004981-21005003 GAGTGAACAAATTGTAAGAAGGG + Intronic
1178021124 21:28409509-28409531 GAATGCATACATCTTAAGACTGG + Intergenic
1179135649 21:38678064-38678086 GTGTCCACAAATTTTTAGAGAGG - Intergenic
1185304398 22:50105454-50105476 GAATGCTCAAATTCTAAGACTGG - Intronic
949143214 3:661748-661770 GAGTGTACACATTTTTAGAATGG + Intergenic
949377259 3:3404693-3404715 GAGTGCCCAAAGTATAAGAGGGG + Intergenic
951697392 3:25459988-25460010 GAGTTCACAAAATATAAGAACGG - Intronic
955530450 3:59867260-59867282 GTGTGTCCAAATTTTAACACAGG - Intronic
957010160 3:74995516-74995538 AAGTGCACAGCTCTTAAGACTGG + Intergenic
958642803 3:96829426-96829448 GAGAGCACATATTTTTTGACAGG - Intronic
959211739 3:103392337-103392359 GATTTCACAAATTATCAGACTGG + Intergenic
960958464 3:123052030-123052052 AAGTGCACAAATCATAAGTCTGG - Intergenic
961354719 3:126329889-126329911 GAGTTCATAACTTTTATGACAGG - Intergenic
966122300 3:176536410-176536432 GAGTGCACAAATTTTGAAAGTGG + Intergenic
967342637 3:188417038-188417060 GAATGCAGTAATTTTAAGAAAGG - Intronic
971048190 4:22829678-22829700 TTGTGCACAGATTTTAACACAGG - Intergenic
972046409 4:34670349-34670371 GAAAGCACAAATATAAAGACAGG - Intergenic
973821370 4:54664518-54664540 GAGTGTCCAAGTTTTAAGGCAGG - Intronic
975574508 4:75849485-75849507 GAGTTCACAAATATTAATAAGGG - Intergenic
976268197 4:83205057-83205079 TAGTGCCCAAATTTTTAGAAGGG - Intergenic
977042895 4:92036714-92036736 GAAAGAACAATTTTTAAGACAGG + Intergenic
977867620 4:102048748-102048770 AAGTGCACTAAGTTTAAGACTGG + Intronic
982282441 4:153698522-153698544 GAGTGCAGAACTTTTAATAATGG - Intergenic
982999267 4:162391487-162391509 GAGTGCACAAGATATGAGACAGG + Intergenic
983009521 4:162529546-162529568 AAGTGCACAACTTTTAAAATAGG + Intergenic
983320632 4:166191826-166191848 GAGTGCACAGAATTCAAGAACGG + Intergenic
983604103 4:169566093-169566115 TAGTTCACAAATTTTGAGAATGG - Intronic
985897505 5:2757516-2757538 GAATGCAGAAATTTTAAAAATGG + Intergenic
986151769 5:5136577-5136599 GAGTGGACCGAGTTTAAGACTGG - Intergenic
986509060 5:8483980-8484002 GAGTGCAGAACTTTTAACAATGG - Intergenic
987011862 5:13774436-13774458 GAGTACACAGATTTCAAGCCAGG + Intronic
988056287 5:26101616-26101638 CAGTGAAGAAATTGTAAGACTGG + Intergenic
988956835 5:36328935-36328957 GACTGCACACATTTAAACACGGG - Intergenic
991068665 5:62452756-62452778 GTGTGCACGCATTTTGAGACGGG + Intronic
992931021 5:81645455-81645477 TAATGCAAAAATTTTAAGAAAGG + Intronic
994201573 5:96982819-96982841 AAGTACACAAATTTTAAGTGTGG + Intronic
996320612 5:122211219-122211241 CATTGCAAAAATTCTAAGACAGG + Intergenic
1005570968 6:27145396-27145418 GAGTCCACGAATTTTAAGCTAGG - Intergenic
1007251236 6:40496515-40496537 CAGTGCAAAGATTCTAAGACTGG - Intronic
1008558731 6:52702161-52702183 AAGTGCAAAAATATAAAGACTGG + Intergenic
1009981169 6:70727687-70727709 TAGAGCCCAAATTCTAAGACGGG - Intronic
1011673308 6:89705360-89705382 GAGATCAAAAAGTTTAAGACTGG + Intronic
1014669928 6:124289760-124289782 GAGTGCAAAAATTTTTAGGGAGG - Intronic
1018409017 6:163522298-163522320 GAGTGAACAAGGTTTATGACAGG - Intronic
1019752145 7:2737588-2737610 AAGTGCAGAAACTGTAAGACAGG - Intronic
1020542867 7:9482994-9483016 AAATGGACAAATTTTTAGACAGG - Intergenic
1024501834 7:50118268-50118290 GAGTGCAAAACTTTTAACAGTGG - Intronic
1024862714 7:53864177-53864199 AAGATGACAAATTTTAAGACTGG + Intergenic
1027756725 7:82223350-82223372 GGGGAAACAAATTTTAAGACTGG - Intronic
1027861200 7:83584312-83584334 GAGTGCACAACTTTTGAGTCTGG - Intronic
1028683432 7:93565372-93565394 GAGTCCACAAATATCAAAACTGG - Intronic
1029891942 7:103939510-103939532 GAGTGCTCATATTCTAATACTGG - Intronic
1030854940 7:114543905-114543927 GAGGATAAAAATTTTAAGACAGG - Intronic
1030906386 7:115188726-115188748 GAGTGCATAAACTTTAAAAAAGG + Intergenic
1031687348 7:124747574-124747596 GAGTGCAGAACATTTAGGACTGG + Intronic
1035624855 8:1063337-1063359 GAGTGCACACATTTTGACAAGGG + Intergenic
1038964375 8:32555412-32555434 GAGTGCACATTTTTGAACACAGG + Intronic
1040617656 8:49054749-49054771 TAATGCACAAATTTGAAGCCAGG + Intronic
1040754344 8:50753369-50753391 CACAGCACAAATTTTAATACTGG + Intronic
1041854826 8:62439298-62439320 CAGTTTACAAATTTTAAGAGAGG + Intronic
1046863376 8:119119136-119119158 GAGTGCACTAATGTTAAGCCTGG - Intergenic
1050385676 9:5087900-5087922 GAATGCACTAATTTTAACATTGG - Intronic
1051326727 9:15980095-15980117 GAGAGTAAAAATATTAAGACTGG + Intronic
1051621621 9:19055813-19055835 AAGATGACAAATTTTAAGACTGG - Exonic
1054672829 9:67820276-67820298 GAGTGCTCAAATGCTAAGAAAGG + Intergenic
1057018926 9:91680888-91680910 GCGTGAACAGATTTTAAGTCTGG - Intronic
1057538539 9:95941928-95941950 GAGTACAGAAATTTTAAGCATGG + Intronic
1059356130 9:113700909-113700931 GACTGTACAACTTCTAAGACTGG + Intergenic
1059921099 9:119160741-119160763 AAGAGCACAGATTTCAAGACAGG - Intronic
1186963637 X:14763916-14763938 AAGTGCACAACTTTTAATAGGGG + Intergenic
1188374519 X:29411347-29411369 GAGAGCATAAATATTAAGAAAGG + Intronic
1188806082 X:34591919-34591941 GAGTGACCCAATGTTAAGACAGG - Intergenic
1189826897 X:44928142-44928164 GAGTGAAGAAATTTTAATATAGG + Intronic
1192573873 X:72227449-72227471 GAATGCCCAAATTTTTAGAAGGG - Intronic
1193207765 X:78768919-78768941 GAGGGCACAAATTAAATGACAGG - Intergenic
1193290149 X:79762879-79762901 GAGTGCCCAAAGTATAAGAGGGG - Intergenic
1196377675 X:115052399-115052421 GAGTGCAGAATTTGTATGACAGG - Intergenic
1197148116 X:123191022-123191044 GATGGCATAGATTTTAAGACAGG + Intronic
1199553425 X:149080825-149080847 GAGTGCCCAAAGTGTGAGACAGG + Intergenic
1200770118 Y:7116652-7116674 AACTGCACAAATTGTAAAACGGG - Intergenic
1202027351 Y:20538699-20538721 GAGTGCAGTATTTTTAATACTGG - Intergenic