ID: 1081962681

View in Genome Browser
Species Human (GRCh38)
Location 11:47149871-47149893
Sequence ATGTTCAAGCAGAAGTTTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 308
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 275}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081962681 Original CRISPR ATGTTCAAGCAGAAGTTTGA AGG (reversed) Intronic
903052969 1:20615265-20615287 ATTTTCAAGAAGAAACTTGAAGG + Intronic
904025167 1:27498221-27498243 AAATTCAAGCAGGATTTTGAAGG - Intergenic
904199414 1:28810342-28810364 ATATTTAAGCTGAAATTTGAGGG + Intergenic
904205363 1:28851297-28851319 ATTTTCCATCAGAATTTTGAAGG - Intronic
905109209 1:35582686-35582708 TTGTTCAAGCTGGAGTTTGGTGG + Intronic
905387741 1:37615886-37615908 GTTTTTAAGCAGAAGTGTGATGG + Intronic
905523012 1:38614575-38614597 ATGGACAAGCAGGAGTGTGAGGG - Intergenic
906403751 1:45524828-45524850 AGGTTCAAACAAAAGTCTGAAGG - Intergenic
909021753 1:70439215-70439237 ATTTTCAAGCGGAAATTTTAAGG + Exonic
910178798 1:84459238-84459260 AACTTCAACCAGAGGTTTGAAGG + Intergenic
911213783 1:95169759-95169781 ATGTGAACCCAGAAGTTTGAGGG - Intronic
912219850 1:107660927-107660949 ATGTTCAAACATATGGTTGAGGG + Intronic
915364014 1:155303848-155303870 ATTTTGAAGCTGAAATTTGAAGG + Intergenic
915790902 1:158669882-158669904 ATGTGGGAGGAGAAGTTTGAAGG + Intronic
916431078 1:164729098-164729120 ATTTTCAAGCAGAATTTTCAAGG + Intronic
916571995 1:166036157-166036179 ATGCTCAAACAGTAGTTGGACGG - Intergenic
916714530 1:167438294-167438316 ATGGCCAAGGAGCAGTTTGAGGG + Intronic
917429481 1:174951121-174951143 ATGATCAAGAAGAAATTTGTGGG - Intronic
918765162 1:188472587-188472609 ATGTGTAAGCAGAGGGTTGAAGG + Intergenic
918974601 1:191466513-191466535 ATTTTCAAGCATATATTTGACGG + Intergenic
919269740 1:195325006-195325028 ATGTTCAAAAAGAAGTTTCCAGG - Intergenic
919285123 1:195548475-195548497 AGATTAAAGCAGAAGTTTCAAGG + Intergenic
919388715 1:196954601-196954623 ATGTTCAGGCAGAAGTCTGCAGG - Intronic
919398619 1:197081561-197081583 ATGCCCAGGCAGAAGTTTGCTGG + Intergenic
919816617 1:201444873-201444895 CTATGCAAGCAAAAGTTTGAAGG + Intergenic
920611827 1:207447922-207447944 ATGATAAAGGAAAAGTTTGATGG - Intergenic
920871321 1:209797513-209797535 CTAATGAAGCAGAAGTTTGAGGG - Intronic
921255580 1:213336197-213336219 GTTTTCAAGCTCAAGTTTGAAGG - Intergenic
921980732 1:221255740-221255762 ACGTGAAAGCAGAACTTTGAGGG - Intergenic
922192328 1:223330406-223330428 ATATTCCAGCAGAACTTGGAAGG - Intronic
1065381356 10:25094776-25094798 ATGATCAAGCAGAAGAATTAGGG - Intergenic
1066268734 10:33801257-33801279 ATGTTCAATCAGATATTTGGTGG - Intergenic
1066396011 10:35022454-35022476 ATGTTTAAGCAGAAGTAACAGGG + Intronic
1067239232 10:44476318-44476340 AGGTGCAAGAAGGAGTTTGAAGG - Intergenic
1067941414 10:50660047-50660069 AGGTTCAGGGAGGAGTTTGAGGG + Intergenic
1069583409 10:69580192-69580214 ATGTTCATGCAGAATTTTGAAGG + Intergenic
1071380975 10:85059174-85059196 ATGTTCAGGCATAAGTTTGCAGG + Intergenic
1071671306 10:87611774-87611796 ATGGTCAGGCAGGAGTTTGCTGG + Intergenic
1071701718 10:87945988-87946010 TGGTTCCAGCAGAAGTATGATGG + Intronic
1074312868 10:112337463-112337485 ATGCTTAAGCTGAACTTTGAAGG + Intergenic
1079164591 11:18027551-18027573 AAGTTCAAGCAAAAGTTGGAAGG - Intronic
1079591463 11:22188383-22188405 ATCTTCATACAGATGTTTGATGG - Intergenic
1080959852 11:37145741-37145763 ATGCCCAGGCAGAAGTTTGGTGG - Intergenic
1081055682 11:38408071-38408093 ATGGACAATCAGGAGTTTGATGG + Intergenic
1081487747 11:43545124-43545146 ATCTTCATGGAGAACTTTGAGGG - Intergenic
1081962681 11:47149871-47149893 ATGTTCAAGCAGAAGTTTGAAGG - Intronic
1083535468 11:63463133-63463155 ATATTCAAGCAGAGGTTTCTGGG + Intronic
1085600857 11:77854878-77854900 ATGTCCAGGCAGAAGTCTGCTGG - Intronic
1086201452 11:84208060-84208082 ATGTTGAAGCAGAAGCTTATAGG - Intronic
1087097504 11:94333520-94333542 TTATTCATGCTGAAGTTTGAGGG + Intergenic
1087765441 11:102147385-102147407 ATGTACATGCGGGAGTTTGAGGG + Intronic
1088207431 11:107409710-107409732 GTGTTCAAGCACAAGTTAGATGG + Intronic
1090304203 11:125676358-125676380 ATGTTAAAGAAGATCTTTGAAGG - Exonic
1090415430 11:126537063-126537085 TTGTTCCAGCAGCAGATTGAGGG + Intronic
1090822727 11:130358476-130358498 ATCTAAAAGCACAAGTTTGAAGG - Intergenic
1092744260 12:11658794-11658816 ATCTTACAGCAGAATTTTGAAGG + Intronic
1092991874 12:13910970-13910992 ATGTGTAAACTGAAGTTTGATGG - Intronic
1093973511 12:25396428-25396450 ATGAGGAAGCATAAGTTTGAAGG + Intergenic
1095201362 12:39388073-39388095 AACTTCAACCAGAAGTTTGTGGG - Intronic
1096551473 12:52376333-52376355 ATGTCCCAGCAGAGGTGTGAAGG - Intergenic
1098496228 12:71138671-71138693 ATGCTGAATCATAAGTTTGAAGG + Intronic
1099465184 12:82976278-82976300 TTTTTCAAGTTGAAGTTTGATGG + Intronic
1099943195 12:89214568-89214590 ATGTCTAAGCAGAAGTTAAATGG + Intergenic
1100072223 12:90734925-90734947 ATGCCCAAGCAGAAGTCTGCAGG - Intergenic
1100479593 12:94965337-94965359 ATGTACATGCAGAGGTTTTATGG + Intronic
1100741846 12:97602523-97602545 ACTTTCAAGCAGAAGTGTTAAGG - Intergenic
1100778085 12:97994264-97994286 ATGTTCATTCAGATGTTTGCTGG - Intergenic
1101179001 12:102190199-102190221 ATGAGCAAGCAAAAGTTTGGAGG - Intronic
1101433118 12:104643391-104643413 ATGAGGAAGCAGAAGTTTGGAGG + Intronic
1101799064 12:108004678-108004700 ATATTCAAGCAGAAGTTGTGTGG + Intergenic
1101860735 12:108480386-108480408 ATGTTCTAGCAAAAGTCTCATGG - Intergenic
1105264359 13:18802949-18802971 AAGTTCAAGCGGAAGGTTAATGG - Intergenic
1107585609 13:41844601-41844623 CTGTTCTAGCAGCATTTTGAGGG - Intronic
1109303188 13:60610715-60610737 ATTTTCACTCAGAATTTTGAAGG + Intergenic
1109513013 13:63404216-63404238 ATGTCCATGCAAAAGTTTGCTGG - Intergenic
1109872830 13:68357947-68357969 ATGTTCAGGAAAAAGTTTGTGGG + Intergenic
1111146598 13:84190139-84190161 ATTTTCAACCAGAATTCTGATGG + Intergenic
1112210412 13:97371598-97371620 ATTTTCAAGCAGAATAGTGATGG + Intronic
1112447089 13:99474028-99474050 ATGGCAAAGCAGAAGATTGATGG + Intergenic
1113441344 13:110331127-110331149 ATGTTCAAGCTGATTTTTGGAGG - Intronic
1113608729 13:111628377-111628399 ATGTTTCAGGAGAAATTTGATGG - Intronic
1114276412 14:21149629-21149651 ATTTTCAAGCAGAATGTTTAAGG - Intergenic
1115122004 14:29948502-29948524 GTGTCCAGGCAGAAGTTTGCTGG - Intronic
1115863583 14:37716995-37717017 AGGTTAAAGAAGAAGTTTCAAGG + Intronic
1116020782 14:39457689-39457711 ATGTTTGAGCAGAAATCTGAAGG + Intergenic
1117726779 14:58682583-58682605 ATGTTTGAGCTGAACTTTGAAGG + Intergenic
1117997883 14:61495080-61495102 GTATTAAAGCAGATGTTTGATGG + Intronic
1118995759 14:70834183-70834205 ATGTTTCAGAAGAAATTTGAAGG - Intergenic
1121394690 14:93610146-93610168 ATATTTAAGCTGAAGTCTGATGG + Intronic
1124791715 15:32733272-32733294 ATGCTAAGGCAGAATTTTGAGGG + Exonic
1127173892 15:56332845-56332867 CTGATAAAGCAGAAGCTTGAAGG + Intronic
1127201172 15:56653264-56653286 ATGCTGAAGCAGTGGTTTGATGG + Intronic
1128223299 15:65983513-65983535 ATGTTCTGGGAGAAGTTGGATGG + Intronic
1130035858 15:80360924-80360946 ATGTTGCAGCTGAAGTCTGAAGG - Intronic
1130857190 15:87850928-87850950 ATGTCTCAGCAGAAGTTTGAGGG + Intergenic
1134646136 16:15868153-15868175 GTGTTCAATCAGCATTTTGAGGG + Intronic
1134908680 16:18004540-18004562 ATATTCCAGCAGAAGTGTGAGGG + Intergenic
1135277108 16:21122697-21122719 ATGTTTTAGCTGAATTTTGAAGG - Intronic
1136872475 16:33820171-33820193 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
1141216776 16:82032619-82032641 ATGTTTAAGCAGATATCTGAAGG + Intergenic
1142038341 16:87876563-87876585 GTGTTCAAACAGAAGCTAGAAGG - Intergenic
1203099697 16_KI270728v1_random:1295897-1295919 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1143123204 17:4622723-4622745 ATTTTCACACAGAAGCTTGAAGG + Intergenic
1143809993 17:9463567-9463589 ATGTTCAACCAGGAGTTGGCTGG - Intronic
1144271531 17:13621941-13621963 GAGTTCCAGCAGAAGTTTTAGGG - Intergenic
1147454877 17:40530924-40530946 CTGTCCAAGCAGAGGTCTGAAGG + Intergenic
1148990686 17:51664243-51664265 ATATTCCAGCAGATATTTGAGGG + Intronic
1155175691 18:23299379-23299401 ATCTTCAGGCAGAAGTTGGGTGG - Intronic
1155710748 18:28875661-28875683 ATTTGCAAGCAGAAGTTGGCTGG + Intergenic
1156082826 18:33359872-33359894 TTTATCAAGCAGAAGTTTGTGGG - Intronic
1157289214 18:46398190-46398212 GTGGTCATGCAGAAGTGTGAGGG + Intronic
1159083211 18:63758923-63758945 ATGTTTAAGAAGAAATTTAAAGG + Intronic
1160035285 18:75295782-75295804 ATCTGCAAGCAGAAATCTGATGG + Intergenic
1163245397 19:16090564-16090586 ATGTTTAAGCAGAAGCTCAAAGG - Intronic
1166640447 19:44490324-44490346 ATGTTCATGCAGCAATTTCAAGG - Intronic
1166643546 19:44514286-44514308 AGGTTCAGGCAGAAGTGAGATGG - Intronic
925591799 2:5517229-5517251 ATATTCAAGGGAAAGTTTGAAGG + Intergenic
925696242 2:6582872-6582894 GTGTTGAAGCAGAATGTTGAAGG + Intergenic
926841399 2:17084650-17084672 GTGTTTAAGCTGAAATTTGAAGG - Intergenic
928411671 2:31059112-31059134 CTGTTTAAGCACAAGTTGGAGGG + Intronic
929849281 2:45568682-45568704 ATTTTCAAGCAGAAATTAGAAGG + Intronic
931874720 2:66499399-66499421 AGGATCAGGCAGAAGTTGGAGGG - Intronic
933167804 2:79094863-79094885 GTGTTCAAACAGAAGTGTGTAGG + Intergenic
933567272 2:83966266-83966288 AAGTTCTAGCCCAAGTTTGAAGG + Intergenic
934886463 2:98029640-98029662 ATGTTCAGGCAGAAATTTAAAGG - Intergenic
937732412 2:125249506-125249528 ACCTGCAAGCAGAAGTTTTAAGG - Intergenic
938184867 2:129222024-129222046 ATGTTACAGCTGAAGTCTGAAGG + Intergenic
939647245 2:144715810-144715832 ATGTTCCAGGAGAAGAGTGAGGG - Intergenic
940488713 2:154329622-154329644 AATTTCAAGATGAAGTTTGAGGG - Intronic
941763534 2:169270909-169270931 ATTTTTAAGCAAAAGATTGATGG - Exonic
942469019 2:176240712-176240734 ATTTTCAAGGAGGAATTTGATGG + Intergenic
942498299 2:176562378-176562400 ATGTGCAAGCTGAAGTTACAAGG - Intergenic
942608353 2:177715199-177715221 ATTTTCACTCAGAATTTTGAAGG + Intronic
942884842 2:180910595-180910617 ATATTCAAGCAGAAGGTAGAGGG + Intergenic
942993200 2:182228053-182228075 ATGTTCAAAGAGACATTTGAAGG + Intronic
944332218 2:198483816-198483838 ATGTTGATTCAGAAGTTTCAGGG + Intronic
944502083 2:200372289-200372311 CTGTTCAAGCAGAAGCTGGCTGG - Intronic
944814809 2:203364522-203364544 AAGTTCAAGATGAAGTTTAAAGG - Intronic
945136536 2:206634908-206634930 ATGTTGAAGTAGAAATTTAATGG + Intergenic
945284262 2:208066317-208066339 ATGTCCAAGCAGAATGTAGAAGG + Intergenic
945943600 2:215973252-215973274 TTGTCCAGGCAGAAGTTTGGAGG - Intronic
946835394 2:223767495-223767517 ATATTCAAGCAGAAGATGGATGG - Intronic
946971066 2:225092389-225092411 ATTTTTAGGGAGAAGTTTGAAGG - Intergenic
1170539352 20:17372482-17372504 ATATTCAAGAGGAAGTTTGATGG + Intronic
1172024411 20:31938170-31938192 TTATTCCAGCAGAAGTTTGAGGG + Intronic
1175017903 20:55811409-55811431 ATGTTAAAGCAGAGATTTGAAGG - Intergenic
1176849432 21:13901387-13901409 AAGTTCAAGCAGAAGGTTAATGG - Intergenic
1176991198 21:15498217-15498239 ATATCCAAGTGGAAGTTTGAAGG - Intergenic
1177744949 21:25200772-25200794 ATGGCCAAGTAGAAGGTTGAAGG - Intergenic
1179093018 21:38285565-38285587 ATGTTCAACCTGACTTTTGAAGG + Intronic
1179127803 21:38607136-38607158 ATTTTCCAGCAGCACTTTGAAGG - Intronic
1179536513 21:42056176-42056198 ATGGCCAAGCAGAACTTTGCCGG + Intergenic
1180482723 22:15769683-15769705 ATGATCAAGCAGAACTTGAAGGG - Intergenic
1182977763 22:34639433-34639455 TTGTTCAATCAGAAGTGTCAAGG + Intergenic
1184978513 22:48080156-48080178 ATGTTCCAGCAGATGTAAGAGGG + Intergenic
949102138 3:158569-158591 ATGTTCAATTATAAATTTGAGGG - Intergenic
952158674 3:30671407-30671429 ACATTTAAGCTGAAGTTTGAAGG + Intronic
952247106 3:31606635-31606657 ATGTCCAGGCAGAAGTTTGCTGG + Intronic
952690550 3:36200182-36200204 ATGTTCAAGAAGAAATTGAAGGG - Intergenic
952791328 3:37202946-37202968 ATGCTCAAACAGGAGTGTGATGG + Intergenic
952939705 3:38433046-38433068 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
952957577 3:38566526-38566548 ATACTCAAGCAGAACCTTGATGG + Exonic
953675670 3:44999955-44999977 ATGTTCAAACAGATATTTGCTGG + Intronic
954543889 3:51416330-51416352 ATGTTTAAGCAGAGCCTTGAAGG - Intronic
954860774 3:53688777-53688799 ATTTTAAAGCAGAAATTCGAAGG - Intronic
955708439 3:61753563-61753585 AACTTCAAGTAGAAATTTGAGGG + Intronic
955725179 3:61925429-61925451 ATTTTTAAGGAGAAGTTTGCTGG - Intronic
955784208 3:62519221-62519243 ATGTTCCAATAGAAGTTTTATGG - Intronic
956894074 3:73641726-73641748 AGGTTGAAGCAGAAGTTTGCTGG + Intergenic
958138710 3:89532233-89532255 ATTTTCAAGCATAAGTTACATGG + Intergenic
963878319 3:150501182-150501204 ATGTCCAAGCAGAAGTTTGCTGG - Intergenic
964986688 3:162750406-162750428 ATGATCAAGAGGAAGTTTGGGGG - Intergenic
965281870 3:166764889-166764911 ATGTCCAGGCAGAAGTCTGCTGG - Intergenic
966314808 3:178633345-178633367 ATGTCCAGTCAGAAGTTTGCTGG - Intronic
966476193 3:180349881-180349903 ATGTTTAAGCATCATTTTGAGGG - Intergenic
971035827 4:22691881-22691903 ATTTTCACTCAGAATTTTGAAGG - Intergenic
971369504 4:26004900-26004922 ATGTTGTAGCTCAAGTTTGAAGG + Intergenic
971718575 4:30214670-30214692 ATGTTAAAACAGAAGCTTTAGGG - Intergenic
971844896 4:31906187-31906209 ATGCCCAGGCAGAAGTTTGCTGG - Intergenic
972242259 4:37205635-37205657 ACGTTCAAGCTGAATGTTGAAGG + Intergenic
972847159 4:43004295-43004317 ATGTCCAGGCAGAAGTCTGCTGG + Intronic
974436741 4:61866419-61866441 ATGTTCACGCACAAGTTTTCAGG + Intronic
974754423 4:66184927-66184949 ATGTCCAAACAAAAGTATGAAGG - Intergenic
976715072 4:88115010-88115032 ATGTCCAAGAAGAAGTCTGCAGG + Exonic
977405195 4:96588965-96588987 ATGTCGAACAAGAAGTTTGAAGG - Intergenic
977914531 4:102577001-102577023 ATTTGCAAGCAGAAGGTGGAGGG + Exonic
979966897 4:127086700-127086722 ATGTCCAGGCAGAAGTCTGTTGG + Intergenic
980171362 4:129294070-129294092 CTGTTTAAGCAAATGTTTGAAGG + Intergenic
980697653 4:136380950-136380972 ATGTATAAGCAGAAATTTGTAGG + Intergenic
980993502 4:139759129-139759151 ATGTTCAAACTGACATTTGAGGG + Intronic
981335195 4:143561668-143561690 ATCTTCACACAGATGTTTGATGG - Intergenic
982387693 4:154829724-154829746 AGTTTCAAGCAGAAGTTATATGG + Intergenic
982514011 4:156321207-156321229 ATATTTAAGCAAATGTTTGAAGG + Intergenic
984132779 4:175898779-175898801 ATTTTGAAGCATAACTTTGATGG - Intronic
984379486 4:178972347-178972369 ATGATCAAGCATAAGTCCGAAGG + Intergenic
984591610 4:181623762-181623784 ATGTACAAGCAGTGTTTTGATGG + Intergenic
984614135 4:181876710-181876732 CATTTCAAGCAGAAGTTTTAAGG - Intergenic
984622873 4:181973832-181973854 ATGTTTAAGCAAAGGCTTGAAGG + Intergenic
986419974 5:7570085-7570107 ATTTTCAAGCAGAAGTCATAGGG - Intronic
986496228 5:8344504-8344526 ATGTCCAAGCAGAAATATGTTGG - Intergenic
986960334 5:13202889-13202911 GTGTCCAAGAAGAAGTTTGATGG - Intergenic
987378201 5:17257723-17257745 TAGTTCAAGCGGAACTTTGATGG - Intronic
987541954 5:19267415-19267437 ATTTTTAAGCAGAAGACTGATGG + Intergenic
988018488 5:25592730-25592752 AGGTTCAAGCAGAGGTATAATGG - Intergenic
988256783 5:28830796-28830818 ATGTCCAGGCAAAAGTTTGCTGG - Intergenic
989484516 5:41973865-41973887 TTTTTCAGGCAGAAGTTTAATGG - Intergenic
991066171 5:62427280-62427302 AACTCCAAGCAGAAGTTTGTAGG + Intronic
991240708 5:64456998-64457020 ATGTTTAAGCTGAGGGTTGACGG - Intergenic
991936046 5:71801296-71801318 ATGGTCAAGCTGAAGATTAATGG + Intergenic
993436683 5:87904427-87904449 ATTATGAAGCACAAGTTTGAAGG + Intergenic
993996175 5:94726149-94726171 AAATTGAGGCAGAAGTTTGAGGG - Intronic
994502616 5:100599251-100599273 AATATCAAACAGAAGTTTGATGG - Intergenic
994672861 5:102783712-102783734 ATGTGCATGCAGCAGTATGAGGG + Intronic
994944785 5:106373056-106373078 GTGTTTAAGCATAAGTTTTATGG + Intergenic
995909009 5:117163305-117163327 CTGTAGAAGCAGAAGTTTCATGG + Intergenic
996559010 5:124808719-124808741 ATGTTTAACCAGAGATTTGAGGG - Intergenic
997023182 5:130026179-130026201 ATGGTCATGCAGAAATTTCAAGG - Intronic
997273750 5:132564977-132564999 ATGTCCAGGCAGAAGTCTGCAGG + Intronic
997575014 5:134968124-134968146 ATGTGCTAGTAGAAGTGTGAGGG + Exonic
997944332 5:138185776-138185798 ATGTTAGAGCAGGAGTTAGAAGG - Intronic
1000177398 5:158770753-158770775 TTGCACAAGCTGAAGTTTGAAGG - Intronic
1004333129 6:14739827-14739849 ATCTTCCAGCAGAATCTTGAAGG + Intergenic
1005637709 6:27767251-27767273 CAGTTCAAGCAGAAGTGTGCGGG + Intergenic
1005783421 6:29217695-29217717 ATGTCCAGGAAGAAGTTTGCTGG + Intergenic
1007689509 6:43690489-43690511 ATGTTCAAGCAGAACTTGACTGG + Intergenic
1008245069 6:49161512-49161534 ATGTCCAGGCAGAAGTTTGCTGG - Intergenic
1010712582 6:79192516-79192538 ATGTCTGAGCAGAAGGTTGATGG - Intergenic
1011638114 6:89393655-89393677 ATGTTCAAGGAAATGTTGGAGGG - Intronic
1012683222 6:102209665-102209687 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1014182906 6:118405175-118405197 ATGAACAAGCAGACCTTTGATGG + Intergenic
1014883059 6:126746522-126746544 ATGTCTAGGCAGAAGTTTGCTGG - Intergenic
1015559666 6:134501126-134501148 TTAATCAACCAGAAGTTTGAAGG - Intergenic
1015855112 6:137616149-137616171 ATTTTAAAGCAAAAGTGTGATGG - Intergenic
1016253223 6:142071991-142072013 ATGCTCAGGCAAAAGTTTGCTGG + Intronic
1017528932 6:155268308-155268330 TTCTTCAAGAAGGAGTTTGAAGG - Intronic
1019081215 6:169431198-169431220 ATGCACAAAGAGAAGTTTGAGGG - Intergenic
1020819417 7:12947102-12947124 AAGTTCAAGAAAAATTTTGAAGG - Intergenic
1021794966 7:24245310-24245332 AAGCTCAAGCAGAAGTTGCAAGG + Intergenic
1023168598 7:37368089-37368111 ATTTTAAAGGAAAAGTTTGATGG - Intronic
1023424702 7:40023359-40023381 ATGTATAATCAGAAGTTTGCAGG - Intronic
1023493464 7:40768844-40768866 AGGTGCACACAGAAGTTTGATGG + Intronic
1024630811 7:51245207-51245229 ATGTGAAAGCAGGAGTTTCAGGG - Intronic
1028157779 7:87451056-87451078 ATGTTCATGCAATAATTTGAGGG + Intronic
1029294086 7:99525645-99525667 ATATTCAAGCAGAAAAGTGAGGG - Intronic
1029882007 7:103823827-103823849 ATGTTAAAGCAAAATTTTAAAGG - Intronic
1033382585 7:140837676-140837698 ATTTTCAGGCAGTAGTGTGAAGG - Intronic
1033399423 7:141007732-141007754 AGGTTTAAGCAGAGGCTTGAAGG - Intronic
1033713975 7:143980747-143980769 TTGTTCAAGCAGAGTTTGGATGG + Intergenic
1033965088 7:146965574-146965596 GGGTACAAGCAGAAGTTGGATGG + Intronic
1034026533 7:147710491-147710513 ATGCTTAAGCTGAGGTTTGAAGG - Intronic
1036956739 8:13195759-13195781 GTGTTCAAGAAGAGGGTTGATGG + Intronic
1037933245 8:22896725-22896747 ATGATAAGGCAGAATTTTGAAGG + Intronic
1038397306 8:27256849-27256871 GCATTCAAGCAGAAGTTGGATGG - Intronic
1038756886 8:30350097-30350119 ATCTACAAGGAGAAATTTGAAGG - Intergenic
1039137362 8:34340339-34340361 ATGTTCAAACTGAAGTAGGAAGG - Intergenic
1039177740 8:34828215-34828237 ATGTTCAAGCTGAGGCCTGAAGG + Intergenic
1041745496 8:61204426-61204448 ATATCCAAGCAGAATTTTCAGGG + Intronic
1043822889 8:84890285-84890307 ATGTTGTGGCAGGAGTTTGAGGG + Intronic
1044301023 8:90583052-90583074 GTGTTCAGGCACGAGTTTGACGG + Intergenic
1044851445 8:96432708-96432730 ATGTCCAGGCAGAAGTCTGCAGG + Intergenic
1045233617 8:100329959-100329981 ATGTTCAAGTAGAGCTTAGATGG + Intronic
1046053459 8:109051509-109051531 ATGTTTAGGCAGAATTTTGAAGG - Intergenic
1046439324 8:114237521-114237543 AAATTAATGCAGAAGTTTGAAGG + Intergenic
1047451676 8:124970614-124970636 ATATTTCAGCAGAAGTATGAAGG - Intergenic
1048478913 8:134769755-134769777 ATGCCTAGGCAGAAGTTTGATGG - Intergenic
1048668341 8:136689497-136689519 ATGTCCAGGCAGAAATTTGCTGG - Intergenic
1048839369 8:138551504-138551526 ATGTCCAGGCAGAAGTCTGCTGG + Intergenic
1050920902 9:11199468-11199490 CTGTTCAAGCAGCAGGCTGAGGG - Intergenic
1051767438 9:20540371-20540393 ATGTCCAGGCAGAAGTCTGCTGG - Intronic
1052096038 9:24385475-24385497 ATGTTCAAGCAGATAATTGATGG + Intergenic
1053800834 9:41763691-41763713 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1054144361 9:61551149-61551171 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1054189265 9:61975841-61975863 AAGTTCAAGAAGAAGTGTTATGG + Intergenic
1054649252 9:67612771-67612793 AAGTTCAAGAAGAAGTGTTATGG - Intergenic
1056092226 9:83216575-83216597 ACGTCCACGCAGAAGTTTGCTGG + Intergenic
1057038720 9:91832314-91832336 ATGTTAAATGAGAAGTTTGGAGG + Intronic
1057748564 9:97771842-97771864 ATTTACAAGCAGGAGGTTGAAGG + Intergenic
1058027602 9:100159239-100159261 ATATTCAATGAGAAGTTTTAGGG + Intronic
1058221979 9:102314055-102314077 ATGTCCAGGCAGAATTTTGCTGG + Intergenic
1060303047 9:122387176-122387198 ATGTCCAAGCAGAAATTGGAAGG + Intronic
1061242844 9:129384234-129384256 TTGCTCAAGCAAAAGTTTCAGGG - Intergenic
1187069778 X:15877139-15877161 ATATTCATGGAGAAGTTGGAAGG + Intergenic
1187441108 X:19321034-19321056 ATGTTGAAGTTCAAGTTTGAAGG + Intergenic
1188659420 X:32740096-32740118 ATTTCCAAGCAGAAGCTTTACGG + Intronic
1188821653 X:34782904-34782926 ATATTAAAGCAGAGATTTGAAGG + Intergenic
1189206391 X:39242911-39242933 ATGAGCAAGCAGAAATTGGAAGG - Intergenic
1189486049 X:41433061-41433083 ATGTTCAAGGAGAAGTCCGCTGG - Intergenic
1190019762 X:46863508-46863530 ATATTCTAGCAGGAGTTGGATGG + Intronic
1190531804 X:51386170-51386192 ATGTCTAGGCAGAAGTTTGCTGG - Intergenic
1191025176 X:55906741-55906763 ATATTCAAGCAGATGTTCTAAGG + Intergenic
1192273640 X:69608536-69608558 AATTTTAAGCAGCAGTTTGAAGG - Intergenic
1192390581 X:70722645-70722667 ATGTTCAGACAGAAGTCTAAGGG + Exonic
1193167664 X:78300866-78300888 ATGTACAGGCAGAAATTTGCTGG - Intronic
1193369516 X:80677587-80677609 AGGTTTAGGCAGAAGTTTTAAGG + Intronic
1194091998 X:89589563-89589585 ATGCTGAAGCAGAAGTTTCAAGG + Intergenic
1194162226 X:90468116-90468138 ATGTTCACGCTGAAGGTTGTTGG - Intergenic
1194755385 X:97733075-97733097 ATTTTCAGGCAGAATGTTGAGGG + Intergenic
1194893545 X:99410222-99410244 ATGTTCAAGAAATATTTTGAAGG - Intergenic
1195536317 X:106012874-106012896 ATGTCCAGGCAGAAGTTTGCTGG + Intergenic
1196820662 X:119697859-119697881 ATATTGAAGGAGAAGTTTGAAGG + Intergenic
1197250467 X:124210476-124210498 AAGATGAAGCAGTAGTTTGAAGG + Intronic
1199389421 X:147262270-147262292 ATCTCCAGGCAGAAGTTTGCTGG + Intergenic
1199849058 X:151712293-151712315 ATGTTCACGTGGAAGTTTCAGGG - Intergenic
1199931826 X:152530891-152530913 ATGTCCAGGCAGAAGTCTGCAGG - Intergenic
1200380728 X:155834665-155834687 AAGTCCAAGCAGAAGTCTGCTGG + Intergenic
1200444632 Y:3245627-3245649 ATGCTGAAGCAGAAGTTTCAAGG + Intergenic
1200508503 Y:4045853-4045875 ATGTTCACGCTGAAGGTTGTTGG - Intergenic
1201426614 Y:13858388-13858410 ACATTCAAGCAAAAGCTTGATGG + Intergenic