ID: 1081957793

View in Genome Browser
Species Human (GRCh38)
Location 11:47108672-47108694
Sequence CTGAACTGTCCCACCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081957793_1081957795 14 Left 1081957793 11:47108672-47108694 CCCACAAGGGTGGGACAGTTCAG 0: 1
1: 0
2: 2
3: 8
4: 123
Right 1081957795 11:47108709-47108731 TTTTTTTTTTTTTTTTGAGATGG 0: 83672
1: 60776
2: 74199
3: 114646
4: 163091

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081957793 Original CRISPR CTGAACTGTCCCACCCTTGT GGG (reversed) Intronic
901586138 1:10294632-10294654 CTCAACTGACCCACCCTCCTTGG - Intronic
902546452 1:17193526-17193548 CTCAACTGTCCCTTCCTTGTGGG + Intergenic
905874534 1:41423643-41423665 CTGAGCTGACCACCCCTTGTCGG - Intergenic
906026179 1:42676129-42676151 CTGACCTGTTCTACCCTTTTGGG + Intronic
910692071 1:89975165-89975187 CTGAACTGCCCAGCCCTTCTAGG - Intergenic
912342614 1:108932037-108932059 CTCAAGTGACCCGCCCTTGTCGG - Exonic
916472844 1:165140779-165140801 CTGTGCTGTCCCACCCTCCTAGG + Intergenic
917821627 1:178769190-178769212 CTGACCTGCCCCACCCTTCCTGG - Intronic
919344316 1:196355278-196355300 CAGAACTGCCCCAACATTGTAGG + Intronic
920543287 1:206795172-206795194 CTGAACTGTACCAGCCTTGGTGG - Intergenic
1064119469 10:12606270-12606292 CTGAACTGTCTGTCCCTAGTAGG - Intronic
1072867154 10:99075624-99075646 CTGAAGTGTCCCACTATTATAGG + Intronic
1074711281 10:116179770-116179792 GTGAACTGTCCCATTCTTGAAGG + Intronic
1079258426 11:18853047-18853069 CTGAGCTATCCCACCCTTCCTGG + Intergenic
1081957793 11:47108672-47108694 CTGAACTGTCCCACCCTTGTGGG - Intronic
1084811261 11:71613106-71613128 CTTAACTGGCCAACCCTGGTGGG - Intergenic
1085756115 11:79202623-79202645 CTGGACTGTCCCAACCTGGCAGG - Intronic
1087132456 11:94679910-94679932 CAGAACTCTCCCACCCTGGATGG + Intergenic
1089620150 11:119717500-119717522 CTGAACTGTCCCAATCTCATTGG - Intronic
1092342707 12:7690232-7690254 CTGATCAGTGCCACCCTTCTCGG - Exonic
1094739991 12:33277854-33277876 CAGTACTGTTACACCCTTGTAGG + Intergenic
1095400947 12:41814214-41814236 CTGAGCTGCCCCACCCTTCCTGG - Intergenic
1096844064 12:54395798-54395820 CTGGACAGCCCCACCCTGGTGGG - Exonic
1100931952 12:99619509-99619531 CTGAACCTTCCCACCCTTCCTGG + Intronic
1104878912 12:132055770-132055792 GTGAACTGTCCCCTCCCTGTAGG + Intronic
1106026528 13:25960576-25960598 CTCAGGTGGCCCACCCTTGTAGG + Intronic
1108117383 13:47144446-47144468 CTGCACTGTCCCATCATAGTGGG - Intergenic
1110993118 13:82069302-82069324 CTGAGCTGCCCCACCCTTCCTGG - Intergenic
1111468418 13:88646329-88646351 CTGAACTTTGCCAACATTGTAGG + Intergenic
1116365244 14:44052942-44052964 CTGTACTGTCCCACTCTATTTGG - Intergenic
1117370850 14:55077172-55077194 CTAAACTGTAACACTCTTGTAGG - Intergenic
1119988750 14:79170842-79170864 CTGAACTGACCCAACCTCATGGG + Intronic
1121422151 14:93823778-93823800 GTGAACTGTCCCACTCAGGTTGG + Intergenic
1125130512 15:36279090-36279112 CCGAACTGCCCCACTCTTCTTGG - Intergenic
1125130590 15:36279524-36279546 CTGAGCTGCCCCACCCTTGATGG - Intergenic
1130552927 15:84903510-84903532 CTGAATTCTCCCACCCTTCAGGG + Intronic
1132982364 16:2745022-2745044 CTTACCTGTCCCACCCCAGTGGG - Intergenic
1133583175 16:7166245-7166267 CTCAAGTGATCCACCCTTGTCGG + Intronic
1134204373 16:12224980-12225002 ATCAACTATCCCACCCTTGCTGG - Intronic
1134318965 16:13145289-13145311 CTGAACTGATCCACCCATCTCGG - Intronic
1139184913 16:64794560-64794582 CTGGATTCTCCCACGCTTGTAGG + Intergenic
1139342553 16:66277979-66278001 CTGAGCTGCCCCACCCTTCTTGG + Intergenic
1143051126 17:4126730-4126752 CTGAAGTGATCCACCCTTTTGGG - Intronic
1143592725 17:7895240-7895262 CTGCACTCCCCCACCCTTGTGGG + Intronic
1148807967 17:50273677-50273699 CTGCTCTGTCCCTCCCTTTTTGG + Intronic
1150297014 17:64016511-64016533 CTTAACTCTCCCACACTTCTGGG - Intronic
1151397655 17:73834763-73834785 CTGAACTCTCCCTGCCTTGCTGG + Intergenic
1152142389 17:78544433-78544455 CTACCCTTTCCCACCCTTGTCGG - Intronic
1156927294 18:42597128-42597150 CTGAGCTGCCCCACCCTTCATGG - Intergenic
1157058826 18:44262525-44262547 ATTTACTGTCCCACCCTTATTGG + Intergenic
1163131420 19:15275771-15275793 CTCAAGTGACCCACCCTTCTTGG - Intronic
1164859160 19:31549024-31549046 CTGATATGCCCCACTCTTGTGGG - Intergenic
1167097761 19:47383895-47383917 CTCAACTGATCCACCCTTATCGG - Intergenic
927238812 2:20902069-20902091 CTAATCTGTACCACCCTTGAGGG - Intergenic
934619742 2:95796928-95796950 CTGAACTGTCCCTCCCTCTGGGG + Intergenic
934641146 2:96027629-96027651 CTGAACTGTCCCTCCCTCTGGGG - Intronic
946497022 2:220205148-220205170 CTGGCCTGTCTCACCCTTGCAGG - Intergenic
947845720 2:233242141-233242163 CTGGACTGTCCCACACTTCCAGG + Intronic
948960048 2:241327815-241327837 CTGAAGTGATCCACCCATGTTGG - Intronic
1169671317 20:8106002-8106024 CTGAGTTGCCCCACCCTTCTTGG + Intergenic
1172214327 20:33224309-33224331 CTGAAGTCCCTCACCCTTGTGGG + Intronic
1176127881 20:63484086-63484108 CTGCACGGTCCCACCCTTGCAGG + Intergenic
1178366905 21:31995940-31995962 CAGAGCTGACCCACCTTTGTCGG - Exonic
949402354 3:3678982-3679004 CTGTCCTCTCCCACCTTTGTGGG - Intergenic
956647796 3:71473909-71473931 GTGACATGTCCCACCCATGTAGG - Intronic
956856665 3:73281756-73281778 ATGAACTGTTTCACCATTGTTGG + Intergenic
967215015 3:187202333-187202355 CTGAGCTCTGCCACCCTTGCTGG + Intergenic
970311537 4:14787546-14787568 CTGAACTGCTCCACCCTTAATGG + Intergenic
971950025 4:33332719-33332741 CTGAGCTGTCCCATCCTTCCAGG + Intergenic
976056856 4:81079282-81079304 CTCAAGTGTTCCACCCTTCTTGG - Intergenic
976712493 4:88087248-88087270 TAGCAGTGTCCCACCCTTGTGGG - Intergenic
982270954 4:153587556-153587578 CTGAACTGTCTCTCCCTAGGAGG - Intronic
983052346 4:163063062-163063084 CTGGACTGTACCACATTTGTAGG - Intergenic
987535689 5:19184690-19184712 CTGAACTTTCCCTCCCTTACAGG - Intergenic
987669648 5:20990434-20990456 CTGAGCTGTCCCACCCTTCCTGG + Intergenic
987669725 5:20990911-20990933 CTGAACCTCCCCACCCTTCTTGG + Intergenic
987709651 5:21491631-21491653 CTGATGTTTCCCACCCTTGGTGG + Intergenic
988067250 5:26237139-26237161 CTGGACTCTCCCAGCCTTTTTGG + Intergenic
988576861 5:32434567-32434589 CACTACTGTACCACCCTTGTAGG + Intronic
988749962 5:34182535-34182557 CTGATGTTTCCCACCCTTGGCGG - Intergenic
991268587 5:64751582-64751604 CAGGACTGTCCTACCATTGTAGG + Intronic
991738220 5:69645747-69645769 CTGATGTTTCCCACCCTTGGTGG - Intergenic
991759974 5:69910675-69910697 CTGATGTTTCCCACCCTTGGTGG + Intergenic
991787358 5:70207423-70207445 CTGATGTTTCCCACCCTTGGTGG - Intergenic
991789796 5:70225473-70225495 CTGATGTTTCCCACCCTTGGTGG - Intergenic
991814545 5:70500582-70500604 CTGATGTTTCCCACCCTTGGTGG - Intergenic
991817680 5:70521866-70521888 CTGATGTTTCCCACCCTTGGTGG - Intergenic
991839204 5:70785738-70785760 CTGATGTTTCCCACCCTTGGTGG + Intergenic
991879804 5:71207808-71207830 CTGATGTTTCCCACCCTTGGTGG - Intergenic
991882244 5:71225832-71225854 CTGATGTTTCCCACCCTTGGTGG - Intergenic
993382448 5:87223192-87223214 CTTAACTTTCCCAGCTTTGTAGG - Intergenic
993628466 5:90254682-90254704 CTCAACTCTTCCACCCTTTTTGG + Intergenic
994421777 5:99532929-99532951 CTGATGTTTCCCACCCTTGGTGG + Intergenic
994461066 5:100067632-100067654 CTGATGTTTCCCACCCTTGGTGG - Intergenic
999266350 5:150269349-150269371 CTGTCCTGTCCCACCCTGCTGGG - Intronic
1001046749 5:168379355-168379377 CTGAACTGTCACACCCTGAGGGG - Intronic
1002531953 5:179852441-179852463 AGGAACTGGCCCAACCTTGTTGG - Intronic
1003593266 6:7453362-7453384 CTTAACTGGCCCACTCTTGATGG + Intergenic
1005548025 6:26888875-26888897 CTGATGTTTCCCACCCTTGGTGG - Intergenic
1006115952 6:31776350-31776372 CGGGACTGTCCCTCCTTTGTGGG - Intronic
1009018784 6:57929969-57929991 CTGATGTTTCCCACCCTTGGTGG - Intergenic
1010988989 6:82458394-82458416 CTGAGCTGCCCCACCCTTCCTGG - Intergenic
1013029832 6:106322634-106322656 CTCAACAGTCCCACCCTGGGAGG + Intronic
1017318474 6:153060347-153060369 CTAAACAGTCTCACCCTTTTTGG + Intronic
1017609741 6:156172863-156172885 CTGATTTGGCCCACCCTTGGTGG + Intergenic
1017783193 6:157732676-157732698 CTGAACTTTCCTACCCTTTGTGG + Intronic
1020070329 7:5223190-5223212 CAGGACTGTCCCTCCCTCGTCGG + Intronic
1022662396 7:32379189-32379211 CTGTACTGTGACACCCTTGAGGG + Intergenic
1025731621 7:64113385-64113407 CTGATATTTCCCACCCTTGGTGG + Intronic
1027634670 7:80656060-80656082 CTGAAGTGTCCAACTCTTGAAGG + Intronic
1028304535 7:89246742-89246764 CTGAACTGTCCCACCCTTTATGG + Intronic
1035694230 8:1582829-1582851 CTGAAATGGCCCACCCTCCTCGG + Intronic
1037037702 8:14188531-14188553 CAGACCTGTCCCACCCCTCTAGG - Intronic
1038778328 8:30550510-30550532 CTTAACTGTCACGGCCTTGTGGG - Intronic
1040011988 8:42669181-42669203 CTGAACTATCTCACCTCTGTGGG + Intergenic
1048216074 8:132496495-132496517 CTTAACTGCCCCACCCCTGGTGG - Intergenic
1048366603 8:133743915-133743937 CTGGACTCTCCCAGCCATGTTGG - Intergenic
1048605221 8:135961347-135961369 CTCACCAGGCCCACCCTTGTGGG - Intergenic
1050663807 9:7912747-7912769 TTGATCTGTCACACCCTTGGGGG - Intergenic
1051216965 9:14808391-14808413 ATAAACTGTCAGACCCTTGTTGG - Intronic
1051920355 9:22257397-22257419 CTGAACTGCCTCACCCTTCCTGG - Intergenic
1052063728 9:23991836-23991858 CTGCTTTGGCCCACCCTTGTGGG - Intergenic
1056081262 9:83096415-83096437 CTGAACAGACCCACCTTTGCTGG + Intergenic
1058639669 9:107070725-107070747 CTGGACTGTGCCACCCTTTGTGG - Intergenic
1061798771 9:133103160-133103182 TTGAAATGTCCTACCCTGGTGGG + Intronic
1203689009 Un_GL000214v1:24641-24663 CTCAAGTGTCCCACCCGTCTTGG + Intergenic
1203647266 Un_KI270751v1:79412-79434 CTCAAGTGTCCCACCCGTCTTGG - Intergenic
1187238927 X:17494947-17494969 CTGAACTGACCCAACCTTGTTGG - Intronic
1189587681 X:42477562-42477584 TTGAACTGTCTCATCCCTGTGGG + Intergenic
1189885808 X:45543383-45543405 AGGAATTGTCCCACCCTTGAGGG + Intergenic
1189957076 X:46286940-46286962 TTGAGATGTCCCACCTTTGTGGG - Intergenic
1192761992 X:74103836-74103858 CTGAGCTGTCCCACCCTTCATGG + Intergenic
1196709617 X:118749147-118749169 CTCAAATGATCCACCCTTGTTGG + Intronic
1199855978 X:151759137-151759159 TGGAAGTGTCCCACCCTTGCCGG + Intergenic