ID: 1081960558

View in Genome Browser
Species Human (GRCh38)
Location 11:47133519-47133541
Sequence GGGCTGGGGGACCACTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 424
Summary {0: 1, 1: 0, 2: 2, 3: 39, 4: 382}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081960558_1081960564 -5 Left 1081960558 11:47133519-47133541 CCAGCACAGTGGTCCCCCAGCCC 0: 1
1: 0
2: 2
3: 39
4: 382
Right 1081960564 11:47133537-47133559 AGCCCATGCCCTCTGGCCTGAGG 0: 1
1: 0
2: 4
3: 47
4: 429
1081960558_1081960569 7 Left 1081960558 11:47133519-47133541 CCAGCACAGTGGTCCCCCAGCCC 0: 1
1: 0
2: 2
3: 39
4: 382
Right 1081960569 11:47133549-47133571 CTGGCCTGAGGCTGCTGTGCTGG 0: 1
1: 0
2: 8
3: 68
4: 512

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081960558 Original CRISPR GGGCTGGGGGACCACTGTGC TGG (reversed) Intronic
900291473 1:1925489-1925511 TGGGTGGGGGAGCTCTGTGCAGG + Intronic
900714194 1:4133526-4133548 CGGCTGGGGGAGGACTCTGCAGG - Intergenic
901917577 1:12511720-12511742 GGGCTGGGGAAGCACTGGCCTGG - Exonic
902785960 1:18732917-18732939 GGGCTGGGAGACTACTGGGAGGG - Intronic
902865399 1:19274408-19274430 GGGATGGGGGACGACGGGGCAGG - Intergenic
903542337 1:24103803-24103825 GGGCGGGGGGAGATCTGTGCAGG - Intronic
904008137 1:27374411-27374433 GGGCAGGAGGACAACTTTGCTGG + Exonic
904075518 1:27839038-27839060 GGGTTTGGGGAGCACTGTCCTGG + Intronic
904080158 1:27867262-27867284 GGGCGGGGGGAGAACTGTGCAGG + Intergenic
904160289 1:28518120-28518142 GGGCTGGGGGAGCCCTTGGCCGG - Intronic
904831039 1:33306968-33306990 GGGCTGACGGCGCACTGTGCGGG - Exonic
905927664 1:41763342-41763364 AGGTTTGGGGACCCCTGTGCAGG - Intronic
905933199 1:41804225-41804247 GGGCTGTGGGACCACTGGGGAGG - Intronic
906151298 1:43589128-43589150 GGGCTGGAGGACCCCAGGGCAGG - Intronic
906442156 1:45857529-45857551 TGGATGGGGCACCACTGTGATGG + Intronic
907451411 1:54547999-54548021 GGGCTGGGTGCCCAGTGGGCGGG + Intronic
907881035 1:58549555-58549577 GGGTTGGGGGAGATCTGTGCAGG - Intergenic
908511180 1:64850987-64851009 GGGCCGTGGGACCGGTGTGCGGG + Intronic
908768191 1:67572708-67572730 GGGCTGGCGGCCCACAGTGAGGG + Intergenic
909779256 1:79521936-79521958 GGGCTAGGGCACCAATGTGGTGG + Intergenic
910617927 1:89219881-89219903 GGGGTGGGGGAGATCTGTGCAGG + Intergenic
913009493 1:114669675-114669697 GGGCTTGGGGACCCCTAGGCTGG - Intronic
913228717 1:116723072-116723094 GGGGTAGGGGACCATTGTGGAGG - Intergenic
915361721 1:155289963-155289985 GGGCTTGTAGACCACTGTCCTGG - Intronic
919062455 1:192651010-192651032 GGGCTGTGAGACCACTGAGAGGG + Intronic
919781273 1:201222681-201222703 GGGCTGGGGTCCAACTGTGAGGG + Intronic
920065495 1:203266706-203266728 GGGGTGGGGGGCCCCTCTGCCGG - Intronic
920088525 1:203435554-203435576 GGCCTGGGGAGCCAATGTGCTGG + Intergenic
922233353 1:223704976-223704998 GGGCTGGTGGGCCAGGGTGCTGG - Intronic
922810556 1:228413357-228413379 GGGCTTGGGGGCCTCTGGGCTGG - Intronic
1062951470 10:1506996-1507018 AGGCTGGGAGCCCACTGTCCAGG - Intronic
1063139233 10:3241689-3241711 GTGCTGCGGGACCACAGTGCGGG + Intergenic
1063190540 10:3689855-3689877 GGACTGGGGGAGCAGCGTGCGGG - Intergenic
1063463989 10:6231645-6231667 GGGCTGTGGGATCACAGAGCAGG - Intronic
1063826647 10:9906192-9906214 GGGCTGGAGGACCTCCCTGCAGG + Intergenic
1064809126 10:19174476-19174498 GGACTGGTGGTCCACTATGCAGG + Intronic
1064853835 10:19742206-19742228 GGGCAGGGGGAGATCTGTGCAGG + Intronic
1066301543 10:34101687-34101709 GAGCAGGGAGACCAGTGTGCTGG - Intergenic
1067199576 10:44155712-44155734 AAGGTTGGGGACCACTGTGCTGG - Intergenic
1067210004 10:44252225-44252247 GGGCTGGGTTAGCTCTGTGCTGG - Intergenic
1067700020 10:48564679-48564701 GGGCTGCAGAAACACTGTGCAGG - Intronic
1067831731 10:49614496-49614518 GGGCTGGCGGAGCGCGGTGCCGG + Intronic
1068334827 10:55621395-55621417 GGGGTGGGGGACCCCTGCTCTGG - Intronic
1069634093 10:69914774-69914796 GGGCTTGGAGACCGCTGTGGCGG + Intronic
1070599285 10:77854449-77854471 GTACTGGGGAACCACTGGGCTGG - Intronic
1070850096 10:79556600-79556622 TGGCTTGGGCACCACCGTGCTGG + Exonic
1071206868 10:83290180-83290202 AGGCTGCTGGACCACTGTGATGG + Intergenic
1071437711 10:85662511-85662533 GAGCTGGGGATCCAGTGTGCAGG - Intronic
1071582529 10:86786164-86786186 GGGCTGAGTGAGCACAGTGCAGG - Intronic
1072505332 10:96060564-96060586 GGGGTGGGGGAACATTGTGTGGG + Intronic
1073564928 10:104526776-104526798 CTGGTGGGAGACCACTGTGCAGG - Intergenic
1074826030 10:117216404-117216426 GGGCTGGTGGACCACTGAACGGG - Intergenic
1076209135 10:128626549-128626571 GAGTTTGGGGACCTCTGTGCGGG + Intergenic
1076560658 10:131361135-131361157 TGACTGGGGCACCACTGTGCAGG + Intergenic
1076843348 10:133057270-133057292 GGGCCGTGGGGCCCCTGTGCTGG - Intergenic
1076890554 10:133281110-133281132 GAGCTGGGGGACGGCTGAGCAGG + Intronic
1077059260 11:610553-610575 GGGCTGGCTGACCAGTGCGCAGG - Exonic
1077142620 11:1031133-1031155 GGGCTGGGGGGCCTCTGGGGGGG - Intronic
1077192778 11:1262404-1262426 GGGCTGTGGGAGCACTGCCCAGG + Intergenic
1077245527 11:1535462-1535484 GGGCTGTGGCACCACAGTGCTGG - Intergenic
1077800473 11:5531086-5531108 GGGCAGGGGGAGATCTGTGCAGG + Intronic
1079588006 11:22149867-22149889 GTGGTGGGGGTGCACTGTGCTGG + Intergenic
1081151651 11:39640064-39640086 GGGCTGGGGGACAACTAAGATGG - Intergenic
1081960558 11:47133519-47133541 GGGCTGGGGGACCACTGTGCTGG - Intronic
1081992164 11:47343660-47343682 GGCCTGGGGGAGCAGGGTGCGGG - Intronic
1083281686 11:61630566-61630588 AGGCTTGGGGACCACTGGCCAGG - Intergenic
1083430378 11:62611214-62611236 GGGCTGGGGGTCCATTGCTCAGG + Exonic
1083694004 11:64430434-64430456 GAGGTGAGGGACCACTGTTCTGG + Intergenic
1083748552 11:64748236-64748258 CAGGTGGGGGACCACTGTGGGGG - Intronic
1083749368 11:64752934-64752956 AGGCTTGGGGAACACAGTGCAGG + Intronic
1083775577 11:64893006-64893028 GGGATGGGGGATCCCTGGGCTGG + Intergenic
1083791574 11:64989433-64989455 GGGCTGGGGGACAGCTGGACAGG + Exonic
1084111083 11:67014629-67014651 GGGCTGAGGGATCACAGTGGAGG + Intronic
1084488092 11:69462848-69462870 GGGCTGGGGCCCCACACTGCTGG - Intergenic
1084800782 11:71542495-71542517 GGGCTTGAGGAGCTCTGTGCCGG + Intronic
1084957902 11:72701243-72701265 GGGGTGGTGGCCAACTGTGCGGG + Intronic
1085312882 11:75526293-75526315 GGGCATGGGGACTGCTGTGCGGG + Intergenic
1085402356 11:76242479-76242501 GGGCTGGGGATCCACTCTGAGGG + Intergenic
1085476798 11:76794125-76794147 CTGCTGAGGGGCCACTGTGCAGG + Intronic
1085621110 11:78038542-78038564 GGGCTGGGGAGCCAGTGAGCGGG - Intronic
1087281586 11:96216795-96216817 GGGCTGGAGCAACACGGTGCAGG + Intronic
1087374565 11:97325726-97325748 AGGCTTGGAGTCCACTGTGCTGG + Intergenic
1088305354 11:108401628-108401650 GGGTTGGGGGAGATCTGTGCAGG - Intronic
1089110972 11:116055761-116055783 GGGCCACGGGACCACTGTGGAGG + Intergenic
1090278046 11:125433222-125433244 GTGCTGGGGGACGCCTGTCCAGG - Exonic
1090601027 11:128371382-128371404 GGATTGGGGGACAACTGTACTGG + Intergenic
1090918312 11:131186390-131186412 GGGCTGGGAGACAACAGTGACGG - Intergenic
1091256595 11:134192825-134192847 GGACTGCGAGAGCACTGTGCAGG - Exonic
1091302175 11:134514737-134514759 GGGCTGGGGGCCCAGAGTGAGGG + Intergenic
1092459906 12:8677242-8677264 AGGGTGGGGGTGCACTGTGCGGG - Intergenic
1092619856 12:10251977-10251999 GGGCTTGGGGACCTCTGGTCTGG + Intergenic
1093714485 12:22366136-22366158 GGGCATGGGATCCACTGTGCTGG - Intronic
1096817769 12:54212473-54212495 GGGGTGGGGGACGACAGTGGTGG - Intergenic
1097003792 12:55900625-55900647 GGGCTGGGGGGACACTCGGCGGG + Intergenic
1097158714 12:57030463-57030485 GGGCTGGAGGACCATTGAGGAGG + Intronic
1097905149 12:64911987-64912009 GGGCTGGGGGATCACTGGCAAGG + Intergenic
1100177843 12:92051110-92051132 GGGGTTGGGGACCCCTGTGATGG + Intronic
1101717231 12:107321240-107321262 GGGCTGGAGGAGCACTGCGGTGG + Intronic
1101849501 12:108390910-108390932 GGGCTGGGGGCCAATTGTGCAGG + Intergenic
1101940874 12:109098156-109098178 GGGGCGGGGCACCTCTGTGCAGG + Intronic
1102117980 12:110417975-110417997 GGGCAGGGGGAGATCTGTGCAGG + Intergenic
1103568853 12:121830908-121830930 GGCCTGGGGCACCACTGACCCGG + Exonic
1103587816 12:121969145-121969167 TGGCAGGGGGTACACTGTGCTGG - Intronic
1104105182 12:125652347-125652369 GGGCTGGGAGAGCACTTTGTTGG + Intronic
1104275135 12:127320036-127320058 GGGCTGGGAGAGCACTTTGTTGG - Intergenic
1104307661 12:127624068-127624090 GGGCTGGGAGAGCACTTTGTTGG + Intergenic
1104918974 12:132280731-132280753 GGGCTGGGGGGCCACCCTGAGGG - Intronic
1104926845 12:132318308-132318330 GGGCTGGGCGGGCACTGGGCAGG + Intronic
1106096819 13:26653599-26653621 GAGGTGGCGGACCACTGTGCAGG - Intronic
1106594141 13:31122685-31122707 GGGCAAGGGGACCCCTGTCCTGG + Intergenic
1107770720 13:43786217-43786239 GGGCAGCGGGAACACTGTGTGGG + Intronic
1113902726 13:113805648-113805670 GGGCTGGCCAACCGCTGTGCTGG + Intronic
1113971537 13:114195097-114195119 GGGCTGTGGGGCCACTGGGCGGG - Intergenic
1115235606 14:31206971-31206993 GTGCTGGGGAACCACAGCGCGGG - Intronic
1115643393 14:35350069-35350091 GGGCTGGGGGTCTACCTTGCAGG - Intergenic
1116640240 14:47452502-47452524 GGGCTAGGTGGCCACTGTACTGG + Intronic
1118846401 14:69550765-69550787 GGGGAGGGTGACCACGGTGCGGG + Intergenic
1119263147 14:73250111-73250133 GGGCTGGGGCACCACTCACCCGG - Exonic
1121045684 14:90785986-90786008 AGGCTGGCTGACCACTGTGGGGG - Intronic
1122115658 14:99526110-99526132 GGGCTGGGGGAGGCCTGTGTTGG - Intronic
1122662892 14:103309779-103309801 GGCCCTGGGGACCACTGTGGTGG - Intergenic
1122972143 14:105156719-105156741 GGCCTGGGAGGACACTGTGCTGG + Intronic
1124199301 15:27663606-27663628 GGGCAGGGGGAGATCTGTGCAGG + Intergenic
1124254856 15:28132060-28132082 GAGCTGGGAGAGCACTGGGCAGG + Intronic
1124890371 15:33726577-33726599 GGGCCTGGGGGCCACTGTGCTGG - Intronic
1125364792 15:38902259-38902281 GGGCGGGGGGACAAGTGTGTAGG + Intergenic
1127833547 15:62771767-62771789 GAGCTGGGGGACCACCAGGCAGG + Intronic
1128063128 15:64747733-64747755 GGGCTGGGTGCCCAATGGGCAGG - Intronic
1128422130 15:67503008-67503030 GGGCTGGGGATGTACTGTGCTGG + Intergenic
1129108354 15:73323634-73323656 GGGCTGGGCAACCTCGGTGCCGG - Exonic
1129607445 15:77031739-77031761 TGGCTGGGGGCCCTCTCTGCTGG - Intronic
1129769530 15:78194239-78194261 GGGCTGGAAGCCCAGTGTGCTGG - Intronic
1130260275 15:82348960-82348982 GGGCTGGGGGACCCAGGTCCTGG + Intronic
1130268455 15:82430473-82430495 GGGCTGGGGGACCCAGGTCCTGG - Intronic
1130280958 15:82520047-82520069 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130472328 15:84236228-84236250 GGGCTGGGGGACCCAGGTCCTGG - Intronic
1130479819 15:84350799-84350821 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130483951 15:84387232-84387254 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1130491951 15:84437330-84437352 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1130503565 15:84516370-84516392 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1130594626 15:85240864-85240886 GGGCTGGGGGACCCAGGTCCTGG - Intergenic
1131122422 15:89830805-89830827 GGGCTGGGGTGCCACTGTACAGG + Exonic
1132055271 15:98647578-98647600 GGGCTGGGGGCCGACTCGGCTGG - Intergenic
1132516697 16:369370-369392 GGGCTGGGGCGGCACTGGGCTGG - Intronic
1132570144 16:640974-640996 GTGCTTGGGGATCCCTGTGCCGG - Intronic
1132829198 16:1919242-1919264 GGACTCAGGGACCCCTGTGCTGG + Intergenic
1132885445 16:2180235-2180257 GGGCCGGGTGGCCACCGTGCTGG - Exonic
1134132449 16:11658977-11658999 GGGCTGTGGGAACACAGAGCAGG + Intergenic
1136291104 16:29271958-29271980 GGGCTGCGGGAGGACGGTGCGGG - Intergenic
1136593210 16:31230397-31230419 GGGCAGGGGGAGATCTGTGCAGG - Intergenic
1137540274 16:49357030-49357052 GCATTTGGGGACCACTGTGCAGG - Intergenic
1137629489 16:49932157-49932179 GCGGTGAGGGACCACTGTCCTGG + Intergenic
1137717592 16:50608239-50608261 GGGTTGGGGGAGCCCAGTGCTGG - Intronic
1138153774 16:54684391-54684413 GGGATTAGGGACCCCTGTGCTGG + Intergenic
1138412903 16:56853804-56853826 GGGATGGGAGAACACTGTGTGGG + Intergenic
1139427833 16:66894232-66894254 GGGCTGCAGGGCCACTGTGGAGG + Intronic
1139428081 16:66895558-66895580 GGGCTGGGTGACCACAGGACCGG - Intronic
1139663029 16:68435191-68435213 GGGCTGAGGGACCAGAGTGAGGG + Intronic
1139699270 16:68697507-68697529 AGGGTCGGGAACCACTGTGCTGG - Intronic
1139948953 16:70660101-70660123 GAGCTGGGGGACCACGGGGGCGG - Exonic
1140355212 16:74299487-74299509 GGGCTGGGGGACTGAGGTGCAGG - Intronic
1140986594 16:80163724-80163746 TGGCTGTGGGACCACTAGGCAGG + Intergenic
1141619010 16:85226876-85226898 AGGCTGGGGGAAGACTTTGCAGG + Intergenic
1141720411 16:85752351-85752373 GGGCTGGGGGAGGCCTGTGCAGG + Intergenic
1142719372 17:1766227-1766249 GGGCTGGGGCCCCACTGCTCTGG + Intronic
1142809331 17:2387823-2387845 GGGCTGGGGGGCCAGCGTGGGGG + Intronic
1143211571 17:5191876-5191898 GGACTGGGGGACCGCAGTCCCGG - Intronic
1143787411 17:9266262-9266284 TGGCTGGGGCACCCCTGTTCTGG - Intronic
1144484650 17:15654756-15654778 GGGCAGGGGGAGATCTGTGCAGG - Intronic
1144712451 17:17410759-17410781 GCGCAGGGGGAGCACTGTGAAGG + Intergenic
1144764404 17:17724912-17724934 GGGCAGGGGGGCCACTGGGCAGG - Intronic
1144890446 17:18491149-18491171 GGTCTGTGGGGCCACTGGGCTGG + Intronic
1144934206 17:18884972-18884994 AGGCTGGGGCACCCTTGTGCTGG + Intronic
1145141771 17:20453169-20453191 GGTCTGTGGGGCCACTGGGCTGG - Intronic
1145933186 17:28700447-28700469 TGGCTGGAGGCCCACTGGGCTGG - Exonic
1146473943 17:33146666-33146688 GAGCTCGGAGACCTCTGTGCCGG + Intronic
1147317679 17:39628572-39628594 GGCCTGGGGGACCTCTCTGGGGG - Intronic
1147727206 17:42573445-42573467 AGGCTGTAGGACCGCTGTGCAGG - Intronic
1147808992 17:43153542-43153564 GGGGTGGGGGAGATCTGTGCAGG - Intergenic
1148103220 17:45105298-45105320 GGGCTGGGGGAACTCTGAGGAGG + Intronic
1148200360 17:45746255-45746277 AGGCTGGGGCACAACTGTGGAGG + Intergenic
1148667926 17:49388519-49388541 GGGCAGGGGTGCCAGTGTGCTGG + Intronic
1148688706 17:49514593-49514615 GGGCTGGGGGAACCCTGGGCTGG - Exonic
1148786696 17:50149294-50149316 GGGCTCGGGGAGGACTCTGCGGG - Exonic
1149803836 17:59595667-59595689 GGGCGGGGGGAGATCTGTGCAGG + Intronic
1149842656 17:59979811-59979833 GGGCGGGGGGAGATCTGTGCAGG - Intergenic
1150292635 17:63990495-63990517 GGGCTGAGGGAGGGCTGTGCTGG + Intergenic
1150294933 17:64002473-64002495 GGGCTGGGAGGCCCCTGTGAAGG + Exonic
1151548198 17:74806242-74806264 GGGCTGGGCTACCACTGTTGGGG - Intronic
1151844355 17:76641191-76641213 GGGCAGGGGGAGATCTGTGCAGG - Intronic
1152260188 17:79262618-79262640 GGGCTGTGGGCCCTCTGTGCAGG + Intronic
1152404842 17:80091503-80091525 GGGGTGGGGGAACACTGGGCTGG - Intronic
1152512865 17:80802174-80802196 GGGTTTGGGTACCACTGTGAAGG - Intronic
1152561474 17:81081005-81081027 GGGCTGAGGGAGCACTGGCCAGG + Intronic
1152758489 17:82097016-82097038 GGGGTGGGGGCCCGCTGTCCAGG + Intronic
1153926901 18:9842441-9842463 GGGTTTGGGGAGAACTGTGCCGG + Intronic
1154082255 18:11269468-11269490 GAGCTGTGTGACCACTGTGAAGG - Intergenic
1157339532 18:46766991-46767013 GGGTTGGGGGAGATCTGTGCAGG + Intergenic
1157499019 18:48177210-48177232 GGGCGAGGGGACCACTTTGCTGG - Intronic
1157597108 18:48870683-48870705 AGGCTGGGTGGCCTCTGTGCAGG + Intergenic
1157614617 18:48979094-48979116 AGGCTGGGTGGCCTCTGTGCAGG - Intergenic
1157845315 18:50998946-50998968 GGGCTGGTGGAACACTGTGAGGG - Intronic
1158306815 18:56115262-56115284 GGGCTGGAGGAGCACAGAGCAGG - Intergenic
1160535310 18:79588487-79588509 GGGCTGAGGCTCCACTGGGCAGG - Intergenic
1160778505 19:867459-867481 CAGCAGGGGCACCACTGTGCTGG + Intergenic
1160872476 19:1283551-1283573 TGGCAGGGGGGCCACTGTGGGGG - Intergenic
1161178791 19:2865666-2865688 GGGCCGGGGGAGATCTGTGCAGG - Intergenic
1163035040 19:14565139-14565161 GGGCAGGGGGACAGCTGGGCTGG + Intronic
1163166375 19:15500843-15500865 GACCTGGGGGACCACTGAGAGGG - Intergenic
1163435312 19:17292096-17292118 GTGCTGGGTGACCACAGGGCAGG - Intergenic
1163777939 19:19228698-19228720 GGGCTGGGGGATCCCAGAGCAGG + Intronic
1163818915 19:19485073-19485095 TGTCTGGGGGGCCTCTGTGCAGG + Intronic
1164053474 19:21603169-21603191 GGGTTGGGGGAGATCTGTGCAGG - Intergenic
1164054683 19:21612491-21612513 GGGCAGGGGGAGATCTGTGCAGG - Intergenic
1164672081 19:30077976-30077998 GGGCTGGGTGCCCACTATGGTGG - Intergenic
1166010937 19:39942354-39942376 GGGCTGGGGGAGATCTGTGCAGG - Intergenic
1167363044 19:49040302-49040324 GGCTTCGGGGACCACTGTGGAGG - Intergenic
1167365519 19:49053284-49053306 GGCTTCGGGGACCACTGTGGAGG + Intergenic
1167752896 19:51391124-51391146 GGGCTGGGGAACCAGAGTACGGG - Intergenic
1168213024 19:54905454-54905476 GGGTTGGGGGAGATCTGTGCAGG + Intergenic
925085118 2:1101616-1101638 GGGCTGTGGGACTTCGGTGCTGG + Intronic
926695819 2:15769798-15769820 GGGCTGGCAGAGCACTGGGCTGG - Intergenic
927511610 2:23647583-23647605 GGGCTGGGAGGCCAGTGTGCAGG - Intronic
927569021 2:24141851-24141873 AGGCTGTGGGACCACTTTGTAGG - Intronic
927606439 2:24491075-24491097 GGGCTGGGGGCGCGCTGTCCCGG + Intergenic
927640687 2:24843724-24843746 GCGCTGTGGGGCCTCTGTGCGGG + Intronic
928641179 2:33301623-33301645 GGGCTTGGAGACCACTGTGAAGG + Exonic
928994366 2:37271497-37271519 GGGCTTGGGGACCCCTGTTGTGG - Intronic
930596215 2:53391384-53391406 GGGCTGGGGGAGATCTGTGCAGG - Intergenic
931166541 2:59755047-59755069 GGGATGGCAGACCTCTGTGCAGG - Intergenic
931191162 2:60001725-60001747 GGGCTGGGGAAGCCCTGTGCAGG - Intergenic
932491785 2:72127374-72127396 GGGCTAGGGGACCAGCGTGGGGG - Intergenic
932750859 2:74370856-74370878 GGCCTGGGGCATCTCTGTGCTGG - Intronic
937279351 2:120706662-120706684 GGGCTGGGGCACAACTGAGATGG - Intergenic
937326145 2:120990404-120990426 GAGCTGGGAGTCCACAGTGCTGG - Exonic
937979760 2:127608021-127608043 GGGCTGGGAGGACACTGAGCAGG + Intronic
938036565 2:128039648-128039670 TGGCTGAGGGACCACTCTGGAGG + Intergenic
938072756 2:128317255-128317277 GGGCTGGGGGACCCCAGAGAAGG + Intronic
947635936 2:231680891-231680913 GGGCTGGGCCACCGCTGTGGGGG - Intergenic
947894347 2:233655655-233655677 GGGGTGGGTGATCACTGTCCTGG + Intronic
948387629 2:237591463-237591485 GGGCGGAGGAACCACTGTGGTGG - Intronic
948632680 2:239312176-239312198 GGGCAGGGGCACCCCTGGGCAGG + Intronic
1168795406 20:607681-607703 AGGCTGGGGGACTTCTCTGCAGG - Intronic
1168896663 20:1328450-1328472 GGGCTGGGCGAGCACTGGACAGG - Intronic
1169316060 20:4592147-4592169 GGGCAGAGGGACCAGTGGGCAGG + Intergenic
1172167385 20:32907526-32907548 GGGCTGTGGGCCCACAGTGCTGG + Intronic
1172991911 20:39042918-39042940 GGCCTGGGGGAACGCTGCGCTGG - Intergenic
1173316670 20:41950884-41950906 GGCCTTGTGGACCACTGTGAAGG + Intergenic
1173609436 20:44355861-44355883 GGGCTGGGGGAAGACTGGACAGG + Intronic
1174562681 20:51442835-51442857 GGCCTGGGGTACAGCTGTGCCGG - Intronic
1175563807 20:59955920-59955942 GAGCTGGGGGACAACAGTGAAGG - Intergenic
1176267180 20:64216076-64216098 GGCCTGGTGGTCCTCTGTGCTGG + Intronic
1176360905 21:5995829-5995851 GGGATGTGGGGCCACTGGGCTGG + Intergenic
1176428735 21:6563711-6563733 AGTCAGGGGGGCCACTGTGCAGG - Intergenic
1179088607 21:38242759-38242781 GGGCTGGGGGAACACAGAGCAGG - Intronic
1179576311 21:42310532-42310554 GGCCGGGGGGACCACAGTGCAGG + Intergenic
1179704225 21:43172027-43172049 AGTCAGGGGGGCCACTGTGCAGG - Intronic
1179762613 21:43542721-43542743 GGGATGTGGGGCCACTGGGCTGG - Intronic
1179784874 21:43723876-43723898 GTGCTGCAGGACCACAGTGCAGG + Intronic
1180089317 21:45525698-45525720 GGGCTGGGGGCACAGGGTGCGGG - Intronic
1180103939 21:45605127-45605149 GGGATGTGGGGCCACTGGGCTGG + Intergenic
1180715752 22:17871128-17871150 GGGCTGGGGGTCCTCAATGCAGG + Intronic
1182027889 22:27134695-27134717 GGGCTGGGGGAACCCCATGCAGG + Intergenic
1182679363 22:32066798-32066820 GGGCTGGGAGAAAACTGTGCTGG - Intronic
1182967117 22:34532725-34532747 GGGCAGGGGGACTACAGTGAGGG - Intergenic
1183335652 22:37244427-37244449 GACCTGGGGGCCCTCTGTGCTGG + Intronic
1183370227 22:37427809-37427831 GGCCTGGCGGACCCCTGTCCCGG + Intergenic
1183597907 22:38823262-38823284 GGGTTGGGGGACCTGTGTCCAGG - Exonic
1183639000 22:39082058-39082080 GGGCTGGGTGCCCACAGGGCAGG + Intronic
1184231655 22:43161405-43161427 GGGTTTGGGGGCCACTGTGTAGG + Intronic
1184274016 22:43400051-43400073 GGGCTGGGCGACCCCAGGGCTGG + Intergenic
1184274027 22:43400083-43400105 GGGCTGGGTGACCTCAGGGCTGG + Intergenic
1184594156 22:45503855-45503877 GGGCTGGGTGGGCACTGTCCCGG - Intronic
1184846338 22:47090132-47090154 GAGCTGGAGAACCACTTTGCTGG - Intronic
1185048700 22:48541965-48541987 GGCCTGGGAGGCCAGTGTGCAGG + Intronic
1185077166 22:48689728-48689750 GGGCTGGGGCCAGACTGTGCAGG + Intronic
1185123052 22:48984864-48984886 GGGCAGGAGGACCATTGTGGAGG + Intergenic
950100520 3:10353798-10353820 GGGCTTGGGGACCAACGGGCTGG + Intronic
950193283 3:10992600-10992622 GGCCTGGGGGAGCGCTGGGCGGG + Intergenic
950216810 3:11166068-11166090 GGGCTGGTTGCCCACTGTGGAGG - Intronic
950400904 3:12768777-12768799 GGACTGTGGGAGCACTGCGCGGG - Intronic
950439874 3:13004392-13004414 GGGCCGGGGGAGCGCTCTGCAGG + Intronic
950493483 3:13320018-13320040 GAGTGGGGGGACCACTGAGCGGG + Intronic
950570486 3:13796813-13796835 GGGCTGGGGGAGCCCTGTGCTGG - Intergenic
950629661 3:14274141-14274163 GGGCTGGACGACCACTTTGTGGG - Intergenic
950664751 3:14488401-14488423 TGGGTGGGGGACCAGTGTGGCGG - Exonic
950905428 3:16533671-16533693 GGCCTGGGGGATAACAGTGCGGG - Intergenic
953411493 3:42692862-42692884 GGTCTGGGGGAACCCTGTGTGGG + Exonic
954369588 3:50163217-50163239 GGGCTGGGGTCGCACTGGGCAGG + Intronic
956519865 3:70092076-70092098 GGCCTGGGTTTCCACTGTGCTGG + Intergenic
960568120 3:119156689-119156711 CAGGTGTGGGACCACTGTGCTGG + Intronic
961623592 3:128243798-128243820 GGGCTGGGTCCCCACTGGGCAGG + Intronic
963065204 3:141258211-141258233 GGCCTGGGAAGCCACTGTGCTGG - Intronic
964170862 3:153768246-153768268 GGGCTGGAGGACAAATCTGCTGG + Intergenic
966408804 3:179627517-179627539 GGGCAGGGGGAGATCTGTGCAGG - Intronic
966807617 3:183819176-183819198 AAGCTGGGGCACCACTGGGCAGG + Intronic
966923978 3:184632803-184632825 GGGCTGGGAGGCCTCTGTGCAGG - Intronic
968051578 3:195658295-195658317 GGGCTGGGAGAGCCCTGGGCCGG + Intergenic
968104238 3:195990038-195990060 GGGCTGGGAGAGCCCTGGGCCGG - Intergenic
968302539 3:197627628-197627650 GGGCTGGGAGAGCCCTGGGCCGG - Intergenic
968585077 4:1412568-1412590 GGGCTGGTGGACCCCTGCTCTGG + Intergenic
968672017 4:1856869-1856891 GGGATGGGGGGCCGCTATGCTGG - Intergenic
968709995 4:2107651-2107673 GGCCAGGGGGACCACTGGCCTGG + Intronic
968746370 4:2362621-2362643 AGGCTGGGGGCCCACTGACCTGG + Intronic
969285540 4:6200047-6200069 AGGGTGGGGGACCACTGAGGTGG + Intronic
969291081 4:6240358-6240380 CGGCTGGGGGACCTCTGGACAGG + Intergenic
969330420 4:6471252-6471274 GGGCTCGGGGCCGCCTGTGCTGG - Intronic
969346828 4:6575327-6575349 GGGCTGGGTCTACACTGTGCAGG + Exonic
969491674 4:7502761-7502783 GTGCTCAGAGACCACTGTGCGGG + Intronic
973207364 4:47575493-47575515 GGGATGGCTGACCACTCTGCTGG + Intronic
975229552 4:71915818-71915840 GGGCAGGGGGAGATCTGTGCAGG + Intergenic
978618624 4:110619180-110619202 GGGGTGGGGGACGACAGTGGAGG - Intronic
981750849 4:148091306-148091328 GGGTTGGGGGAAGGCTGTGCAGG - Intronic
985704426 5:1392270-1392292 GGGCTGGGGGAGAGCGGTGCAGG + Intergenic
985956693 5:3271058-3271080 GTGCTGGGTGGCCACTGTGCTGG - Intergenic
986773127 5:10991271-10991293 GGGTAGGGAGACCACTTTGCTGG + Intronic
986908344 5:12522211-12522233 GGGGTGGGGGAGCAGTGGGCAGG + Intergenic
987828989 5:23071781-23071803 GGGGTGCAGGACCACTGTCCTGG + Intergenic
988495444 5:31741741-31741763 GGGGTTGGGGAGCCCTGTGCAGG - Intronic
988705715 5:33724311-33724333 GGGGTGGGGGATGACTGTGTGGG - Intronic
989565352 5:42895977-42895999 GGGGCAGTGGACCACTGTGCTGG - Intergenic
992398442 5:76389100-76389122 TGGCTGGGGGTTCACTGTGCAGG - Intergenic
995747968 5:115423752-115423774 AGGCTCTGGGACCACTGTGAGGG - Intergenic
997444492 5:133931518-133931540 GGGCTGGTGGTTCAGTGTGCAGG - Intergenic
999758474 5:154682717-154682739 GGGCTGGGGGAGGACAGTGGGGG - Intergenic
999805767 5:155079850-155079872 GGGCTGGGCATGCACTGTGCTGG + Intergenic
1001307461 5:170585826-170585848 GGGCTGGGAGACAGCCGTGCTGG - Intronic
1002552116 5:180002347-180002369 GAGATGTGGGGCCACTGTGCTGG + Intronic
1003271657 6:4613149-4613171 GGGCTGGGAGAACAATGGGCAGG - Intergenic
1003875656 6:10434069-10434091 GGGCAGGGGGACAAGTGTGGAGG + Intergenic
1003943468 6:11051424-11051446 AGGCTGGAGGACTACTGTGTGGG - Intergenic
1005989221 6:30892914-30892936 GGGCTGGGGGAGCAGGGTCCTGG - Intronic
1006802393 6:36767525-36767547 GGACTGGGAGGCCACTGGGCAGG - Intronic
1006986583 6:38179612-38179634 GGGCAGAGGCACCTCTGTGCAGG + Intronic
1007338214 6:41170727-41170749 GACATGGGTGACCACTGTGCTGG + Intergenic
1007711249 6:43825742-43825764 GGGCTGGGGGAGGCCTGTGCTGG + Intergenic
1008053268 6:46921717-46921739 CAGCCGGGGGACCACAGTGCTGG - Exonic
1013410337 6:109877987-109878009 GGGCGGGGGGAGATCTGTGCAGG - Intergenic
1014859774 6:126451549-126451571 TTGCTTGGGGACCAGTGTGCAGG - Intergenic
1017464151 6:154678949-154678971 AGGGTTGGGGACCACTGTGTTGG + Intergenic
1017720420 6:157239783-157239805 GGGCTGGGGGAGGAATGAGCTGG + Intergenic
1018711727 6:166502059-166502081 GGGCTGGGGAGCTACTGTGCAGG + Intronic
1019354223 7:570527-570549 GGGCTCGGGGACTGCTGGGCAGG - Intronic
1019473134 7:1231708-1231730 TGGCTGCGGGACCCCAGTGCTGG - Intergenic
1019538272 7:1539921-1539943 GACCTGGGGGGCCACAGTGCGGG - Exonic
1019553753 7:1618210-1618232 AGGCTGGGAGACCAGTGTGTAGG + Intergenic
1019737311 7:2656933-2656955 AGGTTGGTGGTCCACTGTGCAGG + Intronic
1023861708 7:44220792-44220814 GGGCTGGGGGGGGGCTGTGCAGG - Intronic
1023868810 7:44251940-44251962 GGGCCGGGGGACCGCAGAGCTGG - Intronic
1024013952 7:45294349-45294371 AAGCTGGGGGAGCACTGTGCAGG + Intergenic
1024427164 7:49239742-49239764 AGGCTTGGAGTCCACTGTGCTGG + Intergenic
1024498140 7:50070728-50070750 GGGGTGGGGGAGATCTGTGCAGG + Intronic
1025112084 7:56226309-56226331 GGGGTGGGGGAGCATTGTGTGGG - Intergenic
1025917095 7:65873857-65873879 GGGCTGGGGCCCGGCTGTGCAGG + Intronic
1025995024 7:66522608-66522630 GGGCTGGGGGTACAGTGAGCAGG - Intergenic
1026986665 7:74559303-74559325 GGGCTGGGGGTGCAGTGAGCGGG - Intronic
1027124311 7:75545089-75545111 GGGCTGGGGAGCCACTGTCATGG - Exonic
1027189824 7:75990101-75990123 CTGCTTGGGGAGCACTGTGCCGG - Intronic
1028083114 7:86601223-86601245 GGGTTTGGAGTCCACTGTGCTGG - Intergenic
1029506768 7:100967754-100967776 GGGCTGGGGGACTGGGGTGCAGG - Exonic
1030210343 7:106989687-106989709 GGGCGGGGGGAGATCTGTGCAGG + Intergenic
1033278660 7:139990687-139990709 GGGCAGGGAGAGCACAGTGCCGG - Intronic
1034422880 7:150998544-150998566 GCGCTGCGGGAACACTGTGATGG - Exonic
1034466248 7:151231660-151231682 TGGTTGGGGAACCACTGTGGTGG + Intergenic
1034808436 7:154108755-154108777 GGGCTGGGGAGCCACTGGGGCGG + Intronic
1034886428 7:154802349-154802371 GGGCTGCGGGACCCCTGGGATGG + Intronic
1035291595 7:157842739-157842761 GGGCTGGGTGTGCACTGTGGCGG - Intronic
1035411373 7:158645395-158645417 AGGCTGGGGGACACCTGAGCTGG + Intronic
1035602878 8:907508-907530 GGGCTGTTGGAACATTGTGCTGG - Intergenic
1038484460 8:27923917-27923939 GGGGTGGGGGATCACTGGGATGG - Intronic
1038584554 8:28777298-28777320 GGGCCACGGAACCACTGTGCTGG - Intronic
1040026907 8:42789918-42789940 GGGCAGGGGGAGATCTGTGCAGG + Intronic
1040471475 8:47738350-47738372 GGGCTGGGGGTCCCCAGGGCCGG - Exonic
1044637825 8:94344186-94344208 GGGGTGAGGGACAACAGTGCAGG + Intergenic
1047313989 8:123715627-123715649 GGGCTGGGGCAGAACTGAGCTGG + Intronic
1047416418 8:124667973-124667995 GGTCTGGGGGACCACTGAGGTGG + Intronic
1049374399 8:142282085-142282107 GAGCTGAGGGCCCACGGTGCTGG + Intronic
1049389572 8:142360866-142360888 GGGCTGTGGGGCCAGTGTGGGGG + Intronic
1049645614 8:143734349-143734371 GGTCTGGGGGTCCTCTGTGTGGG - Intergenic
1049694178 8:143975626-143975648 TGGCTGGGGGGTCACTGTGTAGG - Intronic
1049709121 8:144055837-144055859 CAGCTGGGGGCCCACTGTGCCGG + Exonic
1049778303 8:144416290-144416312 GGGATGGGGGACCACTGTTGGGG - Intronic
1050839773 9:10134111-10134133 AGGCTGGGAGACCTCTGGGCAGG - Intronic
1051400967 9:16681920-16681942 GGGTTGGGGGACCGGTGCGCTGG + Intronic
1053602708 9:39626773-39626795 GCGCATGGGGACCACTGTTCTGG + Intergenic
1053667278 9:40325105-40325127 GGGCTGGAGGATCACAGGGCAGG + Intronic
1054378423 9:64465133-64465155 GGGCTGGAGGATCACAGGGCAGG + Intergenic
1054517332 9:66051178-66051200 GGGCTGGAGGATCACAGGGCAGG - Intergenic
1054564935 9:66750175-66750197 GCGCATGGGGACCACTGTTCTGG - Intergenic
1056546819 9:87620474-87620496 GGGCTGGTGGTCCTCTGTCCTGG + Intronic
1056615277 9:88160217-88160239 GGGCTGGGGAAATTCTGTGCAGG - Intergenic
1057000418 9:91503918-91503940 GGGCAGTGAGACCAATGTGCTGG + Intergenic
1057854856 9:98594304-98594326 GGGCTTGGGGACCCCTTAGCAGG - Intronic
1059356388 9:113702548-113702570 AGGCTTGAGAACCACTGTGCTGG - Intergenic
1059901410 9:118930494-118930516 GTGCTGGCAGGCCACTGTGCAGG + Intergenic
1060047024 9:120349340-120349362 GGGCTGGGAGGCCACTGAGAAGG - Intergenic
1061454520 9:130687731-130687753 GTGCTGTGGGACCACAGAGCTGG - Intergenic
1061631757 9:131876434-131876456 GGGCTGAGGGAGCCTTGTGCAGG + Intronic
1061636962 9:131917556-131917578 GGGGTGGGGGGCTAGTGTGCAGG + Intronic
1061777174 9:132973289-132973311 GGGCTGGGGAAGCTCTGTGCGGG - Intronic
1062004455 9:134232214-134232236 GGGGTGGGGGATCGCTGGGCAGG - Intergenic
1062600462 9:137316696-137316718 GGGCTGGGGGACAACAGAGTGGG + Intronic
1062623839 9:137434235-137434257 TGGCTGGAGGGCCACTGTGACGG + Exonic
1203777923 EBV:84488-84510 TCGCTGGAGGACCACTGTGGGGG - Intergenic
1185723976 X:2404723-2404745 GGGCGGGGGGAGCTCTGTGTAGG - Intronic
1187131678 X:16509200-16509222 GGACTGGGGGACCATTGTGGAGG + Intergenic
1187699703 X:21953294-21953316 GGGCAGGGGGAGATCTGTGCAGG + Intronic
1187946706 X:24433195-24433217 GGGCAGGGGGAGATCTGTGCAGG + Intergenic
1190342377 X:49308102-49308124 GGGCAGGGGGAGATCTGTGCAGG - Intronic
1192143213 X:68662272-68662294 GTGCTGGGAGGCCACTGTGCCGG + Intronic
1192152835 X:68722677-68722699 GGGCTGGGAGAGCATGGTGCAGG + Intronic
1192153586 X:68726828-68726850 GGGCTGGGAGATCACTCTGGTGG + Intergenic
1192358479 X:70424226-70424248 GGGTTGGGGGATGACTGGGCAGG + Intronic
1193164284 X:78263877-78263899 GGGGAGGGGGTGCACTGTGCTGG + Intergenic
1193573347 X:83172310-83172332 TGCCTTGGGGACCACTGTGATGG + Intergenic
1193966958 X:87999479-87999501 GGGCTGGGGGAAGATTGTACAGG + Intergenic
1195212023 X:102659763-102659785 GCTCTGGAGGACCACTGGGCTGG - Intergenic
1195678648 X:107526745-107526767 GGGCTAGGGGAACACTCTGAGGG - Intronic
1198176908 X:134165737-134165759 TGGCTGGGAGACCACTGTGCTGG - Intergenic
1200247581 X:154534301-154534323 GGGCCGGGGGACCAGGGTGGGGG - Intronic
1201277348 Y:12312028-12312050 GGGCAGGGGGAGATCTGTGCAGG - Intergenic
1201746398 Y:17378885-17378907 GGGCAGGGGGAGAGCTGTGCAGG + Intergenic
1202374128 Y:24218064-24218086 GGGCTGGGGGACCCAGGTCCTGG + Intergenic
1202496653 Y:25452056-25452078 GGGCTGGGGGACCCAGGTCCTGG - Intergenic