ID: 1081961250

View in Genome Browser
Species Human (GRCh38)
Location 11:47139214-47139236
Sequence CTGAAGACAGAGTTGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 589
Summary {0: 1, 1: 2, 2: 4, 3: 59, 4: 523}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081961243_1081961250 8 Left 1081961243 11:47139183-47139205 CCTTTGTGGTTTCTGTGGGGAGC 0: 2
1: 0
2: 0
3: 21
4: 166
Right 1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG 0: 1
1: 2
2: 4
3: 59
4: 523
1081961239_1081961250 21 Left 1081961239 11:47139170-47139192 CCTTTAAAATGATCCTTTGTGGT 0: 1
1: 0
2: 1
3: 25
4: 225
Right 1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG 0: 1
1: 2
2: 4
3: 59
4: 523
1081961237_1081961250 22 Left 1081961237 11:47139169-47139191 CCCTTTAAAATGATCCTTTGTGG 0: 1
1: 0
2: 4
3: 25
4: 258
Right 1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG 0: 1
1: 2
2: 4
3: 59
4: 523

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081961250 Original CRISPR CTGAAGACAGAGTTGGAGGG TGG Intronic
900161437 1:1225907-1225929 CTGAAGACACGGCTGCAGGGCGG + Intronic
900704859 1:4074048-4074070 GTGAAGACAGAGGTGCTGGGTGG - Intergenic
900917808 1:5650792-5650814 CTGAGGACAGAATGGGAGGGTGG + Intergenic
900975207 1:6012291-6012313 ATGAAGGCAGAGGTGGTGGGTGG + Intronic
901633142 1:10657606-10657628 CTGAAGACAGAGTGGGACAGGGG + Intronic
901759194 1:11459658-11459680 GTGAAGACAGAGGCGGAGGCTGG - Intergenic
902657880 1:17881983-17882005 CTGCAGGCAGAGGAGGAGGGTGG + Intergenic
903067368 1:20708114-20708136 CTGAGGACAGATCAGGAGGGAGG - Intronic
903247869 1:22029464-22029486 ATGATGAAAGAGATGGAGGGAGG + Intergenic
903262150 1:22137135-22137157 CTGAGGAGAGAGCGGGAGGGAGG - Intronic
903510625 1:23872186-23872208 ATGAAGACAGAGTCAGAGGTAGG + Exonic
904187115 1:28714204-28714226 CTCAAGACAGTGGTGGAGGCTGG - Exonic
904357329 1:29948821-29948843 CTGAAGACAGCGTAGGATGGTGG + Intergenic
904698915 1:32346741-32346763 GAGAGGACAGAGTTGGAGGCAGG + Intergenic
904962578 1:34346267-34346289 ATGAATAAAGAGTTGGGGGGTGG + Intergenic
905037090 1:34925390-34925412 CTGCAGACAGATGTGGTGGGGGG + Intronic
905343999 1:37299167-37299189 CTGAAGACAGAACAGGAGGGAGG - Intergenic
905469738 1:38182848-38182870 CAGAAGACAGAACTGGAGAGTGG - Intergenic
905792796 1:40799177-40799199 CTGCTCACAGAGTAGGAGGGTGG - Intronic
906588540 1:47001915-47001937 CAGAAGGCAGAGGTGGAGGGAGG - Intergenic
906641386 1:47442984-47443006 CTGAAGGCAGAGAAGAAGGGAGG + Intergenic
908326722 1:63030191-63030213 ATGAGGACAGAGTTTGGGGGTGG - Intergenic
908413264 1:63887297-63887319 CTGAAGAAAGAAGAGGAGGGTGG + Intronic
910281125 1:85502821-85502843 CTGCAGACAGAGGTGGTAGGAGG - Intronic
911335641 1:96576897-96576919 TTAAAGACAGAGTGGGACGGGGG + Intergenic
911502332 1:98703483-98703505 CTGTAGACAGAGTAGGAGAAAGG + Intronic
912775442 1:112503926-112503948 AGGAAGGCAGAGTGGGAGGGAGG + Intronic
912842390 1:113050661-113050683 CTGCAAACAGGGTTGGTGGGTGG + Intergenic
913232715 1:116755155-116755177 CTGAAGACAGAGTTGTAGGCAGG - Intronic
913996599 1:143655909-143655931 CTGAAGACACAGTGGGAAGACGG - Intergenic
915381194 1:155442246-155442268 CTAAAGAATGAGTTGGAGGATGG - Intronic
915490274 1:156246757-156246779 CTAGAGACAGAGTGGGAGGTAGG + Intronic
915577715 1:156791642-156791664 CTGAGGGCACAGTTGGAGAGGGG - Intronic
916270672 1:162938180-162938202 CTGAAGACCTAGTCGGGGGGTGG + Intergenic
916599889 1:166282696-166282718 CTGAAGACAGTTTGGGAGTGAGG - Intergenic
917478318 1:175387750-175387772 CTGGAGACAGAGTAGGAGGTGGG - Intronic
919718516 1:200806673-200806695 CTGAAGAAACTGGTGGAGGGAGG + Intronic
921789653 1:219275129-219275151 CAGAAGACAAAATTGGATGGAGG - Intergenic
921980494 1:221252181-221252203 TTGCAGACTGAGCTGGAGGGTGG - Intergenic
922575388 1:226657951-226657973 CTGGGAACAGACTTGGAGGGAGG - Intronic
923595484 1:235358069-235358091 CTGAAGTCAGAGTTGGGGTGGGG - Intergenic
923619923 1:235570331-235570353 CTAAGGAAAGAATTGGAGGGAGG - Intronic
923782050 1:237033364-237033386 CTGAAGGCAGATGTGCAGGGTGG - Intergenic
1063203231 10:3806142-3806164 CTGCAGACACACCTGGAGGGAGG + Intergenic
1064298756 10:14103028-14103050 CTTAGGAGAAAGTTGGAGGGAGG + Intronic
1064367351 10:14719777-14719799 CGGAAGACAGAGATGGTGTGAGG - Intronic
1064408505 10:15085379-15085401 CTGAAGACAGCCTCCGAGGGTGG + Intronic
1065500625 10:26378289-26378311 CTGAAGACTGACTTACAGGGAGG + Intergenic
1066007554 10:31159458-31159480 CTTAAGAAAGAGATGGAGGCAGG + Intergenic
1066276083 10:33870259-33870281 CTTAACTCAGACTTGGAGGGAGG + Intergenic
1067934045 10:50593051-50593073 CCGAAAACAGAGATGGAAGGTGG - Intronic
1068332985 10:55597353-55597375 ATAAAGTCAGAGATGGAGGGAGG - Intronic
1068628131 10:59271508-59271530 ATGACAAAAGAGTTGGAGGGAGG + Intronic
1068842239 10:61628651-61628673 CTGAAGACAGACTGGGGAGGAGG + Intergenic
1069795749 10:71050768-71050790 CTAAAGCCAGCTTTGGAGGGAGG - Intergenic
1069906369 10:71734842-71734864 CAGAGGACAGAGTTGGAGGCAGG - Intronic
1070391567 10:75975362-75975384 CTGAAGGGAGAATGGGAGGGAGG - Intronic
1070392792 10:75985716-75985738 CAGAACTCAGAGATGGAGGGAGG + Intronic
1070801310 10:79245966-79245988 CTTAAGACAGAGGTGCAGTGAGG + Intronic
1070985364 10:80685444-80685466 TTGAACACATAGCTGGAGGGTGG - Intergenic
1071415104 10:85433873-85433895 CTGCAGGCAGAGCTGGCGGGAGG - Intergenic
1072481844 10:95816594-95816616 GTGAAGACAGAGGTGGAGATTGG + Intronic
1072538812 10:96383022-96383044 ATGAAGACAGAATGGGATGGGGG + Intronic
1073202778 10:101749726-101749748 CTGATGAAAGAGTTAAAGGGTGG - Intergenic
1073337159 10:102718448-102718470 CTGAAGCAAGAGTGGGAGGAGGG - Intronic
1074781704 10:116807005-116807027 GTGAAGACAGAGGTGGAGACTGG + Intergenic
1074881574 10:117663495-117663517 CTGAAGCCAGAGTTGAATGCAGG - Intergenic
1076471533 10:130722115-130722137 CTGAAGGCAAGGATGGAGGGAGG + Intergenic
1076614451 10:131746665-131746687 CTGGGGACAGAGCTGGGGGGAGG + Intergenic
1076679996 10:132166867-132166889 CTGAAGACAGAGCTGTTGGCAGG - Intronic
1076836970 10:133025977-133025999 CTGAAGAGAGAGGTGGGTGGAGG + Intergenic
1077044539 11:538575-538597 CTGTTGACAGAGGTGGTGGGTGG - Intronic
1077304856 11:1864444-1864466 CTGAGGGCAGAGGCGGAGGGAGG + Intronic
1077414393 11:2418027-2418049 CTGAAGCGAGAGTGGGTGGGGGG + Intronic
1078677153 11:13432193-13432215 CAGAGGTCAGAGTTGGAGAGAGG + Intronic
1078966412 11:16349651-16349673 CAGAAGAAAGAGAGGGAGGGAGG + Intronic
1079008031 11:16806400-16806422 CTGATGACAGAGATGCTGGGGGG - Intronic
1079082141 11:17421077-17421099 GTGCAGACAGAGCTGCAGGGTGG - Intronic
1079122445 11:17695701-17695723 CTGAGGACAGAGATGGAGGCCGG + Intergenic
1079411292 11:20190226-20190248 CTGAAGAAAGAGTAGGAGTGAGG - Intergenic
1081222839 11:40483236-40483258 CTGGAGACAAAGCTAGAGGGAGG + Intronic
1081625423 11:44652466-44652488 CTGGAGACAGGTTTGGAGGGTGG + Intergenic
1081776208 11:45677625-45677647 TTGAAGCCAGAGGTGGAGAGTGG + Intergenic
1081961075 11:47137948-47137970 CTGAAGATAGAGTTGGAGGGTGG + Intronic
1081961250 11:47139214-47139236 CTGAAGACAGAGTTGGAGGGTGG + Intronic
1083233252 11:61336429-61336451 CTGAAGACAGAGTGAGACTGGGG - Intronic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083297881 11:61724967-61724989 ATGAAGCCAGGGTTGGAGAGCGG + Intronic
1083457731 11:62790183-62790205 CTGCAGGAAGAGGTGGAGGGGGG - Exonic
1083657411 11:64236122-64236144 CAGGAGACAGGGTTGGGGGGAGG + Intronic
1083840138 11:65299558-65299580 CAGAAGGCAGAGCTGGATGGAGG - Intronic
1083879701 11:65542041-65542063 CTGAGCACAGAGTTGGGGAGTGG - Intronic
1083894767 11:65614266-65614288 CGGGAGGCAGAGGTGGAGGGTGG + Intronic
1084519012 11:69651436-69651458 CTTAAGTCAGAGATGGAAGGGGG - Exonic
1084718495 11:70889249-70889271 GTGAAGACAGAGGCGGAGGCTGG + Intronic
1084768985 11:71330486-71330508 CTCAAGAAAGAGGTGGGGGGAGG - Intergenic
1084942808 11:72622687-72622709 CTGGAGACAGAGGAGGATGGGGG + Intronic
1084974205 11:72787708-72787730 CTGAGCACAGAGCTGAAGGGAGG - Intronic
1085171523 11:74453652-74453674 CAGACGACTGGGTTGGAGGGAGG + Intergenic
1085670526 11:78460081-78460103 CTGAAGACACAGAAGAAGGGTGG + Intronic
1086250413 11:84805608-84805630 AGGAAGACAGAGATGGGGGGAGG - Intronic
1087804308 11:102539185-102539207 CTGAAGGCTGAGTGGGAGTGGGG + Intergenic
1088031953 11:105262075-105262097 GGGAAGAAAGAGCTGGAGGGAGG + Intergenic
1088640895 11:111871722-111871744 CGGAAAAGAGGGTTGGAGGGAGG - Intergenic
1088647248 11:111927000-111927022 CTGGAGGCGGAGCTGGAGGGGGG + Intergenic
1089627577 11:119761435-119761457 CAGCAGACAGAGGTGGTGGGAGG - Intergenic
1090407825 11:126487957-126487979 CAGAAGGCGGAGGTGGAGGGAGG + Intronic
1090410957 11:126509350-126509372 CTGAAGCCAAGCTTGGAGGGTGG - Intronic
1090984177 11:131751048-131751070 CTGAAGAGTGATTAGGAGGGTGG - Intronic
1091022146 11:132109789-132109811 TGGAAGAAAGAGTGGGAGGGAGG - Intronic
1091654244 12:2333661-2333683 CTGCAGAGAGAGATGGAGGTTGG + Intronic
1091713596 12:2760360-2760382 CTGAGGATAAAGATGGAGGGAGG + Intergenic
1091761710 12:3091853-3091875 CTGAAGACTGTGTTGGAGGAGGG + Intronic
1091838490 12:3602619-3602641 CTGAAGAAAGAGTAGAAGGATGG - Intergenic
1092479552 12:8847711-8847733 CTGCTGACAGAGTGGGAGGAGGG + Intronic
1093622142 12:21304825-21304847 CTGAACACTGAGTTGGGAGGAGG - Intronic
1093623079 12:21315264-21315286 CTGAAGACTGAGTAGAAGTGGGG - Intronic
1094076130 12:26475910-26475932 CTCAAGCAAGAGGTGGAGGGTGG + Intronic
1095351584 12:41220274-41220296 CTGAAGACACAGCAAGAGGGTGG - Intronic
1096386162 12:51196768-51196790 CCAAAGACAGGGCTGGAGGGTGG - Intronic
1096743709 12:53712375-53712397 CAGCAGACGGAGATGGAGGGAGG - Intronic
1096814937 12:54196041-54196063 TTGAAGAGGGAGCTGGAGGGTGG - Intergenic
1098003538 12:65970771-65970793 CTGAAGACTGAGGAGGAGGTTGG - Intergenic
1098237643 12:68433093-68433115 TTGGAGAGAGAGTGGGAGGGAGG - Intergenic
1099220746 12:79911186-79911208 CTGAAAAAAGAGTGGGAGGATGG - Intronic
1100129836 12:91478066-91478088 CTGAAGACAGAATTAAGGGGAGG + Intergenic
1102013388 12:109632585-109632607 GTGCAGAGAGAGTGGGAGGGTGG + Intergenic
1102290083 12:111692305-111692327 GTGAAGAAAGAATTGGAGAGAGG + Intronic
1102343219 12:112140122-112140144 CTTAAGACTGAATTGGAGGCCGG + Intronic
1102412903 12:112735751-112735773 CTGAAGAAAGGCTTGGGGGGAGG - Intronic
1102554985 12:113720877-113720899 ATGGAGTCAGAGTTGGGGGGAGG + Intergenic
1102646479 12:114407064-114407086 CTGGAGAAAGGGATGGAGGGAGG + Intronic
1103166913 12:118778197-118778219 TTGAAGACAGAGGTGGAGACTGG + Intergenic
1104166734 12:126238806-126238828 TAGAAGGCAGAGTTGGAGTGAGG - Intergenic
1105715661 13:23061427-23061449 AGGAAGAAAGAGATGGAGGGGGG + Intergenic
1106080209 13:26494050-26494072 CTGATGAGAGAGTTTGAGTGTGG - Intergenic
1107086159 13:36430402-36430424 CTGAAGCCAGTGTTGGAGTCGGG - Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1107931043 13:45307671-45307693 CTGTTGACAGAAATGGAGGGAGG + Intergenic
1109211656 13:59542174-59542196 CTGAAGATAGATTTGGGGGAAGG - Intergenic
1110411286 13:75206067-75206089 CAGAAGACAAAGTGGGAGGGAGG + Intergenic
1111463540 13:88577122-88577144 TGGCAGAAAGAGTTGGAGGGAGG + Intergenic
1111556692 13:89890121-89890143 AGGAAGACAGAGTAGGGGGGAGG - Intergenic
1111720468 13:91937404-91937426 CAGAAGAGCGAGTTGGAGGTGGG + Intronic
1112109242 13:96276251-96276273 CAGAAGACAGGGCTGGAGGGAGG - Intronic
1112184804 13:97117368-97117390 CAGAAGACAGAGTTGCAGGAAGG + Intergenic
1112496711 13:99911060-99911082 TTGGAGACAGAGTCAGAGGGAGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113127726 13:106999038-106999060 CTGAAGAAAGAGGAAGAGGGAGG - Intergenic
1113263321 13:108590713-108590735 GTGAAGACAGAGGTGGAGATCGG + Intergenic
1113351610 13:109535036-109535058 CTGAAGCCAGAGGTGAAGGTGGG - Intergenic
1113737386 13:112688768-112688790 CTGCAGACCGGGTAGGAGGGAGG - Intergenic
1113778709 13:112963539-112963561 CTGGAGACACAGGTGCAGGGAGG - Intronic
1114332358 14:21650370-21650392 AGGAAGGCTGAGTTGGAGGGTGG - Intergenic
1114454504 14:22846247-22846269 CTGAGGGCTGAGTGGGAGGGCGG + Exonic
1114492593 14:23112773-23112795 TTGAAGGCAGGGCTGGAGGGAGG + Intergenic
1114564370 14:23618746-23618768 GTGGGGACTGAGTTGGAGGGAGG + Intergenic
1115145931 14:30225827-30225849 CTGAGGTGAGAGTTGGGGGGAGG + Intergenic
1115435645 14:33369989-33370011 ATGAAGAAAGAGTAGGAAGGAGG - Intronic
1116912759 14:50488651-50488673 CTGGAAACACAGTTGCAGGGTGG - Intronic
1117243795 14:53862842-53862864 CTGAAAAAAAAGTTGGTGGGTGG - Intergenic
1117331891 14:54720800-54720822 CTGAAGGCAGGGGTGCAGGGAGG - Intronic
1118346711 14:64946355-64946377 CTGAAGACAGACTTGAGGGCTGG + Exonic
1118550736 14:66946947-66946969 TTGAAGACTGAATTGAAGGGAGG - Intronic
1119184303 14:72628657-72628679 ATGGAGACAGAGTTGGTGAGAGG + Intronic
1119443857 14:74647746-74647768 ATGAAGACAGAGGGAGAGGGAGG - Intergenic
1119704950 14:76777717-76777739 CTGAAGGCAGAGTGGAAGTGGGG - Intronic
1120037070 14:79709800-79709822 CTGAAGACAGACAAGGAGAGAGG + Intronic
1120524232 14:85559275-85559297 CTGAAAACAGAGTAGAAGAGGGG + Intronic
1120691900 14:87602088-87602110 GTGTAGAGAGAGGTGGAGGGAGG - Intergenic
1120736614 14:88060160-88060182 ATGGAGACAGAGTAGGAGGATGG + Intergenic
1120770930 14:88379889-88379911 CAGTAGATTGAGTTGGAGGGTGG - Intergenic
1120922958 14:89771870-89771892 GTGAAGACAGTGCTGGTGGGGGG - Intergenic
1121220961 14:92285090-92285112 CTCTTGACAGGGTTGGAGGGGGG + Intergenic
1121463281 14:94098341-94098363 GTGAAGACAGAGATGGAGATGGG - Intronic
1122048583 14:99040208-99040230 CTGCAGACAGGGATGGACGGGGG + Intergenic
1122408758 14:101515360-101515382 CTGAGGACAGACATGGATGGTGG - Intergenic
1122689429 14:103524743-103524765 CTGGAGGCAGACTTGGGGGGAGG + Intergenic
1122778578 14:104134085-104134107 CTGGAGAGAGAGTAGGAGTGGGG - Intergenic
1122935810 14:104955584-104955606 CTGAAGACAGAGGTGGAGGCAGG - Exonic
1122984794 14:105207119-105207141 CTTGAGCCAGAGTTGGAGGGTGG - Intergenic
1123040721 14:105489221-105489243 ATGAGGACAGGGTTGGGGGGTGG - Intronic
1124070443 15:26388037-26388059 CTGAAAACAGAGCAGGAGGTTGG - Intergenic
1124126953 15:26945028-26945050 CTGAATGGAGGGTTGGAGGGAGG + Intronic
1126191626 15:45884907-45884929 TTGAAGAGAGAGTTGGATGAGGG + Intergenic
1127839799 15:62821279-62821301 CTGAAGACAGCTATGGAAGGTGG - Intronic
1128316595 15:66663277-66663299 CTGGAGACTGGGTTGGAGTGGGG - Intronic
1128809347 15:70559378-70559400 CTGGAGACAGAAGGGGAGGGAGG + Intergenic
1129003841 15:72355802-72355824 CTGGGGCCAGAGTGGGAGGGTGG + Intronic
1129295808 15:74599457-74599479 CTGAAGGCGCAGATGGAGGGAGG + Intronic
1130031886 15:80322970-80322992 CTGGAGACAGAGTGGGGTGGAGG - Intergenic
1130253420 15:82315019-82315041 CTGAAGACAGGTGTGGAGAGAGG - Intergenic
1130854157 15:87826234-87826256 CTGCACACAGAGGTGGAAGGCGG - Intergenic
1131284332 15:91044602-91044624 CTGAAGACAGAGGCAGAGGTGGG - Intergenic
1131341198 15:91602703-91602725 CTGATGTCAGAGTTTGAGGGAGG + Intergenic
1131732990 15:95301731-95301753 ATGAAGACAGAGTAGAATGGTGG + Intergenic
1132307689 15:100828671-100828693 CTGAACACAGAGTTGGCAAGAGG - Intergenic
1132338349 15:101063095-101063117 CGGGAGGCAGAGATGGAGGGAGG - Intronic
1133691748 16:8222328-8222350 ATGAACACAGAGTGGGAGAGAGG + Intergenic
1133732674 16:8590125-8590147 CTGAAGGCGGAGGTGGAGGTCGG - Intergenic
1133962974 16:10510558-10510580 GTGAAGACAGAGGTGGAGATTGG + Intergenic
1133993454 16:10728607-10728629 CTGAAAACGGGGGTGGAGGGTGG + Intergenic
1135052879 16:19206705-19206727 GTGAGGACAGAGGTGGAGGCTGG - Intronic
1135240833 16:20806226-20806248 CTGAAGACCGAGGTCCAGGGAGG + Intronic
1136246398 16:28978702-28978724 CTGAGGACAGAGTTCTGGGGTGG - Intronic
1137508506 16:49077711-49077733 ATGAAGCCAGAGATGCAGGGAGG + Intergenic
1137646557 16:50080123-50080145 ATGAAGGCTGAGTTGGAAGGAGG + Intronic
1137878509 16:52021258-52021280 ATGAAGGCAGAAATGGAGGGAGG - Intronic
1138189977 16:55006877-55006899 CTGAAGAGATATTTGGAGGCCGG + Intergenic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1141233002 16:82188101-82188123 ATGAGGACTGAGTTGGAAGGGGG - Intergenic
1141622848 16:85246505-85246527 CTGCAGACAGCGTCGGGGGGGGG - Intergenic
1141740050 16:85885116-85885138 CTGAATCCAGAGATGGGGGGTGG - Intergenic
1141742799 16:85905211-85905233 CTGAAGGCACAGTTGCAGGTTGG + Intronic
1142052407 16:87967321-87967343 CTGAGGTCAGAGTTGGAGAGCGG - Intronic
1142624613 17:1183792-1183814 CTGAATACACAGTGGGTGGGAGG + Intronic
1142883550 17:2898665-2898687 CAGAAGGCAGAGGTGGACGGGGG - Intronic
1143626186 17:8111354-8111376 CTGCAGACAGAGCTAGAGGTGGG - Exonic
1144246361 17:13369674-13369696 CAGAAGAAAGGGTGGGAGGGAGG + Intergenic
1144490413 17:15704164-15704186 TTAGAGACAGAGTTGGAGGGAGG + Intronic
1144910554 17:18677805-18677827 TTAGAGACAGAGTTGGAGGGAGG - Intronic
1144953370 17:19005429-19005451 CTGAAGGCAGGCTTTGAGGGTGG + Intronic
1145122888 17:20276848-20276870 CAGAAGTCAGAATTGGAGGCAGG + Intronic
1145252030 17:21301951-21301973 GTGCAGGCAGAGTTGGAGGGTGG + Intronic
1146370211 17:32261429-32261451 CTGGAGATGGAGGTGGAGGGTGG + Intergenic
1147211113 17:38872925-38872947 CTGATGACAGTGTTTGAGGAAGG + Intronic
1147379084 17:40042108-40042130 TTGAAGAACGAGTTGGAGGGAGG - Intronic
1147443445 17:40461217-40461239 CTGAAGACAGAGGTTGAGGTTGG + Intergenic
1147571705 17:41575567-41575589 CTTAAGACAGGGCTGGAGGGTGG - Intergenic
1148097711 17:45064938-45064960 CTGAAGAAAGAGGAGGAGGGAGG - Intronic
1148132445 17:45270356-45270378 CAGAAGACAGAGGTGGACAGAGG - Intronic
1148596371 17:48859188-48859210 AAGAAGACAGGGTGGGAGGGAGG - Intronic
1150382216 17:64729764-64729786 CTGAAGGCGGGGTTGCAGGGAGG + Intergenic
1150774047 17:68065076-68065098 CTGAAGGCAGGGTTGCAGGGAGG - Intergenic
1151337173 17:73446843-73446865 CCCAAGACAGAGAAGGAGGGAGG - Intronic
1151418248 17:73980869-73980891 ATGAATACAGATTTGTAGGGAGG + Intergenic
1152008118 17:77695091-77695113 TTGAAGCCAGAGTAGGAGGCAGG - Intergenic
1152291446 17:79442190-79442212 CAGAAGAGAGAGGAGGAGGGAGG + Intronic
1152463113 17:80451524-80451546 CTGAGGAGCGAGTTGGGGGGTGG + Intergenic
1152492313 17:80645080-80645102 CTGGAGAGAGATTTGGATGGTGG + Intronic
1152583720 17:81180093-81180115 CTGGAGACAGGGTGGGAGGCAGG - Intergenic
1152585787 17:81188897-81188919 GTGTAGACGGAGGTGGAGGGAGG + Intergenic
1152935802 17:83135971-83135993 CTGCAGACAGACATGCAGGGAGG - Intergenic
1153741926 18:8138384-8138406 CAGAAGACAGGGTTGGAAGGGGG - Intronic
1154028326 18:10727170-10727192 CTCAACACAGAGCTGGAGGCAGG - Intronic
1154087187 18:11318845-11318867 CTGAAGACAAAGTCTGAGGGTGG + Intergenic
1155185115 18:23380567-23380589 CTTAACGCAGAGTTGGATGGAGG - Intronic
1155419618 18:25641039-25641061 CTGAAGAAAGACTTCGAGTGGGG - Intergenic
1155515295 18:26618437-26618459 CTGAGGACAGAGTAGGTAGGTGG - Intronic
1155589257 18:27406892-27406914 CAGAAAACAGAGATGGAGGGAGG + Intergenic
1156305265 18:35873345-35873367 CTGATGGCACAGTTGGAGGAGGG - Intergenic
1156506103 18:37595149-37595171 GTGAAGCCAGGGTTGGAGTGCGG - Intergenic
1157100636 18:44725808-44725830 AAGAAAACGGAGTTGGAGGGGGG - Intronic
1158005268 18:52664911-52664933 CTGCATTCAGTGTTGGAGGGAGG - Intronic
1158274930 18:55756897-55756919 CTTAAGCCAGAGTTGGAAGAGGG - Intergenic
1158294788 18:55983798-55983820 CTGAACATAGAGTTGGAGTAAGG + Intergenic
1158677654 18:59536382-59536404 TTGAAGGAAGAGCTGGAGGGTGG - Intronic
1159305838 18:66640939-66640961 ATGAAGACATAGTGAGAGGGTGG - Intergenic
1160391900 18:78540350-78540372 CTGAAGATGGAGGTGGAGGCTGG + Intergenic
1160689904 19:456706-456728 TTGCAGACAGAGTTCTAGGGGGG - Intronic
1160851599 19:1195456-1195478 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1160852023 19:1197270-1197292 CTGGAGGAAGAGATGGAGGGAGG + Intronic
1162936491 19:13984090-13984112 CTGAGGACAGAGGGGCAGGGAGG - Intronic
1163159462 19:15456307-15456329 CTGAAGACAAGGTTGGAGGATGG - Intronic
1163383676 19:16985828-16985850 ATGGAGAGAGAGATGGAGGGTGG + Intronic
1163911412 19:20197622-20197644 GTGAAGAAAGAGTTGCAGGATGG - Exonic
1165051150 19:33142377-33142399 CTGGAGAAAGTGGTGGAGGGAGG + Intronic
1165436237 19:35797027-35797049 ATGAAGACAGAGCTGGCTGGGGG + Intergenic
1165481504 19:36067193-36067215 AGGAAGACAGACTTGGAGTGGGG + Intronic
1166040369 19:40198610-40198632 GTGAGGGCAGAGTGGGAGGGAGG + Intronic
1166072628 19:40395783-40395805 CTGAAGGCAGAGTGAGAGAGGGG + Exonic
1166108138 19:40607590-40607612 GTGAACTCAGGGTTGGAGGGTGG - Intronic
1166585603 19:43945332-43945354 CAGAAGACAGAGCTGGAGAAGGG - Intergenic
1167283997 19:48588680-48588702 CTGGAGATAGAGTTAGAGGTGGG + Intronic
1167369414 19:49071895-49071917 CCGAAGACAGGGTGGGCGGGAGG - Intronic
1168300329 19:55401368-55401390 TTAGAGACAGAGTTGGAGGGAGG + Exonic
1168684166 19:58337929-58337951 CTGGAGACAGAGAGAGAGGGAGG - Intronic
925183484 2:1831756-1831778 ATGAAGACAGAGTTGCATGGTGG - Intronic
925221392 2:2144217-2144239 CTGAGGGCAGAGCAGGAGGGAGG - Intronic
925696077 2:6580538-6580560 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
925696091 2:6580729-6580751 GTGAAGACAGAGGTGGAGGGTGG - Intergenic
926211093 2:10869948-10869970 GTGAAGACAGAGGTGGAGACTGG + Intergenic
927113291 2:19879284-19879306 CTGAAGACAGGGTTGGGAGGTGG - Intergenic
927114862 2:19889769-19889791 GTGAAGACAGAGGTGGAGACTGG - Intergenic
929218678 2:39441217-39441239 CTGAAGACAGAGGGAGATGGTGG + Intergenic
929225756 2:39510440-39510462 CTGAACACAGAGTTGGGAGGTGG + Intergenic
929925236 2:46202031-46202053 CTGAAGTCGGAATTGGAGGGTGG + Intergenic
930191419 2:48463813-48463835 CAGTAGACCGAGGTGGAGGGTGG + Intronic
931264629 2:60649805-60649827 AGGAAGGGAGAGTTGGAGGGAGG + Intergenic
931474237 2:62571341-62571363 CTGGAGATGGAGTTGGAGGTGGG - Intergenic
931618424 2:64185665-64185687 TTGAAGACAGAGTTCCAGGCTGG - Intergenic
932410079 2:71542022-71542044 CTGAAGGCAGAGTGGGGGAGTGG + Intronic
932501316 2:72185327-72185349 GTGAAGACAGACATGGAGGAAGG - Intronic
932748586 2:74356187-74356209 CGGATGATAGAGATGGAGGGAGG + Intronic
933107504 2:78350549-78350571 CTGAAGAGATAGTTGGAGGTGGG + Intergenic
933294348 2:80472358-80472380 GTGAAGACTGACTTGGAGGGAGG + Intronic
933539116 2:83616585-83616607 GTGATGACAGAGTTGGAAGAGGG + Intergenic
934567956 2:95350974-95350996 CTGAAGCCAGAGTTGGGAGTTGG + Intronic
934697924 2:96413595-96413617 CAGAAGACAGAGTTACAGGGAGG + Intergenic
936252547 2:110877768-110877790 GTGAAGACAGAGAGGAAGGGAGG + Intronic
936377826 2:111957412-111957434 CTGAGGAAAGAGTAGGAGTGAGG - Intronic
936474178 2:112825093-112825115 TGGAAGACAGACTTGGTGGGTGG - Intergenic
936805775 2:116330662-116330684 CAAAAGACAGTGTTAGAGGGAGG + Intergenic
937305777 2:120869751-120869773 CTGAAGACAGAGGAGTAGAGTGG + Intronic
938769903 2:134492510-134492532 CTGAGGCTAGAGGTGGAGGGAGG - Intronic
939437946 2:142202990-142203012 CTGAAGACTGAGGTGGCTGGGGG - Intergenic
940076851 2:149751413-149751435 CTGAACAAGGAGTTGGAGTGGGG - Intergenic
940652843 2:156454681-156454703 CAGAGGGCAGAGTGGGAGGGAGG + Intronic
941590330 2:167412008-167412030 ATGAAGACAGAGTGGAATGGTGG + Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
943180943 2:184540340-184540362 AGGAAGAGAGAGTGGGAGGGAGG + Intergenic
943317532 2:186408824-186408846 CTGAAAACATAGTTGGTGCGTGG - Intergenic
944073280 2:195697058-195697080 CTGAGGACAGAGGTGGAAGAGGG + Intronic
944354411 2:198768848-198768870 ATGAAGAGAGACTTGGAGGTAGG - Intergenic
945594695 2:211777049-211777071 GTAAAGGCAGAGATGGAGGGAGG + Intronic
946695577 2:222355149-222355171 GTGAAGACAGAGGGGGAGGACGG - Intergenic
946703163 2:222432693-222432715 CAGAAGCCAGAGGTGGAGGGGGG + Intronic
946881007 2:224177092-224177114 GTGAAGACAGAGTGAGAAGGTGG - Intergenic
947301998 2:228698033-228698055 CTGAAGACAAAGCAGGAGGAAGG + Intergenic
947315345 2:228851625-228851647 CTGGAGACAGGACTGGAGGGGGG + Intronic
947352315 2:229258937-229258959 CTGAGGATGGACTTGGAGGGAGG - Intronic
947369374 2:229428803-229428825 AAGAAGTCAGAGGTGGAGGGAGG + Intronic
947634450 2:231673019-231673041 CTGAGGGCAGATCTGGAGGGAGG + Intergenic
948063415 2:235058814-235058836 GGGAGGACAGAATTGGAGGGAGG - Intergenic
948528496 2:238588158-238588180 GTGAAGACAGAGGCGCAGGGTGG - Intergenic
948588971 2:239037529-239037551 CTGAAGGGAGAGTCGGAGAGAGG - Intergenic
948729123 2:239952284-239952306 CTGAAGGCAGAGTGGGGAGGGGG + Intronic
948822617 2:240557698-240557720 CTGAAGCCAGCGCTCGAGGGTGG + Intronic
1169350940 20:4867316-4867338 CTGAACACAGACCTGAAGGGTGG - Intronic
1169476004 20:5931786-5931808 CTGCACACAGATTTGGAGGATGG - Intergenic
1171311841 20:24150989-24151011 CTGGAGGCAGAGTTTGAGGCTGG - Intergenic
1171419847 20:25010736-25010758 CTGAGGATGGAGCTGGAGGGAGG + Intronic
1172244816 20:33438669-33438691 CTGAAGACAGTGTGGGGTGGTGG - Intronic
1173140561 20:40478278-40478300 CTGAACACAGAGTGGGAGAATGG - Intergenic
1173189396 20:40864641-40864663 CTGAAGGAAGGGATGGAGGGAGG + Intergenic
1173431068 20:42987560-42987582 CTGAAGACAGGGTGGGTGGCTGG - Intronic
1173850456 20:46214581-46214603 CTGAAGCTAGAGATGGAGTGGGG - Intronic
1174406065 20:50304236-50304258 CTGGAGCAAGACTTGGAGGGTGG + Intergenic
1174787179 20:53443966-53443988 CTGAAGAGAGGTTTGGAGAGAGG + Intronic
1174925159 20:54751049-54751071 CTGGAAACAGACTTTGAGGGAGG - Intergenic
1175984129 20:62755636-62755658 ATGAAGGCAGGGATGGAGGGAGG - Intronic
1175984180 20:62755787-62755809 CTGAAGGGAGGGATGGAGGGAGG - Intronic
1176028388 20:62997997-62998019 GAGAAGAGAGAGTTGGAGCGTGG - Intergenic
1177254678 21:18645588-18645610 GTGAAGACAGAGGTGGAGAGTGG - Intergenic
1177811922 21:25934104-25934126 GTGAAGACAGAGGTGGAGATTGG + Intronic
1178280244 21:31276133-31276155 TTGAAGACGGTGTTGGGGGGTGG + Intronic
1179326632 21:40352840-40352862 CTGAAGGCAGATTTGGAGGAAGG - Intronic
1180206922 21:46266427-46266449 CTGAGGACAGAACTGGAAGGAGG + Intronic
1180613650 22:17113693-17113715 CTGAGGACAGAGTGAGATGGAGG + Exonic
1181364812 22:22367730-22367752 CTGGAGACAGAAGTGGATGGAGG + Intergenic
1181866810 22:25864557-25864579 CTGATCCCAGCGTTGGAGGGTGG + Intronic
1183279291 22:36923482-36923504 CAGAGGACAGAGGAGGAGGGAGG + Intronic
1183465754 22:37979704-37979726 CTTAGGCCAGGGTTGGAGGGTGG + Intronic
1183730228 22:39614439-39614461 CTGAAGCAAGAGCTGGAGAGAGG - Intronic
1184615724 22:45637020-45637042 CAGAAGACAGAGGTGGAGCAGGG - Intergenic
1184722204 22:46321431-46321453 CTGAAAACGGAGGTGGAGAGAGG + Intronic
1184978445 22:48079693-48079715 ATGAAGACAGACTTGCTGGGAGG + Intergenic
1185188722 22:49419029-49419051 CTGAAGACAGGGTCAGAGGGTGG - Intronic
949826845 3:8174565-8174587 ATGTAGCCAGAGTTGGAGGTGGG - Intergenic
949915972 3:8964897-8964919 ATGGAGACAGATTTGGAAGGAGG + Intergenic
950015064 3:9749610-9749632 GTGAAGACAGGGTTCGTGGGAGG + Intergenic
950548394 3:13652569-13652591 CTGGAGCCAGAGTTGAAGGGAGG + Intergenic
951688468 3:25370948-25370970 GTGAAGACAGAGATAGAGAGTGG - Intronic
952159731 3:30681593-30681615 CTGCAGAGAGAGGTGGCGGGAGG + Intronic
952166767 3:30758350-30758372 CGGAAGGAAGAGCTGGAGGGAGG - Intronic
952309700 3:32177171-32177193 CTGAAGCCAGAGTTGGGTGAAGG + Intergenic
953064355 3:39455728-39455750 CTGGAGATGGAGATGGAGGGTGG + Intergenic
953475412 3:43201850-43201872 CACAAGACAGAGTAGGATGGGGG + Intergenic
953545129 3:43858658-43858680 TTAAAGACAGAGGTGGAGGAGGG - Intergenic
953592425 3:44271912-44271934 CAGAGGACAGGGGTGGAGGGTGG - Intronic
953614837 3:44480584-44480606 CTGCAGAAAAAGATGGAGGGTGG - Intergenic
953793942 3:45968492-45968514 CTGCAGACAGAGAGGGAGAGGGG - Exonic
953836628 3:46351786-46351808 GTGAAGACAAAATTGGAGAGCGG + Intergenic
954195958 3:48997395-48997417 CTGCAGCCAGCGTTGCAGGGTGG + Intronic
954618944 3:51984977-51984999 CTGGACACAGGGTTGGAGGAAGG - Intronic
954658549 3:52213217-52213239 CTAAAGGCAGAGATGGAAGGGGG + Intronic
955562195 3:60203905-60203927 GTGAAGACAGAGTAGAAGGATGG + Intronic
956490637 3:69767782-69767804 ATGAAGAATGGGTTGGAGGGTGG + Intronic
957531977 3:81452011-81452033 CTGAAGAAAGACTTGGGGGTGGG + Intergenic
958450260 3:94264689-94264711 AAGAAGACAGATTTGGAGTGGGG + Intergenic
959686960 3:109158003-109158025 CAGAAGACAGAGAGTGAGGGGGG + Intergenic
960747810 3:120908789-120908811 CTGCGGGCAGAGGTGGAGGGAGG + Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
962254362 3:133860345-133860367 CTGAAGACAGAGGCGGAGAGTGG + Intronic
962937211 3:140092060-140092082 TTGCAGACAGACTTAGAGGGTGG - Intronic
963063374 3:141242566-141242588 CTGGAGACAGTGCTGGGGGGTGG + Intronic
964190580 3:153995904-153995926 ATGAAGACACAGTGAGAGGGAGG - Intergenic
964395789 3:156244290-156244312 GTGAAGACAGAACTGGAGGTTGG - Intronic
965007172 3:163041810-163041832 ATTAAGAGAGAGTTGGAAGGTGG + Intergenic
965179436 3:165383178-165383200 CTGAGGGAAGAGTTGGAGAGAGG + Intergenic
965857479 3:173105764-173105786 ATGAAGACAGGGAGGGAGGGAGG - Intronic
965892051 3:173526771-173526793 ATGAAGACAGAGTAGAAGGATGG - Intronic
966305988 3:178535240-178535262 AGGAAGACAGAGAGGGAGGGAGG + Intronic
966496723 3:180589991-180590013 CAGAAGACAGAGGTGGTGTGTGG - Intergenic
966841508 3:184092753-184092775 CTAAAGACAGAGTTTGAGGCTGG - Intergenic
967329527 3:188276654-188276676 AGAGAGACAGAGTTGGAGGGTGG - Intronic
967817034 3:193808379-193808401 GTGAAGACAGAGGTGGAGACCGG - Intergenic
967833676 3:193943253-193943275 CTGAAAACAGGGTAGGAGGAGGG - Intergenic
968463158 4:735978-736000 CTGAAGACACATTTTGAAGGAGG + Intronic
968702997 4:2065454-2065476 GGGGAGACAGAGGTGGAGGGTGG + Exonic
969112152 4:4850966-4850988 CTGAGGTCAGAGGTGGAGGCTGG + Intergenic
969332778 4:6489376-6489398 CTGAAGCCCGATGTGGAGGGAGG - Intronic
969469834 4:7381323-7381345 CGGAGCACAGAGCTGGAGGGCGG + Intronic
969538766 4:7772872-7772894 CTGAAGAAAGCGCTGGCGGGCGG - Exonic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
971155908 4:24082775-24082797 TTCAAGAAAGAGTTGGAGGAGGG + Intergenic
971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG + Intergenic
972796095 4:42421192-42421214 ATGAAGAAAAAGGTGGAGGGAGG + Intronic
973621399 4:52729749-52729771 TTGAAGACAGAGCTGGAGTAAGG + Intronic
973630032 4:52811624-52811646 CTGGTGAAGGAGTTGGAGGGAGG + Intergenic
975528191 4:75373947-75373969 CTGAGGACACAGCTAGAGGGAGG + Intergenic
976085992 4:81407682-81407704 CTGAAGAAAGGGATGGAGGATGG + Intergenic
976306053 4:83560526-83560548 CTGAGGACAGATTTTGTGGGTGG + Intronic
977747260 4:100564221-100564243 CGGAGGAAAGAGTGGGAGGGGGG + Intronic
978606027 4:110480771-110480793 CTGGGGACAGAGTTGTAGTGGGG + Intronic
979086543 4:116417723-116417745 TTGGAGACAGAGTAGGAGGTAGG + Intergenic
979363799 4:119796262-119796284 CTTAAGAGAGAGTAGGAGGAAGG + Intergenic
979481006 4:121217428-121217450 CTGTACATAGTGTTGGAGGGTGG + Intronic
980992925 4:139753938-139753960 CTGGAGACTGGGGTGGAGGGAGG + Intronic
981130134 4:141149382-141149404 CTGGGGAAAGAGTGGGAGGGGGG - Intronic
981603511 4:146518740-146518762 GTGATGACAGAGGTGGAGGCTGG + Intronic
981747916 4:148068837-148068859 CTGAAAACTGAGTTGGTGGAAGG + Intronic
982699834 4:158647940-158647962 CAGAAGGCAGAGTTGCAGTGAGG + Intronic
983559144 4:169083922-169083944 CTGAAGAGAGTGTTGGGGGCTGG + Intergenic
984473201 4:180203482-180203504 CTGAGAAAAGAGTAGGAGGGAGG + Intergenic
984565867 4:181329511-181329533 CAGAAGACAGAGTTGGAAGTTGG - Intergenic
984876865 4:184376621-184376643 GTGAAGACAGAGGTGGAGTTTGG + Intergenic
984988016 4:185350296-185350318 CTGATGACAGAGTGTGGGGGAGG - Intronic
985812012 5:2097197-2097219 CTGAGAACAGAATTGGAGGCGGG - Intergenic
986383827 5:7211481-7211503 GTGAAGACAGAGGTAGAGGCTGG - Intergenic
986827429 5:11536720-11536742 CAGAAGAAAGGGTGGGAGGGGGG + Intronic
988781862 5:34529603-34529625 CTCAAAACAGAGGTGGAGTGGGG - Intergenic
989553283 5:42760612-42760634 GTGAAGCAAGAGTGGGAGGGAGG + Intronic
990432453 5:55749644-55749666 GTGAGGACAGAGTGGGAGGAAGG - Intronic
990861469 5:60332327-60332349 CCGAAAACAGAGAGGGAGGGGGG - Intronic
990908807 5:60833076-60833098 TTGTAGACAAAGATGGAGGGGGG + Intronic
991018920 5:61959798-61959820 CTGAAGTAAGAGTAGGAGGCAGG - Intergenic
991596104 5:68307431-68307453 CTGAACACAGAGTTGGGAGGAGG + Intergenic
991922638 5:71671916-71671938 GTGAAGAGAGCATTGGAGGGCGG - Intergenic
993877939 5:93329882-93329904 CAGAAGCCAGAGTTGGGGGATGG - Intergenic
994520234 5:100824652-100824674 CTGAAAAAAAAGGTGGAGGGGGG + Intronic
995063543 5:107837000-107837022 ATGGAGACAGAGTAGGAGAGAGG - Intergenic
995173243 5:109142132-109142154 GTGAAGATAGAGTGGGAAGGAGG + Intronic
995771131 5:115671652-115671674 ATGAAGACAGAGTAGAAGGATGG + Intergenic
998163314 5:139825818-139825840 CTGAAGACAGAGATGGGGTGGGG + Intronic
998394138 5:141807187-141807209 CTTAAGACAGAGAAGGATGGAGG + Intergenic
999316582 5:150588208-150588230 CTCAAGAGGGAGTTGGAGGTTGG - Intergenic
999456407 5:151720006-151720028 ATCCAGACAGAGGTGGAGGGAGG - Intergenic
1000131963 5:158308919-158308941 CTGAAGACATAGAAGAAGGGAGG - Intergenic
1000319088 5:160119405-160119427 CTGCAGCCGGAGTTGGAGGAGGG - Exonic
1000398269 5:160798471-160798493 ATGAAGACAGAGGTAGAGGTTGG + Intronic
1000616201 5:163430317-163430339 GTGAAGACAGAGTAAGAAGGTGG + Intergenic
1001689348 5:173621323-173621345 GTGAAGACAGAGGTAGAGGATGG - Intergenic
1002084598 5:176765369-176765391 CTGAATACAGATTTGCAGGTTGG + Intergenic
1002790580 6:434768-434790 CTGGACACACAGGTGGAGGGAGG - Intergenic
1002965934 6:1966592-1966614 GTGATGACACAGCTGGAGGGTGG - Intronic
1003255706 6:4472998-4473020 AGGAAGGCAGAGTTGGAGGATGG - Intergenic
1003362099 6:5437061-5437083 CTGAAGACAGGGATGGGTGGAGG - Intronic
1003482763 6:6547962-6547984 CTGAAAACTGAGTTGCAGTGAGG - Intergenic
1003978300 6:11365022-11365044 CTGGAGCAAGAGTTGGAGGTGGG + Intronic
1004069921 6:12288612-12288634 CTGAAGCAAGAGTTGGAGATGGG - Intergenic
1004291778 6:14374125-14374147 CAGAAGAAAGAATTGGACGGAGG + Intergenic
1004319463 6:14621319-14621341 GTGCAGACAGAGAGGGAGGGTGG - Intergenic
1004822790 6:19386030-19386052 CAAAAGAGAGAGTGGGAGGGTGG + Intergenic
1005865806 6:29935136-29935158 GAGAAGAAAGAGATGGAGGGAGG - Intergenic
1006627552 6:35408108-35408130 CAGAAGACAGGGTAGGAGGGTGG - Intronic
1007091211 6:39185934-39185956 CTGAAGAGAGAGGTGGGGCGGGG + Intergenic
1007699411 6:43758069-43758091 TTTAAGACAGAGTTGGGGTGAGG - Intergenic
1008547475 6:52595989-52596011 CTGAACAGAGAGTTGGGGGATGG - Intergenic
1008602611 6:53110591-53110613 ATGAGGAGAGAATTGGAGGGAGG - Intergenic
1009764938 6:68060166-68060188 CTGGAGACAAACTTGGAGCGAGG + Intergenic
1010189803 6:73183489-73183511 CTGGACACAGAGCTGGATGGCGG - Intronic
1010345977 6:74811265-74811287 AAGAAGACAGAGAGGGAGGGAGG + Intergenic
1011303599 6:85902183-85902205 CTGAACACAGAGTAGCAGAGGGG + Intergenic
1012391089 6:98740925-98740947 CAGGTGAGAGAGTTGGAGGGTGG + Intergenic
1013300852 6:108803772-108803794 GTGAAGAAAGTGTTTGAGGGAGG + Intergenic
1013318083 6:108960398-108960420 CTGGAGACTGAGTGGGAGGCAGG + Intronic
1013475808 6:110506311-110506333 CTGGAAACAGAGATGGAGGAAGG - Intergenic
1013601991 6:111713540-111713562 CTGAAGAAAGTGTGGGGGGGTGG - Intronic
1013804478 6:113982267-113982289 CTGGACACAGAGTGGGAGGGTGG - Intronic
1015478435 6:133679675-133679697 ATGAAGACAGAGATGGAAGGAGG + Intergenic
1016839001 6:148507168-148507190 CAGAAGACAGAGTGGGAGAAGGG + Intronic
1017131709 6:151113517-151113539 CCCAAGACAGAGGTGGAGGCAGG + Intergenic
1017806113 6:157946928-157946950 CTGAAGACAGAATGAGAGTGAGG + Intergenic
1019473974 7:1235368-1235390 CCGAAGACAGGTGTGGAGGGCGG + Intronic
1019934121 7:4243156-4243178 CAGAAGACAGAGTTGCAGCAAGG - Intronic
1021514070 7:21463701-21463723 TTGAAGACAGAGTTTGAGCTGGG + Intronic
1021841640 7:24726032-24726054 CGGCAGGCAGAGATGGAGGGAGG + Intronic
1021997138 7:26190654-26190676 CTGAAGAGAAAGTTGTAGGTTGG - Exonic
1022550816 7:31237448-31237470 CTGAGGAAACAGTTGCAGGGAGG - Intergenic
1022834388 7:34100049-34100071 TTGAAGAGAGAGAGGGAGGGAGG - Intronic
1023043598 7:36193482-36193504 CTGAAGGCAGAGGCAGAGGGAGG + Intronic
1023624626 7:42103581-42103603 CTGAAGAAATAGTTGCAGAGAGG - Intronic
1023680684 7:42684389-42684411 CTGAAGATAGAGGCAGAGGGAGG + Intergenic
1023808531 7:43892511-43892533 GTGAAGACAGAGGTGGAAGCTGG - Intronic
1023983995 7:45084897-45084919 CAGAAGACAGAGGAGGAGAGCGG - Exonic
1024118297 7:46213147-46213169 CTGAAGACAGAGTTGGAGAGGGG + Intergenic
1024134204 7:46390047-46390069 CTGGGGAAAGAGTTGGAGAGAGG + Intergenic
1024512195 7:50212990-50213012 CTGGAGAAAGAGTGGGAGGCAGG + Intergenic
1025625689 7:63219230-63219252 CTGAGGTCAGAGTCGGAGAGTGG - Intergenic
1029673098 7:102047481-102047503 ATGAAGGGAGAGATGGAGGGAGG + Intronic
1029926581 7:104325807-104325829 CTAAGGACAAAGTTGGGGGGTGG + Intergenic
1031106579 7:117550809-117550831 ATGAAGGCAGAGTTAGAGGAAGG + Intronic
1031152384 7:118069608-118069630 CAGAAGGGAGAGTTGGTGGGTGG - Intergenic
1032411184 7:131694182-131694204 CTGAGAAGAGAGGTGGAGGGAGG + Intergenic
1032655218 7:133921128-133921150 CTGAGAACAGGGTTAGAGGGTGG + Intronic
1033225697 7:139560511-139560533 ATGGAGACAGAGTAGAAGGGTGG + Intergenic
1033315685 7:140295404-140295426 CACAAGAGAGAATTGGAGGGTGG - Intronic
1033488049 7:141811125-141811147 CTGAAAATAGAGTGGGAAGGTGG - Intergenic
1033557636 7:142502463-142502485 CTGAGGCCAGAGCTGGAGGAGGG - Intergenic
1033789386 7:144773271-144773293 CTGAAGAAAGGGATGGAGGGAGG + Intronic
1033818453 7:145103913-145103935 CTAAAGACAGAGCAGGAGGTGGG + Intergenic
1035352047 7:158253908-158253930 CTGAACGTAGAGATGGAGGGCGG - Intronic
1036191413 8:6674175-6674197 CTGAAGCCAGTGTAGGTGGGAGG - Intergenic
1036655921 8:10677255-10677277 TGGAAGACAGATTTGGAGAGGGG - Intronic
1036928256 8:12928404-12928426 GAGAAGACAGATTTGGGGGGAGG + Intergenic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1038876657 8:31558352-31558374 CTGAAGACAAAATTGCAGGATGG + Intergenic
1039758443 8:40548041-40548063 CTGAAGCCAGAGTTCCACGGAGG + Intronic
1039945647 8:42126766-42126788 TTGGAGACAGAGAAGGAGGGAGG - Intergenic
1040296318 8:46150928-46150950 GTGAAAACAGAGTGGCAGGGTGG - Intergenic
1040815302 8:51501890-51501912 GTGAAGAAAGAGTTAGAAGGAGG + Intronic
1041170885 8:55141256-55141278 CTGGAGGCAGAGGAGGAGGGAGG - Intronic
1042230411 8:66548653-66548675 GTGAACACAGGGTTGGCGGGGGG + Intergenic
1042387675 8:68196725-68196747 AGGAAGAGAGAGTTGGGGGGGGG - Intronic
1043558768 8:81466171-81466193 ATGAAGAGAGAGAGGGAGGGAGG - Intergenic
1044817856 8:96131324-96131346 TTGGAGACAGAGATGCAGGGAGG - Intergenic
1045379484 8:101609075-101609097 CTGGGGAGAGAATTGGAGGGTGG + Intronic
1046531230 8:115448152-115448174 CTGAACAAAGATTTGGAGGATGG - Intronic
1046860181 8:119082589-119082611 TTGAAGACGGAGATGGAGGCAGG + Intronic
1047237578 8:123055682-123055704 CTGAATGCAGAGTTGGACAGAGG - Intronic
1047313202 8:123709442-123709464 AGGAAGACAGAGAAGGAGGGAGG - Intronic
1048049321 8:130802584-130802606 CTGAAGAGATAGGTGGAGGCAGG - Intronic
1048319337 8:133386221-133386243 CTGAAGACAGACTCTGAGGTAGG - Intergenic
1049356738 8:142192850-142192872 ATGAAGAGGGAGTGGGAGGGAGG + Intergenic
1049368354 8:142251730-142251752 CTGCAGACAGAGATCGCGGGTGG - Intronic
1049368366 8:142251774-142251796 CTGAAGACAGAGAACGTGGGCGG - Intronic
1049368390 8:142251862-142251884 CTGAAGACAGAGAATGCGGGCGG - Intronic
1049417243 8:142500653-142500675 CTGAGGTCAGAGAGGGAGGGTGG + Intronic
1049583301 8:143422263-143422285 CTGAGGACTGGGTGGGAGGGAGG + Intronic
1055432639 9:76259433-76259455 GTGTAGACAGAGAGGGAGGGAGG - Intronic
1055566781 9:77577533-77577555 CTGATGACAGTGCTAGAGGGAGG - Intronic
1055640953 9:78318612-78318634 GTGAAGACAGATGTGGAGGCTGG - Intronic
1056555836 9:87686425-87686447 CTGAAGCCAGAGTTGGGGTGGGG + Intronic
1056604757 9:88077098-88077120 GCGAAGACAGAGCTGGCGGGAGG - Intergenic
1057354326 9:94321852-94321874 CTAAAGACAGAGTGGGGGGCAGG - Intronic
1057421893 9:94919473-94919495 CTGAAGCCAAAGTGGGGGGGTGG - Intronic
1057491979 9:95527540-95527562 GTGAAGACAGAGATGGAGACTGG - Intergenic
1057653437 9:96935783-96935805 CTAAAGACAGAGTGGGGGGCAGG + Intronic
1057843651 9:98505714-98505736 GTGAAGACAGAGGCAGAGGGTGG + Intronic
1057868885 9:98702924-98702946 CTGAACACAGAGTTGGGGAGAGG - Intronic
1058483161 9:105417399-105417421 CTGAAGACCAAGCAGGAGGGAGG - Intronic
1058733505 9:107873302-107873324 CTGAGGACAGGGTGGGAGTGAGG - Intergenic
1058745242 9:107983966-107983988 CTGGAAACACAGTGGGAGGGAGG - Intergenic
1058745952 9:107991037-107991059 CAGAAGACTGAGGTGGAGAGAGG - Intergenic
1058761126 9:108133403-108133425 CTGCAGAGAGAGTTGAGGGGTGG - Intergenic
1059711321 9:116870210-116870232 CTGAAGTCAGTGTTGGAGTTAGG + Intronic
1059740216 9:117142854-117142876 CTGGAGACACAGATGGAGGGAGG - Intronic
1060112110 9:120913763-120913785 GTGAAAACAGAGGTGGAGTGAGG + Intronic
1060143307 9:121229174-121229196 CTGAAGACAAAGTAGGGGGAGGG - Intronic
1060348246 9:122835623-122835645 CTGCAGAGAGAGTTGGCTGGTGG - Intergenic
1060425816 9:123504615-123504637 CTGAATACAGAATCTGAGGGAGG + Intronic
1061149938 9:128822884-128822906 CTGAAGACAGGCTGGGAGCGGGG - Intronic
1061561510 9:131407216-131407238 CTGTTGACATGGTTGGAGGGTGG + Intronic
1061992757 9:134168837-134168859 CTGAAGACAGAGCAGGAGGAAGG + Intergenic
1062082251 9:134630257-134630279 GTGAAGACAGAGGTGGAGTCTGG - Intergenic
1185445987 X:258300-258322 CTGAGGACAGGAATGGAGGGAGG - Intergenic
1185889562 X:3812407-3812429 CTGCAGAGAGAGAGGGAGGGAGG - Intergenic
1187193052 X:17054913-17054935 CTGGCTGCAGAGTTGGAGGGAGG - Exonic
1187200839 X:17132349-17132371 CTGAAGGCAGAGAGGGAGAGGGG + Intronic
1188522439 X:31053746-31053768 CTGAGGAGAGAGAGGGAGGGAGG - Intergenic
1189009462 X:37031786-37031808 AAGATGACAGAGTTGGAGGTGGG + Intergenic
1189039109 X:37523939-37523961 AAGATGACAGAGTTGGAGGTGGG - Intronic
1189116518 X:38348783-38348805 CTGAACACAGAGATGAAGAGAGG - Intronic
1189143057 X:38626813-38626835 CTGGAGTCAGATTTGGTGGGGGG + Intronic
1189898617 X:45682607-45682629 CTGAGGATAGAGGTGGAGGATGG - Intergenic
1190911527 X:54776060-54776082 CTGGGGGCAGAGTTGGAGGGTGG - Intronic
1190919690 X:54840148-54840170 CTGGGGGCAGAGGTGGAGGGTGG + Intergenic
1193451309 X:81671497-81671519 CTCAAGGAAGAGTGGGAGGGTGG - Intergenic
1193599119 X:83487593-83487615 ATGAAGACAGAGTAGGTTGGTGG + Intergenic
1195297763 X:103497010-103497032 ATGAGGACTGAGGTGGAGGGAGG + Intergenic
1195676721 X:107512322-107512344 CTGAGGGCAGAGCTGGTGGGGGG + Intergenic
1195824030 X:108977796-108977818 CTGAAGATAGAGTAGAAGGATGG + Intergenic
1197614548 X:128676809-128676831 CTCAGGAGAGAGTTGGAGGCAGG + Intergenic
1199478312 X:148270564-148270586 CTGAAGGGAGAGTTGGATGTTGG + Intergenic
1199881763 X:151979040-151979062 CTCAACACAGAGTTGAGGGGGGG + Intergenic
1199890005 X:152069540-152069562 GTGAAGACAGAGTGAGAAGGTGG - Intergenic
1199922982 X:152429286-152429308 CTGGAGAAAGAGAGGGAGGGAGG - Intronic
1200100141 X:153686097-153686119 CTGGAGACAGAAGTGAAGGGTGG - Intronic