ID: 1081951070

View in Genome Browser
Species Human (GRCh38)
Location 11:47043442-47043464
Sequence CACTGTACCCCTAAGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 106
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 94}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081951070_1081951073 6 Left 1081951070 11:47043442-47043464 CCAACCTCCTTAGGGGTACAGTG 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1081951073 11:47043471-47043493 TGTATGATATCCCTAATATCAGG 0: 1
1: 0
2: 0
3: 23
4: 352
1081951070_1081951074 11 Left 1081951070 11:47043442-47043464 CCAACCTCCTTAGGGGTACAGTG 0: 1
1: 0
2: 0
3: 11
4: 94
Right 1081951074 11:47043476-47043498 GATATCCCTAATATCAGGAATGG 0: 1
1: 0
2: 0
3: 7
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081951070 Original CRISPR CACTGTACCCCTAAGGAGGT TGG (reversed) Intronic
900504086 1:3020585-3020607 CACTTTTTTCCTAAGGAGGTTGG - Intergenic
903261143 1:22132433-22132455 TACTGTACCCATAAGGAGACAGG - Intronic
908340461 1:63173328-63173350 CACAGGCCCCCTAAGGGGGTAGG + Intergenic
910019694 1:82571592-82571614 CACTGTACCCTTACTAAGGTAGG + Intergenic
915514054 1:156402418-156402440 CACTGTGGCCCTGGGGAGGTGGG - Intergenic
920339254 1:205265468-205265490 CACTCTCCCCCTAAGTAGTTGGG + Intronic
1063868060 10:10388635-10388657 CACTATACACCAAAGGAGGTAGG - Intergenic
1063914977 10:10872224-10872246 GATTGTATCCCTAAGGAAGTTGG + Intergenic
1069618742 10:69823349-69823371 CACTGTACCTCTTTAGAGGTGGG + Intronic
1070805233 10:79266951-79266973 CACTGTGTCCAGAAGGAGGTGGG - Intronic
1071524782 10:86352247-86352269 CACTGTAGCCCTAAGAAGGCAGG + Intronic
1072711206 10:97716737-97716759 CTCAGTAACCCTAATGAGGTGGG + Intronic
1073190390 10:101646682-101646704 CACAGTAACCCAAAGGAGGCTGG + Intronic
1073219260 10:101856167-101856189 CCCTGGAGCCCTAAGGAGCTGGG - Intronic
1074953324 10:118362722-118362744 CACAATATCCCTATGGAGGTAGG - Intergenic
1076354117 10:129839959-129839981 CCCTGTGCCCCTAAGGGGGTGGG - Intronic
1076750497 10:132539696-132539718 CACTGTTCACCTAGGGAGGGAGG - Intronic
1078082569 11:8214890-8214912 CACTGTGCCCTTACAGAGGTAGG + Intergenic
1080193793 11:29583410-29583432 TACTGGACTCCTATGGAGGTGGG - Intergenic
1081111353 11:39137817-39137839 CAGTTTACCCCTAAGGAAGGAGG - Intergenic
1081951070 11:47043442-47043464 CACTGTACCCCTAAGGAGGTTGG - Intronic
1084055945 11:66633126-66633148 CACTTTACCTCTGAGGAGCTTGG + Intronic
1084463428 11:69308824-69308846 CACTGTGCACCTAAGGCAGTGGG - Intronic
1085043401 11:73340036-73340058 CACGGTACCCCTATGCAGGTTGG - Intronic
1085502173 11:77034316-77034338 CACCTTACCCCTAAGGAGGAGGG + Intergenic
1088837399 11:113589503-113589525 CACTGAAGCCCTAAGCAGCTGGG + Intergenic
1093964706 12:25312137-25312159 CACTTTACAGCTAAGGAAGTGGG + Intergenic
1094211529 12:27898245-27898267 CACTGTAACTCTGGGGAGGTGGG - Intergenic
1101831821 12:108263783-108263805 CACTGTAACCCCAAGGTGGTGGG + Intergenic
1102546131 12:113657101-113657123 TACAATAGCCCTAAGGAGGTAGG + Intergenic
1102572792 12:113837531-113837553 CACCGTTTCCCTAACGAGGTGGG + Intronic
1106406702 13:29480908-29480930 CACAGTTCCCCTAACGAGGAAGG + Intronic
1107108293 13:36670292-36670314 CAATGTCACCCTGAGGAGGTAGG + Intergenic
1108040444 13:46334915-46334937 CACTGTACCCCAAAGGAAAGTGG + Intergenic
1115761812 14:36583289-36583311 CACTGTAGACCTAAGTAGCTTGG - Intergenic
1120878654 14:89397571-89397593 GACTTTCCCCCTAAGGTGGTAGG - Intronic
1121870228 14:97400524-97400546 CATTCTACCCTTGAGGAGGTAGG + Intergenic
1121882184 14:97510694-97510716 CACTGTTTCCCTAAGGATCTGGG + Intergenic
1122079479 14:99257024-99257046 CACAGCAACCCTAATGAGGTGGG + Intronic
1123923645 15:25088309-25088331 CCCTGAACCCCTAAGGAGGAAGG - Intergenic
1126864083 15:52918803-52918825 CACTGTACCCCTGAAGTGGGAGG + Intergenic
1127931143 15:63598245-63598267 CACAGTATTCCTAAGGAGGGTGG + Intronic
1128668239 15:69554215-69554237 CACTGTACTCCTAGGTAGATCGG + Intergenic
1130428852 15:83826229-83826251 CACTCCACCCCTAAGTAGCTGGG + Intronic
1131375505 15:91919552-91919574 CACTGGGCCCCTACTGAGGTCGG + Intronic
1132454923 16:17114-17136 CACTGTGCCCCTGATGATGTGGG - Intronic
1133279928 16:4659478-4659500 CACCGTACCCCTCAGGAAGCTGG - Intronic
1134915759 16:18069594-18069616 AAGTGTCCCCCTAAGGAGGGGGG + Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138973310 16:62172129-62172151 CAGTGTCTCCCTAAGAAGGTTGG - Intergenic
1141440898 16:84029038-84029060 CCCTGTACCCCTCAGGAGGCAGG + Intronic
1147041429 17:37722364-37722386 CATTGCACCCCTAAGGGGATAGG + Intronic
1147641312 17:42002445-42002467 GACACTACCCCTATGGAGGTCGG + Intronic
1149857294 17:60093995-60094017 CACTGTACTCCTAAAGAGAGTGG + Intergenic
1150308795 17:64110084-64110106 CACTGTACATCTAAGTGGGTGGG + Intronic
1150628666 17:66860273-66860295 CACTTTACAGATAAGGAGGTTGG - Intronic
1150661230 17:67081480-67081502 CACTGTACCCTTAAAGATGGTGG - Intronic
1154387596 18:13909480-13909502 CACTCCACCCTCAAGGAGGTGGG - Intronic
1155324242 18:24650165-24650187 CACTGGACCCATCGGGAGGTTGG + Intergenic
1158911396 18:62066333-62066355 CACTGTGGCCCTAAGGAGATTGG - Intronic
1162057373 19:8072658-8072680 CACTGTGCCCCCAGGGATGTGGG + Intronic
1164680081 19:30128382-30128404 CCCTGTGCCCCTAAGTGGGTCGG + Intergenic
1165307922 19:35013536-35013558 CACAGGACCCCCAAGGAAGTGGG + Exonic
928270115 2:29848182-29848204 CACTGTACTGCTTAGGTGGTTGG - Intronic
932259922 2:70318441-70318463 CACCGAACACCAAAGGAGGTGGG + Intergenic
933752180 2:85609984-85610006 CACTGGACCCATAAGAAGATTGG - Intronic
936933850 2:117818816-117818838 AAATGTACCCATAAGGTGGTTGG - Intronic
938422719 2:131157020-131157042 CACAGCACCCCTGGGGAGGTTGG + Intronic
944677555 2:202046965-202046987 CACAGATTCCCTAAGGAGGTTGG + Intergenic
948184117 2:236005952-236005974 CACTGTGCACTTAAGGAGTTGGG + Intronic
948664950 2:239528937-239528959 CATTGTACTCCTGAGGAGGGAGG + Intergenic
1171113208 20:22502704-22502726 CACTCTAACCATAAGGAGTTGGG + Intergenic
1172003349 20:31799096-31799118 CACTGTAACTCCAAGGAGTTTGG - Intronic
1176386142 21:6139354-6139376 CACTTCACCCCAAATGAGGTAGG + Intergenic
1178097569 21:29232379-29232401 CACTGTCTCCCTAAGCAGGGAGG - Intronic
1178494895 21:33078221-33078243 CATTTAACCCCCAAGGAGGTGGG - Intergenic
1179737331 21:43398898-43398920 CACTTCACCCCAAATGAGGTAGG - Intergenic
1179995723 21:44973279-44973301 AGCTGAACCCCTGAGGAGGTGGG - Intronic
1183969163 22:41463246-41463268 CATTGCACCCCTAAGGAGAAAGG - Intronic
954673184 3:52301478-52301500 CCCAGTACCCCCAAGTAGGTTGG + Intergenic
960244911 3:115389557-115389579 CTCTCTTTCCCTAAGGAGGTAGG + Intergenic
962074461 3:132066739-132066761 CACTGTACCCCGAATCCGGTGGG + Intronic
962747237 3:138405997-138406019 GACTGTAACCCTAAGGATGGGGG - Intergenic
963007619 3:140740754-140740776 CACTGTTCCCCTAATGTGTTAGG - Intergenic
971384160 4:26127806-26127828 CATTGTGGCCCTAAAGAGGTTGG + Intergenic
978463757 4:108985423-108985445 CACTGTCTCCCTAAGTAGATTGG + Intronic
978895359 4:113880208-113880230 CACTGTAGCCTTTAGGAGGTGGG - Intergenic
981532534 4:145765902-145765924 CCCAGTACCACAAAGGAGGTAGG - Intronic
988508358 5:31843770-31843792 CACTTTAACCCCAAGGAGGGTGG - Intronic
990773623 5:59279908-59279930 CACTGTACAACTAAAGAGGATGG - Intronic
999712503 5:154331174-154331196 TACTGTATGCCTAAGGAGCTGGG - Intronic
999720716 5:154397460-154397482 CACCACAACCCTAAGGAGGTAGG + Intronic
1005963834 6:30712456-30712478 CACTGTCCCCAAAAGGAGGTTGG + Exonic
1017825731 6:158080718-158080740 CTCAGTACCACCAAGGAGGTGGG - Intronic
1023102542 7:36733760-36733782 CAATGTACCTCTTAGGAGATAGG - Intergenic
1027373103 7:77528049-77528071 AACTCTACCCTTAAGTAGGTAGG - Intergenic
1027450415 7:78325180-78325202 CACTGTACCCCTAAGAGTATAGG + Intronic
1030020371 7:105269497-105269519 TACTGTACTGCTAAGGAGGAGGG - Intronic
1039288371 8:36067331-36067353 CACTGAACAGCAAAGGAGGTTGG + Intergenic
1041859531 8:62496893-62496915 CACTGCACCAGTAAGGAGGCAGG - Intronic
1047224939 8:122948134-122948156 CACCGAGCCCCTAAGCAGGTGGG + Intronic
1049884345 9:17542-17564 CACTGTGCCCCTGATGATGTGGG - Intergenic
1061376844 9:130231233-130231255 CTCAGCACCCCTAAGTAGGTGGG - Intronic
1061492316 9:130952545-130952567 GTCTGTACCCCTGAGGACGTGGG + Intergenic
1198068702 X:133126467-133126489 CACTTGAGCCCTGAGGAGGTTGG + Intergenic
1200729385 Y:6716852-6716874 TACTGTTCCCACAAGGAGGTGGG - Intergenic