ID: 1081952543

View in Genome Browser
Species Human (GRCh38)
Location 11:47057453-47057475
Sequence CTGTGAAGAAGTATCTACTA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 156
Summary {0: 1, 1: 0, 2: 2, 3: 5, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081952543 Original CRISPR CTGTGAAGAAGTATCTACTA AGG Intronic
900750440 1:4393199-4393221 CTGTGGTGAAGTATCTGTTAAGG - Intergenic
901317723 1:8320128-8320150 CTCAGAAGAAGTCTTTACTAAGG - Intronic
902585588 1:17437532-17437554 AAGTGAAGAAGCATCTCCTAGGG - Intronic
903569868 1:24296379-24296401 TTGTGAAAAAAAATCTACTATGG + Intergenic
908222809 1:62025261-62025283 CTCTGAACAAGTCTCTACTGAGG + Intronic
909385547 1:75051686-75051708 CTGTGAAGCAGAAAATACTATGG + Intergenic
909667848 1:78155349-78155371 CTGTGAAGAAGTGACTGCTATGG + Intergenic
910582366 1:88842684-88842706 GTGTAAAGAAGTAACTACTTTGG + Intergenic
911412557 1:97528124-97528146 CTTTGAAGAAATATCTATTGAGG + Intronic
911552269 1:99297639-99297661 TTGTGTATAATTATCTACTAGGG - Intronic
913140178 1:115933365-115933387 CTGTGAAGAAGCATCCAATAAGG - Intergenic
918279861 1:182993910-182993932 CTGTGAAGAAGCTTCTTCCAAGG - Intergenic
921201844 1:212814350-212814372 CTATCAATAAGTATCTACTCAGG - Intronic
923181453 1:231523869-231523891 CTGGGAAGAAGTGGCTACTGAGG + Intergenic
923864994 1:237930247-237930269 CTGAAAAGCAGTATCTACAATGG - Intergenic
1067518972 10:46980545-46980567 CTATGAAGCAGTCTCTACCAAGG - Intronic
1067643274 10:48071289-48071311 CTATGAAGCAGTCTCTACCAAGG + Intergenic
1068174247 10:53437487-53437509 CTTTGAAGTAGAATCTATTATGG + Intergenic
1068363933 10:56019065-56019087 CTTTGAAGAAATATCTATTCAGG - Intergenic
1068640526 10:59400178-59400200 TTGTGATGAAGTATTTGCTAGGG + Intergenic
1069779975 10:70949114-70949136 ATGTGAAGATGTATCCACTTTGG - Intergenic
1072314707 10:94190734-94190756 TTGTGAAGAAATATCTAGTTTGG + Intronic
1074091769 10:110266440-110266462 CTATGAAGGAGTGTCTACAATGG + Intronic
1080972343 11:37293445-37293467 CTGTGAACAACACTCTACTATGG + Intergenic
1081579691 11:44343715-44343737 CTATGAAGCAGGTTCTACTATGG + Intergenic
1081952543 11:47057453-47057475 CTGTGAAGAAGTATCTACTAAGG + Intronic
1090646697 11:128772235-128772257 CTGTGTAGAAATTTCTACCAGGG - Intronic
1093166271 12:15807526-15807548 CTGAGAAGCAGCAGCTACTAGGG + Intronic
1093957397 12:25236554-25236576 CTGTGCTGAAATATCTAGTATGG + Intronic
1095513287 12:42977205-42977227 CTTTGAAGAAATTTATACTAGGG - Intergenic
1098225910 12:68323580-68323602 ATGTGAAGAATTTTCTATTAAGG - Intronic
1098676705 12:73298544-73298566 ATGTGAAGAAAAATCTACTGAGG + Intergenic
1107099130 13:36569992-36570014 CTTTGAAGAAATGTCTACTTAGG - Intergenic
1108819568 13:54331569-54331591 CTTTGGTGAAGTATCTGCTAAGG - Intergenic
1109156525 13:58917478-58917500 CTCTGAAGAAATATCTATTCAGG - Intergenic
1109170512 13:59091109-59091131 ATGTGAAGAAATATCTTCGAAGG + Intergenic
1109660251 13:65448689-65448711 CTTTGAAGAAATGTCTACTCAGG - Intergenic
1112069779 13:95836663-95836685 GTGTGAAGTATTACCTACTAAGG - Intronic
1112329217 13:98464061-98464083 CTGTGAAAATGTATTTATTAGGG - Intronic
1120096977 14:80400284-80400306 CTGTCAACAAGCATGTACTATGG + Intergenic
1120402606 14:84051051-84051073 CTTTGAAGAAGCATTTCCTAAGG + Intergenic
1124313258 15:28647024-28647046 CTGAAAAGAATTATCTAGTAAGG + Intergenic
1125263460 15:37853056-37853078 CTGTGAAGAAGTAACAACCTAGG + Intergenic
1125384723 15:39125013-39125035 CTGTGAAGAAGTAGAGTCTATGG - Intergenic
1130277424 15:82488620-82488642 CTGGGAAGAAATTTCTAGTAGGG + Intergenic
1130469744 15:84215810-84215832 CTGGGAAGAAATTTCTAGTAGGG + Intergenic
1130477232 15:84330372-84330394 CTGGGAAGAAATTTCTAGTAGGG + Intergenic
1130494533 15:84457758-84457780 CTGGGAAGAAATTTCTAGTAGGG - Intergenic
1130592033 15:85220433-85220455 CTGGGAAGAAATTTCTAGTAGGG + Intergenic
1136881078 16:33902378-33902400 CTGGGAAGCAGTAACTGCTAGGG + Intergenic
1138786085 16:59848233-59848255 CTGTGAATAAGTTCCTTCTATGG - Intergenic
1139106415 16:63831905-63831927 CTGTAAAGAAATATCTGATATGG - Intergenic
1139395873 16:66638373-66638395 CTGTGTAGAAGTATTGACAATGG - Intronic
1140073388 16:71673263-71673285 CTGTTCAGTAGTATCTGCTAAGG - Intronic
1140281162 16:73556568-73556590 CTCTGAAGAAAAATCTACTGGGG + Intergenic
1141781602 16:86165772-86165794 CAGTGAAGAAGTCACTACTGGGG + Intergenic
1144767552 17:17740848-17740870 CTCTGAGGAAGTATCTGCTTTGG - Intronic
1146557415 17:33838139-33838161 TAGTGAAGAAGTTTCTACTCTGG - Intronic
1147127096 17:38378561-38378583 CTGTTAGGAAGTATCTGCTGTGG + Intronic
1148677649 17:49454401-49454423 CTGTTAAGAAGTCCCTCCTAGGG + Intronic
1149264858 17:54916942-54916964 CAGTGAAGCAGTATCTTCAAAGG - Intronic
1157590039 18:48830947-48830969 CAGTCAATAAGTATCTACTGAGG - Intronic
1159749970 18:72287934-72287956 ATGTGAAGAGGTATCCTCTATGG - Intergenic
1163978845 19:20879143-20879165 CAGTGAACAAGTTTCTACTGTGG - Intergenic
1163980904 19:20899138-20899160 CAGTGAACATGTATCTACTGTGG - Intergenic
1167400605 19:49265844-49265866 CTTTGGAGAAATATCTACTCAGG - Intergenic
1168460788 19:56555470-56555492 ATGTGAAGAACTAACTAATAAGG - Exonic
925630574 2:5888808-5888830 CTGTGAAGAAGGATCTGCCCAGG + Intergenic
925856800 2:8136871-8136893 CTAATAAGAAGTATCTCCTAGGG + Intergenic
929336622 2:40755565-40755587 CTGTGAATAAGAAACTACCAAGG - Intergenic
929442577 2:41976313-41976335 CTGTTTGGCAGTATCTACTAAGG + Intergenic
930092742 2:47543153-47543175 CTGTGAATAAGGAGCTACCAGGG + Intronic
930352244 2:50271877-50271899 CTATGAAGAAGTATTTCCTATGG + Intronic
930880568 2:56265428-56265450 TTGTTATGAAGTATCTACTCAGG - Intronic
932971418 2:76547903-76547925 CTGTGTAGAATTATCTAAGAAGG - Intergenic
934110498 2:88737956-88737978 CTGTGGAAAATTATCTTCTAGGG + Exonic
939453876 2:142408181-142408203 CTGTGAAGGATAATCTATTAAGG + Intergenic
941343905 2:164343702-164343724 ATGTGAATAACTATCTACTAAGG - Intergenic
941390019 2:164900599-164900621 CTTTGGAGAAATATCTGCTAAGG + Intronic
943168186 2:184359984-184360006 CTGTGAAAAATGATCTATTAGGG + Intergenic
943301235 2:186203985-186204007 CTGTGAAGAAATATTTTATAGGG - Intergenic
943973232 2:194438210-194438232 CTTTGAAGAAATATCTATTCAGG + Intergenic
945510509 2:210695915-210695937 CTGTTTGGAAGCATCTACTAAGG - Intergenic
945715384 2:213352076-213352098 CTCTGAAGAGGTTTCTACCATGG + Intronic
1169511817 20:6272797-6272819 CCTTTAAGAACTATCTACTATGG - Intergenic
1175643108 20:60648384-60648406 CTGTGAAGTATTTTCTAATAGGG + Intergenic
1176522401 21:7834233-7834255 CCGTGAAGAAGTGTCTAGAAGGG - Intergenic
1178656421 21:34464245-34464267 CCGTGAAGAAGTGTCTAGAAGGG - Intergenic
1182156708 22:28080483-28080505 CTTTGAAGAAATGTCTACTTAGG + Intronic
1182651910 22:31858921-31858943 CTGAGAAGAAGTATCAGCCAAGG + Intronic
1183283782 22:36950031-36950053 CTTTGATGAAGTGTCTACTCTGG + Intergenic
952535210 3:34302195-34302217 CAGTTTAGTAGTATCTACTAAGG - Intergenic
956309618 3:67864595-67864617 CTGTTAAGAAATATATACAATGG - Intergenic
957412407 3:79858777-79858799 GTGTGAAGAAGTTTGTATTATGG + Intergenic
960088972 3:113619595-113619617 CTGTGTAGAAGTATCAACTATGG - Intronic
963497755 3:146089023-146089045 ATGTGAAGAAGTTTCTGCAAGGG - Intronic
964655474 3:159062026-159062048 CTGTGAAGACCTCTCTCCTATGG + Intronic
964709436 3:159656124-159656146 CTGGTAAGAAGAATCTTCTATGG + Intronic
965019256 3:163206132-163206154 CTGCCAAGATGTATCTATTAAGG - Intergenic
965526414 3:169723889-169723911 CTTTGATGAAGTGTCTATTAAGG - Intergenic
965638590 3:170809619-170809641 CAGAGAAGGAGTATCTTCTAGGG - Intronic
966450637 3:180056426-180056448 CTGTGAACAAGAATAAACTAAGG - Intergenic
967504243 3:190235700-190235722 CTGTGGAGTAGGATCCACTATGG + Intergenic
969209839 4:5678313-5678335 ATGTGAAGTATTATCTACCAGGG - Intronic
970373498 4:15432977-15432999 CTGTGAAGAAGAATGTGGTAAGG - Intronic
972764326 4:42137796-42137818 CTTTGGAGAAGTATCTATTCAGG - Intronic
972921902 4:43953230-43953252 CAGTGAAAAAGTATCTAAAATGG - Intergenic
973048173 4:45562298-45562320 CTGTGAGGAGTTATCTCCTAGGG + Intergenic
975388810 4:73792150-73792172 CTGTGAGGAAGGATCAATTAGGG - Intergenic
975841190 4:78475753-78475775 CTGTGAAGAACAAAGTACTATGG - Intronic
978383742 4:108159029-108159051 CAATGAAGAAGAAACTACTAGGG + Intronic
980413509 4:132454893-132454915 CTCAGAAGCAGTTTCTACTAAGG - Intergenic
982100659 4:151964522-151964544 CTGTTAAGAATTCTCTGCTAGGG - Intergenic
988299976 5:29410648-29410670 CTTTTAAGAAATATCTACCAAGG - Intergenic
992928026 5:81610523-81610545 CTGATAAGAACTATCTACTGTGG + Intronic
995026258 5:107426673-107426695 TTGTGAAGAAGTGTCTAGAAGGG - Intronic
1002122193 5:177013853-177013875 TTGTGAAGTGGTATCTACCAGGG + Intronic
1002337545 5:178490372-178490394 CTGAGAAGAGGTATCTAGAATGG + Intronic
1003050378 6:2775408-2775430 CTGTGTAGAAGTTTCAACCAGGG - Intronic
1006008060 6:31018857-31018879 CTGAGAAGGAGCATCCACTAAGG - Intronic
1006248952 6:32764440-32764462 CTGTGAAGAAGAATTTCCTGGGG + Intergenic
1007006950 6:38373104-38373126 TTGTGAATATGTATCTACCAAGG - Intronic
1007815718 6:44523848-44523870 CTTTGGAGAAGTATCTATTCAGG + Intergenic
1007991203 6:46257952-46257974 CTTTGAAGAAACAGCTACTAGGG + Intronic
1010582917 6:77621596-77621618 CTTTGAAGAAATATCTCCTCAGG + Intergenic
1011704743 6:89989637-89989659 CCATCAAGAAGCATCTACTAAGG + Intronic
1015301857 6:131661695-131661717 CTTTGAAGAAATATCTATTTAGG + Intronic
1016028181 6:139310322-139310344 CTGTGGAGAAATATCTGCTCAGG - Intergenic
1020838625 7:13185911-13185933 CTTTGAAAAAGTGTCTACTCAGG - Intergenic
1026422292 7:70252398-70252420 CTTTGGAGAAGTATCTATTTAGG + Intronic
1026685638 7:72507147-72507169 CTTTGAAGTATTATCTAATAGGG - Intergenic
1027933143 7:84566065-84566087 TGATGAAGAAGTATCTACTCTGG - Intergenic
1028882767 7:95898514-95898536 CTGTGAGCAAGTATCTACTAGGG - Intronic
1029640938 7:101818498-101818520 CCCTGAAGAAGTAGCTAATATGG - Intronic
1030986883 7:116251966-116251988 CTGTGACGAGGTATGTTCTATGG + Exonic
1034933056 7:155179138-155179160 TTGTTTAGCAGTATCTACTAAGG + Intergenic
1045521647 8:102908247-102908269 CTTTGAAGAAATATCTATTCAGG - Intronic
1046154969 8:110276258-110276280 CTGTGAAATAGTATGCACTATGG + Intergenic
1048035320 8:130672465-130672487 CTCGGAAGAAATATCTACTAAGG - Intergenic
1050139104 9:2498845-2498867 CTGTCTAGCAGTATTTACTAGGG - Intergenic
1052132352 9:24863938-24863960 CTCTCAAGAAATATCTACTCTGG + Intergenic
1052792677 9:32890380-32890402 CTGTGCAGAAATGTCTACTCTGG + Intergenic
1056365164 9:85897538-85897560 CTGGGGAGAGGTATCTCCTAGGG + Intergenic
1056636029 9:88331974-88331996 CTGTGAATAAATCTCTTCTAAGG - Intergenic
1058489681 9:105483725-105483747 CTGTGAAAAAGTATATGCCATGG - Intronic
1185921438 X:4097254-4097276 CTATAAAGTAGTATCTAATACGG - Intergenic
1186346838 X:8702618-8702640 CTGAGAAGAAGTAAATATTAGGG + Intronic
1188854665 X:35178492-35178514 CTGAGAATAAATAACTACTATGG - Intergenic
1190707920 X:53046201-53046223 CTGTTTAGCAATATCTACTAAGG - Intergenic
1195863346 X:109404331-109404353 CTCTGAAGAGGAATCTTCTATGG - Exonic
1196989607 X:121313593-121313615 CTGTAATGAAGTCTCTACTGGGG + Intergenic
1197068895 X:122269433-122269455 CTCAGGAGAAGTATTTACTAAGG + Intergenic
1198806164 X:140497279-140497301 CTGGGAAAAAGTGTCTACTCAGG + Intergenic
1198869976 X:141167809-141167831 TTGCTAAGAAATATCTACTAAGG + Intergenic
1199728210 X:150605614-150605636 CTGTGAAGAACTATATAATGTGG + Intronic
1201675701 Y:16581315-16581337 CTGTGAAGAAATGTCTGCTGTGG + Intergenic