ID: 1081964510

View in Genome Browser
Species Human (GRCh38)
Location 11:47161428-47161450
Sequence GAAGCCTGGAGGGCAGCGAG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 450
Summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 408}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081964510_1081964515 -5 Left 1081964510 11:47161428-47161450 CCTCTCGCTGCCCTCCAGGCTTC 0: 1
1: 0
2: 4
3: 37
4: 408
Right 1081964515 11:47161446-47161468 GCTTCTTCCCTTCTTCAGGCTGG 0: 1
1: 0
2: 1
3: 20
4: 234
1081964510_1081964520 13 Left 1081964510 11:47161428-47161450 CCTCTCGCTGCCCTCCAGGCTTC 0: 1
1: 0
2: 4
3: 37
4: 408
Right 1081964520 11:47161464-47161486 GCTGGCCCAGGTCCCAGGCCTGG 0: 1
1: 0
2: 10
3: 103
4: 749
1081964510_1081964523 22 Left 1081964510 11:47161428-47161450 CCTCTCGCTGCCCTCCAGGCTTC 0: 1
1: 0
2: 4
3: 37
4: 408
Right 1081964523 11:47161473-47161495 GGTCCCAGGCCTGGTCAACTCGG 0: 1
1: 0
2: 1
3: 12
4: 152
1081964510_1081964514 -9 Left 1081964510 11:47161428-47161450 CCTCTCGCTGCCCTCCAGGCTTC 0: 1
1: 0
2: 4
3: 37
4: 408
Right 1081964514 11:47161442-47161464 CCAGGCTTCTTCCCTTCTTCAGG 0: 1
1: 0
2: 3
3: 34
4: 347
1081964510_1081964519 8 Left 1081964510 11:47161428-47161450 CCTCTCGCTGCCCTCCAGGCTTC 0: 1
1: 0
2: 4
3: 37
4: 408
Right 1081964519 11:47161459-47161481 TTCAGGCTGGCCCAGGTCCCAGG 0: 1
1: 0
2: 3
3: 37
4: 316
1081964510_1081964516 1 Left 1081964510 11:47161428-47161450 CCTCTCGCTGCCCTCCAGGCTTC 0: 1
1: 0
2: 4
3: 37
4: 408
Right 1081964516 11:47161452-47161474 TCCCTTCTTCAGGCTGGCCCAGG 0: 1
1: 0
2: 4
3: 30
4: 316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081964510 Original CRISPR GAAGCCTGGAGGGCAGCGAG AGG (reversed) Exonic
900008525 1:83306-83328 GAATCCTGGTGGGGAGTGAGGGG + Intergenic
900036756 1:417389-417411 GAATCCTGGTGGGGAGTGAGGGG + Intergenic
900058385 1:653136-653158 GAATCCTGGTGGGGAGTGAGGGG + Intergenic
900150436 1:1176626-1176648 GAAGGCTGGAGGGCTGCTAGTGG + Intronic
900786232 1:4652647-4652669 GGAGCCAGCAGGGCAGGGAGGGG - Intergenic
901638684 1:10682263-10682285 GAAGGCTGGAGGGAAGTGGGGGG + Intronic
901655798 1:10768552-10768574 GAAGGCTGGAGTCCAGGGAGAGG - Intronic
901780948 1:11594156-11594178 GAAGCCTGCAGGGCAGCGGGAGG - Intergenic
902055319 1:13595853-13595875 GAAGCCTGGTGGACAGCGGCAGG + Intronic
903130023 1:21272957-21272979 GAAGCAGGGAGGGCAGAGAAGGG + Intronic
903142519 1:21347461-21347483 GGAACCTGGAGGGCGGGGAGGGG + Intergenic
903597068 1:24502989-24503011 GGAGCCTGGTGGGCGGCGGGCGG - Exonic
903597098 1:24503070-24503092 GGAGCCGGGAGGGCAGCGGACGG - Exonic
903788157 1:25875097-25875119 GAAGGATGGAGGGCAGGGAGTGG - Intergenic
904044894 1:27603190-27603212 GAAGCCTGGCAGGCAGCGCCGGG - Intronic
904410231 1:30320614-30320636 GGAGCCTGGAGGCCAGGGAGGGG - Intergenic
905055910 1:35093222-35093244 GATAACTGGAGGGCAGAGAGGGG + Intronic
905463315 1:38135145-38135167 GAAGCCGAGGGGGCAGAGAGAGG + Intergenic
905824635 1:41018776-41018798 GAAGCAGGGAGGTCAGGGAGGGG - Intronic
905872876 1:41415161-41415183 GAGGCCTGGAAGGCAGTGGGAGG - Intergenic
906278498 1:44536397-44536419 GAAGCCTGGAGAGCAGCAAGTGG + Intronic
907308291 1:53525620-53525642 GAGGCCTGGAGGGCAGGGTGGGG - Intronic
911731513 1:101296604-101296626 GATGCCTGGAGACCAGTGAGTGG + Intergenic
913205480 1:116534489-116534511 GAGGCGTAGAGGGCGGCGAGTGG - Intronic
913260657 1:116995303-116995325 GAAGCATGGAGGCCAGCCATGGG + Intergenic
913298336 1:117343988-117344010 GGAAGCTGGAGGGCAGAGAGGGG + Intergenic
916438033 1:164794713-164794735 GAATCCAAGAGGTCAGCGAGAGG - Intronic
916683290 1:167123275-167123297 GGAGCCTAAAGGGCAGCCAGAGG - Intronic
917027472 1:170659786-170659808 GGAGCCTGGAGGTCAAGGAGAGG + Intergenic
917285042 1:173414745-173414767 GAAGCTTGGAGAGGAGCCAGTGG - Intergenic
917520294 1:175742769-175742791 GAAGCCTGGGGGGTTGGGAGTGG - Intronic
917531744 1:175842052-175842074 GGAGGCAGGAAGGCAGCGAGTGG + Intergenic
919860525 1:201736923-201736945 GTAGCCTGGGGTGCAGGGAGTGG - Intronic
920033798 1:203052670-203052692 GGAGCCTGAAGGGGAGCTAGGGG + Intronic
920324357 1:205150656-205150678 TAAGGCTGGAGGGCAGGCAGTGG - Intronic
921472765 1:215567874-215567896 CAAGCCTGGAGGGGAACGTGGGG + Intronic
921817173 1:219576982-219577004 GTTGCCTGGAGGGCAGAAAGCGG + Intergenic
922989785 1:229896875-229896897 AAATCCTTGAGGCCAGCGAGTGG + Intergenic
1062948132 10:1476230-1476252 GGAGCCTGGAGTGGAGCCAGGGG + Intronic
1063972316 10:11389661-11389683 GAAGTCTGGGGGGTAGTGAGAGG - Intergenic
1065130001 10:22610871-22610893 GAAGCCTGGAGGCCTGGCAGGGG - Intronic
1065134058 10:22651018-22651040 GAAGTCTGGAGCTCAGAGAGTGG - Intronic
1066065447 10:31758236-31758258 GAAGCATGGAGTGCAGCTTGAGG - Intergenic
1067213889 10:44284501-44284523 CAATCCTGGAGGGCATCCAGGGG + Intergenic
1067222367 10:44353273-44353295 GAACCCTGGAAGGTAGCCAGAGG + Intergenic
1067698676 10:48553268-48553290 AAAGGCTGGAGGGCAGAGATGGG + Intronic
1067753301 10:48985801-48985823 GAGGCCTGGGGTGCAGGGAGAGG + Intergenic
1069394824 10:67977166-67977188 GAAGACTGGAGGGAAGAGTGGGG + Intronic
1069686879 10:70324298-70324320 GAAGCCTGGGCCTCAGCGAGGGG + Intronic
1069756222 10:70775793-70775815 GAAGCCCAGAGGGCAGCCTGAGG + Intronic
1070590054 10:77794980-77795002 GAGCCCTGGCGGGCAGTGAGGGG + Intronic
1071551000 10:86566108-86566130 GAAGATTGAAGGGTAGCGAGAGG + Intergenic
1072710805 10:97714505-97714527 AAACGCTGGAGGGCAGGGAGAGG - Exonic
1072874927 10:99162492-99162514 GAAGACAGGAGGGAAGGGAGTGG - Intronic
1073071820 10:100799045-100799067 GAAGACTGGGGGGCAGCCTGGGG + Intronic
1073473643 10:103739207-103739229 GCAGACTGGAGGGCAGGGCGGGG - Intronic
1073483205 10:103799841-103799863 GAAGGCTGGAGAGTAGGGAGTGG + Intronic
1074048115 10:109857792-109857814 GCAGCCTGGAGGCCAGGGAAAGG - Intergenic
1075624345 10:123950945-123950967 GAATCCTGGGGGGCAACCAGAGG - Intergenic
1075724972 10:124606460-124606482 GAACCCTGGAGGGCAGATGGTGG + Intronic
1076911094 10:133390135-133390157 GAAGCCTGGTGGGCACTGAAAGG - Intronic
1077151806 11:1076162-1076184 GGAGCCTGGTGGGCTCCGAGGGG - Intergenic
1077158095 11:1100351-1100373 CAAGGCTGGGGGGCAGAGAGAGG + Intergenic
1077210817 11:1370240-1370262 CCAGCGTGGAGGGCAGCGGGCGG - Intergenic
1078088732 11:8250883-8250905 AAAGCCTGGAGGCCAGTGAGTGG - Intronic
1078507574 11:11964280-11964302 GAAGCCTGGAGAACAGCCTGGGG + Exonic
1080393980 11:31873260-31873282 GAATCCTTGAGGGCAGGGACTGG + Intronic
1081173836 11:39901578-39901600 AAAGGGTGGAGGGCAGGGAGTGG + Intergenic
1081646957 11:44796749-44796771 GAAGCCTAGAGGACAGACAGAGG - Intronic
1081676353 11:44972211-44972233 GAACCCTGCTGGGCAGAGAGTGG - Intergenic
1081964510 11:47161428-47161450 GAAGCCTGGAGGGCAGCGAGAGG - Exonic
1081998289 11:47378210-47378232 CAAGCCAGGAGGGCAGTGGGTGG + Intronic
1083224054 11:61273582-61273604 GGAGCCTGGATGGAAGCGGGAGG - Intronic
1083541600 11:63515470-63515492 GAAGGATGGAGGTCAGGGAGTGG - Intronic
1083672579 11:64307307-64307329 GTGGCCTGGGAGGCAGCGAGTGG - Exonic
1083896059 11:65620385-65620407 GAACCCTGTAGGGCAGCAAGGGG + Exonic
1084189448 11:67492342-67492364 GGACCGTGGAGGGCAGCGTGTGG - Intronic
1084205995 11:67593343-67593365 GAAGCCAGAAGGGCATGGAGTGG + Intergenic
1087252132 11:95914387-95914409 AAAGCCTGCAGGGCAGGGAGTGG + Intronic
1087267308 11:96074897-96074919 GAGTACTGGAGGGCAGGGAGTGG + Intronic
1087410757 11:97787692-97787714 GAAGGGTGGAGGGGAGGGAGGGG - Intergenic
1089059128 11:115611824-115611846 GAGGCCTGGAGGAGAGAGAGAGG + Intergenic
1089495823 11:118908303-118908325 GGACTCTGGAGAGCAGCGAGAGG - Exonic
1089530065 11:119121845-119121867 GAAGCCTGCGGGACTGCGAGTGG + Intronic
1089740292 11:120577692-120577714 GAAGACAGGAGGGCAGGGATTGG - Intronic
1090248554 11:125235443-125235465 TAAGCCTGGAAGGCAATGAGAGG + Intronic
1090405417 11:126473284-126473306 GAGGCCTGGAGGGGAGGGGGTGG - Intronic
1091706597 12:2697646-2697668 GGAGCCTGGAGGGGAGGGTGTGG - Intronic
1092095488 12:5838677-5838699 GAAGCATGGAAGGAAGTGAGAGG - Intronic
1092458488 12:8665984-8666006 GAGGCAGGGAGGGCAGGGAGAGG + Intergenic
1094328792 12:29270001-29270023 GAAGCTTGGAAGGCAGAGAAGGG - Intronic
1094482756 12:30897784-30897806 AAAGACTGGAGGGAAGTGAGGGG - Intergenic
1095970099 12:47895843-47895865 GAAGCCTGCTGGGCCGAGAGGGG + Intronic
1096546359 12:52342827-52342849 GAAGGCTGGAGGGAAGAGGGTGG - Intergenic
1097120168 12:56725336-56725358 GAAGCCTGGAGCGGAGGGGGTGG + Intronic
1097155656 12:57010432-57010454 AAAGCCTGGAGGGCAGGCTGAGG - Intronic
1097184346 12:57188647-57188669 GGAGCTTGGTGGGCAGCCAGGGG - Intronic
1101723689 12:107372696-107372718 AAAGCCCGGAGGGAAGCAAGGGG - Intronic
1102104019 12:110304971-110304993 CCAGGCTGGAGTGCAGCGAGTGG + Intronic
1102183563 12:110931251-110931273 GGATCCTGGAGGGTAGTGAGAGG - Intergenic
1103238456 12:119394495-119394517 GATGCCTGGGGGGCAGTGAGAGG - Intronic
1104987031 12:132603073-132603095 GAAACCTGGAGGTCACAGAGAGG - Intergenic
1105975974 13:25472948-25472970 GAGGAAGGGAGGGCAGCGAGGGG + Intronic
1106882059 13:34142548-34142570 GAAGCCTCTTGAGCAGCGAGTGG - Intergenic
1108033000 13:46256427-46256449 GAAGCCAGGAGGGCAGAAACTGG + Intronic
1108140508 13:47416104-47416126 GAAGCCTGGAGGACAGAGCCAGG + Intergenic
1108300232 13:49066835-49066857 TAAGCTTTGAGGGCAGTGAGGGG - Intronic
1110906714 13:80898592-80898614 GAAGGCTGGGGGGCAGCGCTGGG + Intergenic
1111100350 13:83576249-83576271 GAAGCCTGGAGATCATGGAGAGG - Intergenic
1113541021 13:111109568-111109590 GAAGGGTGGAGGGGAGCGAGGGG + Intergenic
1113644896 13:111987663-111987685 GCAGCCTGGAGTGCAGTGATTGG + Intergenic
1113936858 13:113999468-113999490 GAAGCCTGGAGTGCAGTGGGTGG + Intronic
1116777951 14:49203200-49203222 GAAGCCAGGAAGGCAGAGAAAGG + Intergenic
1117732627 14:58739070-58739092 GACATCTGGAGGGCAGGGAGTGG - Intergenic
1119260288 14:73234214-73234236 GAAGGCTGGAGAGAAGAGAGAGG - Intergenic
1119381692 14:74233358-74233380 GAAACAGGGAGGCCAGCGAGGGG - Intergenic
1119889520 14:78172429-78172451 GAAGGATGGAGGGGAGTGAGAGG + Intergenic
1121104572 14:91272011-91272033 GCAGCCTGCAGGGCAGCTGGCGG - Exonic
1121520234 14:94581238-94581260 AAGGCTTGGGGGGCAGCGAGTGG + Intronic
1121526703 14:94624280-94624302 GAAGCCTGGGGGGCAGGAATTGG - Intronic
1121816636 14:96933842-96933864 GAGGCCTGGAGGACAGAAAGAGG + Intergenic
1122167243 14:99837070-99837092 GAAGACTTGAGGGCAGGGTGTGG + Intronic
1122424368 14:101597075-101597097 GGAGGCAGGAGGGCAGAGAGGGG + Intergenic
1125522738 15:40357307-40357329 GAAGCCTGGGGGGCTGGGAGTGG - Intergenic
1127277579 15:57460902-57460924 AAGGCCTGGAGTGCAGAGAGGGG + Intronic
1127865464 15:63028960-63028982 GAAGACTGAAGGGCAGAGTGGGG - Intergenic
1127975878 15:63996972-63996994 CAAGCCTGGAGGGCTGGGTGGGG + Intronic
1128153341 15:65377128-65377150 GATTCCTGGAGGGCGGCGCGTGG - Intronic
1128454163 15:67823370-67823392 GAAGCCTGGAGCGCATGGCGCGG - Intronic
1129901101 15:79149955-79149977 GAAGCCAGGAGGGAAAAGAGTGG - Intergenic
1130382120 15:83379845-83379867 GAGGCCTGGAGGGCAGGGCCTGG - Intergenic
1131174939 15:90203521-90203543 CAAAACTGGAGAGCAGCGAGGGG + Intronic
1131709219 15:95034637-95034659 GAAGACTGGAGGACAACAAGAGG - Intergenic
1132445029 15:101908812-101908834 GAATCCTGGTGGGGAGTGAGGGG - Intergenic
1132518096 16:375252-375274 GAAGGCTGCAGGGGAGCCAGAGG + Exonic
1132658922 16:1053043-1053065 GGAGCCTGGAGGGAGGGGAGTGG + Intergenic
1133286282 16:4692300-4692322 GAAGGCGAGAGGGCAGCGAGGGG - Intergenic
1134502414 16:14779622-14779644 GAAGCCAGAGGGGCAGTGAGGGG + Intronic
1136342668 16:29655153-29655175 AAAGGGTGGAGGGCAGAGAGGGG - Intergenic
1136540187 16:30924282-30924304 GAGGCCGGGACGGCGGCGAGTGG - Intronic
1136540967 16:30927548-30927570 GTAGGCAGGAGGGCAGTGAGTGG - Intronic
1137615106 16:49841721-49841743 GAAGCCTGGAGGCCAGAGAGGGG - Intronic
1138817232 16:60216467-60216489 CTAGTCTGGAGGGCAGCCAGTGG + Intergenic
1139349618 16:66326977-66326999 GAACCCTGGAGGGCTGAGTGTGG - Intergenic
1139468585 16:67166730-67166752 GAAGCCTGTAGCGCAGGGGGAGG - Intronic
1139648296 16:68347809-68347831 GCTGCCTGGAGAGCAGCCAGAGG + Intronic
1139649647 16:68355895-68355917 GAGGGCTGGGGGGCAGGGAGGGG + Intronic
1141169250 16:81680782-81680804 GAAGCCTCCAGGCCAGAGAGTGG + Intronic
1141476078 16:84274377-84274399 GAAGCCAGGAGGGCTGGCAGGGG - Intergenic
1141678216 16:85528903-85528925 AAAGCCAGGAGATCAGCGAGTGG + Intergenic
1141762699 16:86039065-86039087 GGAGCCTGGAGGGAAGGGGGTGG + Intergenic
1141857185 16:86691405-86691427 GATCCCTGGAAGGCAGGGAGAGG + Intergenic
1141873744 16:86807176-86807198 GGAGGCTGGAAGGCAGCGGGAGG + Intergenic
1141876508 16:86828748-86828770 GAGGCCGGAAGGCCAGCGAGGGG - Intergenic
1142008258 16:87700635-87700657 GAACGCTGGAGGGCAGAGGGAGG + Intronic
1143011707 17:3869621-3869643 GGGGCCGGGAGGGCAGGGAGAGG + Intronic
1143102725 17:4513229-4513251 GACGCCTGGAGGGAAGACAGAGG - Exonic
1143626681 17:8114325-8114347 GAAGACTGTGGGGCAGGGAGAGG + Intronic
1144212878 17:13030124-13030146 AATGCCTGGAGAGCAGCCAGTGG + Intergenic
1144473110 17:15562105-15562127 GCAGCCTGGAGGGCTGCTGGTGG - Intronic
1145029774 17:19495610-19495632 GAAGCCTGGAATGCAGTCAGAGG - Intronic
1146208690 17:30925227-30925249 CCAGCCTGGAGTGCAGTGAGTGG + Intronic
1146299550 17:31677573-31677595 GGAGCCAGGAGGTCAGAGAGAGG - Intergenic
1146810326 17:35898152-35898174 GAGGCCTGGAGGACAGCGGTAGG + Intergenic
1147193560 17:38750254-38750276 GAATCCTGGAGGGCTGCCCGAGG + Exonic
1147870178 17:43581705-43581727 GAAGGCTGGAGGGCAGGGAGAGG + Intergenic
1147969127 17:44210404-44210426 GAAGCCCGGCGGGGAGCGCGAGG - Exonic
1148243045 17:46012659-46012681 GATACCTGGAGGGCAGGGAGGGG - Intronic
1148323009 17:46768879-46768901 GAAGGCTGGAGGGAAGGGGGTGG - Intronic
1148806086 17:50264661-50264683 GGAGCCTGGAGGGGAGTCAGAGG + Intergenic
1149696053 17:58616917-58616939 GCAGCCTGGTGGGGAGGGAGAGG - Intronic
1149868160 17:60161942-60161964 GTTGCCTGGAGGGCAGGGATGGG - Intronic
1150470203 17:65430812-65430834 CAAGCCTGGATGGCAGAGGGTGG + Intergenic
1150571529 17:66391144-66391166 GGAGCTTGGAGAGCAGCGGGTGG + Intronic
1151222852 17:72626050-72626072 GAAGCCTGAGGGGCAGCATGAGG + Intergenic
1151373512 17:73666185-73666207 GAAGCCTGGTGGGAAGTGAGTGG + Intergenic
1152015001 17:77744722-77744744 GGAGCCAGGAGAGCAGTGAGTGG - Intergenic
1152209176 17:78994049-78994071 GAATCCTGGAGAGCAGGGAGGGG - Intronic
1152755102 17:82083932-82083954 GGGGCCAGGAGGGCAGCGGGAGG + Intronic
1153620522 18:6973323-6973345 GAAGCCAGGAGGCCAGCAGGGGG - Intronic
1155639510 18:27997157-27997179 GAAGCCTCTAGGACAGCAAGCGG - Intronic
1156335436 18:36167514-36167536 GAAACTAGGAGGGCAGCGGGAGG + Intronic
1157594245 18:48854233-48854255 GAAGCAGGGAGGGCAGGGACTGG + Intronic
1157686933 18:49650408-49650430 CAAGCCTTGAGGGCAGGGCGGGG - Intergenic
1157804077 18:50645051-50645073 GAGGCCTGCAGGCCAGGGAGTGG + Intronic
1160099064 18:75903607-75903629 GAAGCATGCAGGGGAGCGAGAGG - Intergenic
1160236133 18:77087956-77087978 GGCGCCTGGAGGGGAGCGGGAGG + Intronic
1160524677 18:79528060-79528082 GAACGCTGGAAGGCTGCGAGAGG + Intronic
1160603744 18:80033907-80033929 GAAGCGAGAAGGGCAGCGCGAGG - Intronic
1160640283 19:124899-124921 GAATCCTGGTGGGGAGTGAGGGG + Intergenic
1160791262 19:924873-924895 GGAGCCTGGAGGGCGGGCAGGGG - Intergenic
1160806018 19:992497-992519 GCAGCCGTGAGGGCAGGGAGCGG + Intronic
1161244135 19:3239794-3239816 GAAGACTGGAGGCCAGTGAGGGG - Intronic
1161258890 19:3324705-3324727 GAAGAAGGGAGGGCAGGGAGAGG - Intergenic
1161286460 19:3471027-3471049 GAGGACTGGAGGGCAGGGAAGGG + Intergenic
1161480022 19:4505801-4505823 GATGCCTGGTGGGCACCGAGGGG - Intronic
1161662886 19:5558051-5558073 AAGGCCTGGAGGGGAGTGAGAGG + Intergenic
1161664513 19:5567529-5567551 GAGGCCGGGCGGGCAGCGCGAGG + Intergenic
1162326766 19:10004090-10004112 CAAGCCTGGAAGGCAGCCTGAGG + Exonic
1162604604 19:11697108-11697130 CAAGGCTGGAGGGCAGTGAGTGG + Intergenic
1163004439 19:14388750-14388772 GAACCCTGGATTGCAGCGACAGG - Exonic
1163063023 19:14773984-14774006 GAACCCTGGATTGCAGCGACAGG + Exonic
1163525904 19:17821325-17821347 GAAGCCAGGAGGCCTGCGACCGG - Exonic
1164670108 19:30067588-30067610 GGATCCTGGAGGGCAGTCAGGGG + Intergenic
1164678592 19:30119346-30119368 GAAGCCCAGAGAGCAGGGAGCGG + Intergenic
1164937393 19:32224846-32224868 GAACATTGGCGGGCAGCGAGCGG - Intergenic
1164938210 19:32231154-32231176 GCAGCCTGGTGGGGAGAGAGCGG - Intergenic
1165163316 19:33831688-33831710 AAAACCTGGAGGGCCTCGAGTGG + Intergenic
1165247538 19:34505808-34505830 GCAGGCTGGAGGCCAGGGAGAGG + Exonic
1165426184 19:35746653-35746675 GAAGTCTGGAGAGCAGCCGGAGG + Intronic
1166667440 19:44689523-44689545 GAGGCCTGGAGGGCAGGGCCTGG - Intergenic
1166846350 19:45730891-45730913 GGAGGCTGGAGAGGAGCGAGTGG - Exonic
1167246049 19:48373795-48373817 GGAGCCAGGAGGGCTGTGAGCGG - Intronic
1167453722 19:49587372-49587394 CCAGCCTGGAGGGCAGTGAGTGG + Intronic
1167515584 19:49921512-49921534 GACGCCTGCAGGGAAGAGAGGGG + Intronic
1167940033 19:52939369-52939391 GCAGCCTGGGGGGCAGAGCGAGG - Intronic
1167988276 19:53336478-53336500 GCAGCCTGGGGGGCAGAGCGAGG + Intronic
1168028985 19:53664865-53664887 GGAGGCTGGAGGGCAAAGAGTGG + Intergenic
925034639 2:676404-676426 GCAGCTTGGAGGGCAGGGCGGGG - Intronic
925034647 2:676429-676451 GCAGCTTGGAGGGCAGGGCGGGG - Intronic
925052974 2:831383-831405 GAAGCCTGCTGCGCAGCGAACGG - Intergenic
926093110 2:10063226-10063248 GAGGCCTGGAGAGAAGAGAGGGG + Intronic
926269719 2:11355947-11355969 GAGGTCAGGAGGGCAGAGAGAGG - Intergenic
926340177 2:11898761-11898783 GATGCCTGAAGGGCAGAAAGGGG + Intergenic
926917810 2:17909674-17909696 GAAGACTTGAGGGAAGTGAGAGG + Intronic
927491933 2:23526541-23526563 GAAGGTTGGAGGGGAGAGAGAGG + Intronic
928123203 2:28598782-28598804 GGAGCCTGCAGAGCAGGGAGTGG + Intronic
928494410 2:31817466-31817488 GAGGCTTGGAGGGAAGCAAGTGG - Intergenic
929665597 2:43831699-43831721 GAAGAGAGGAGGGCAGCGGGGGG + Intronic
929924274 2:46196179-46196201 GAAGGCTGGAGGGGAGGGCGGGG - Intergenic
930122051 2:47768411-47768433 GGAGGGTGGTGGGCAGCGAGAGG - Intronic
930734111 2:54757698-54757720 GAAGGCTGGAGTGGAGGGAGGGG - Intronic
930748816 2:54912562-54912584 GATTCCTGGGGGGCAGAGAGAGG - Intronic
930886389 2:56331938-56331960 GCAGCCTGGGGGGCGGGGAGGGG - Intronic
931193195 2:60025110-60025132 AAAGCCTGAAGGGGAGCAAGAGG + Intergenic
932580546 2:72990281-72990303 GAAGGCTGGGAGGCAGCCAGGGG + Intronic
932701910 2:73997891-73997913 GATGCCTTGAGGGCAGAGACTGG + Intronic
932768937 2:74489807-74489829 GAAGGCAGGAAAGCAGCGAGGGG + Intronic
935063101 2:99624856-99624878 GAAGGCGGGAGGGCAGCAAGTGG + Intronic
936389040 2:112055336-112055358 GATGCCTGGAAGGCAGAGATAGG - Exonic
936991584 2:118372621-118372643 GCAGCCTGGAGGGCAAGAAGTGG - Intergenic
937438536 2:121898251-121898273 GCAGCATGGAGGGCAGCATGGGG - Intergenic
937840072 2:126515891-126515913 GAACCCAGGAGGGGAGCCAGAGG + Intergenic
937911370 2:127077200-127077222 GGAACAAGGAGGGCAGCGAGCGG + Intronic
941679243 2:168379154-168379176 GAAGCCTTGTGGGCAGAAAGTGG - Intergenic
941703780 2:168635463-168635485 GAAGGCTGGAAGGCTGCAAGAGG - Intronic
942042307 2:172078899-172078921 GTAGCCTGGGGGACAGGGAGAGG + Intronic
945262574 2:207858519-207858541 CCAGCCTGGAGTGCAGTGAGTGG + Intronic
946171604 2:217899028-217899050 GGAGAGTGGAGGGCAGCGAAAGG + Intronic
946188455 2:217994751-217994773 GGGGCCTGGAGGGCAGGGACAGG + Intronic
946773949 2:223118037-223118059 GGAGCCTGGGGTGCAGGGAGGGG + Intronic
947872914 2:233449703-233449725 GCAGGCTGGAGGGCTGCAAGCGG - Intronic
949001811 2:241619108-241619130 GGAGCCTGCAGGGCTGGGAGGGG - Intronic
1168835455 20:874410-874432 AAAGCCTGGAGGCCACCCAGAGG + Exonic
1169060935 20:2659906-2659928 GAGGCATGGTGGGCAGCGTGGGG + Intronic
1169065010 20:2690230-2690252 CAAGCCTGGTGGGCAGCAGGAGG + Intergenic
1169075850 20:2759426-2759448 GAAGCCTGTGGGGCTGCTAGCGG - Exonic
1169257234 20:4108874-4108896 GAGGCCGGAAGGGCAGTGAGAGG - Intergenic
1170601713 20:17846400-17846422 GAAGCCTGGAGGGCAGAGGCGGG - Intergenic
1170643913 20:18179612-18179634 GAAGCCTAGAAGGCAGCCTGGGG - Intronic
1170836152 20:19886306-19886328 GCAGCCTGGAGCCCAGCCAGGGG + Intergenic
1170847643 20:19975401-19975423 GCAGCCTGGAGGACTACGAGGGG + Exonic
1171225890 20:23441905-23441927 CAAGGCGGGAGGGCAGCGTGGGG + Intronic
1171457227 20:25278919-25278941 GAAGCCTGGAGAACAGGGAGGGG - Intronic
1172052175 20:32126453-32126475 GAAACCTGAAGGGAGGCGAGAGG - Intronic
1172113956 20:32562979-32563001 GGAGAGTGGAGGGCAGAGAGTGG + Intronic
1172518345 20:35551469-35551491 CAAGCCTGGAGTTCAGGGAGAGG + Intronic
1172939253 20:38643574-38643596 GGAGCTGGGAGGGCAGCAAGAGG - Intronic
1173191973 20:40883620-40883642 GACACCTGGAGTGCAGTGAGGGG + Intergenic
1173585678 20:44181162-44181184 AAAGCCTAGAGGACAGGGAGGGG + Intronic
1174264148 20:49319116-49319138 GAAGCTTGGAGGGCCTCGAGGGG + Intergenic
1179419176 21:41222387-41222409 GAAGCCTGGAAGGGAGCGATGGG + Intronic
1179600187 21:42472186-42472208 GAACCCTGCGGGGCAGCGGGCGG + Intergenic
1180071996 21:45441261-45441283 GAACCCTGAAGGGCAGCAGGTGG - Intronic
1180174745 21:46082147-46082169 GGAGCCTGGACGGCAAAGAGGGG + Intergenic
1180694135 22:17741175-17741197 GTAGACTGGACGGCAGGGAGTGG - Intronic
1180801559 22:18634315-18634337 GGGTCCTGGAGGTCAGCGAGCGG + Intergenic
1180904821 22:19402046-19402068 GAAGACTGGACGGCAGTGAGGGG - Intronic
1181005896 22:20013382-20013404 GAAGCCTGAAGGCCAGCTGGTGG - Intronic
1181220163 22:21360946-21360968 GGGTCCTGGAGGTCAGCGAGCGG - Intergenic
1182092051 22:27602561-27602583 GGGGCCTGGAGGGTAGGGAGGGG + Intergenic
1183625738 22:39000305-39000327 GAAGACACGAGGGGAGCGAGGGG + Intergenic
1183693436 22:39404522-39404544 CCAGCCTGGAGTGCAGTGAGGGG - Intronic
1183710447 22:39500312-39500334 GAAGCATCGGGGGCAGGGAGAGG + Intronic
1184256991 22:43292971-43292993 GAAGCCTGGGGAGGAGGGAGAGG + Intronic
1184279575 22:43429309-43429331 TCAGCCTGGAGTGCAGGGAGGGG + Intronic
1184651503 22:45921329-45921351 GAAGCCTCAAAGGCACCGAGGGG + Exonic
1185088018 22:48751084-48751106 CAAGCCTGGCCCGCAGCGAGGGG - Intronic
1185329538 22:50245959-50245981 GCAGCCAGGAGTGCAGCGTGGGG + Exonic
1185360741 22:50405247-50405269 GAGGCCTGGAGGGAGGCAAGAGG + Intronic
1185360767 22:50405365-50405387 GAGGCCTGGAGAGAGGCGAGAGG + Intronic
1185360786 22:50405464-50405486 GAGGCCTGGAGAGAGGCGAGAGG + Intronic
1185360812 22:50405601-50405623 GAGGCCTGGAGAGAAGTGAGAGG + Intronic
1185360823 22:50405660-50405682 GAGGCCTGGAGAGAAGTGAGAGG + Intronic
1185360851 22:50405797-50405819 GAGGCCTGGAGAGAGGCGAGAGG + Intronic
1185360885 22:50405953-50405975 GAGGCCTGGAGAGAGGCGAGAGG + Intronic
1185360922 22:50406149-50406171 GAGGCCTGGAGAGAGGCGAGAGG + Intronic
950967124 3:17154307-17154329 GTAACCTGGAGGGCAGGGAGAGG + Intergenic
952068258 3:29599129-29599151 CAAGCATGGTGGGCAGAGAGTGG + Intronic
953912257 3:46899062-46899084 GGAGCCTTGATGGCAGCGCGGGG - Intronic
953914587 3:46910116-46910138 GAAGCCTCCAAGGCAGTGAGGGG + Intergenic
955709157 3:61760758-61760780 GGGGCCTGGAGAGCAGGGAGGGG - Intronic
957863726 3:85994710-85994732 GGAGCCTGGAGGAGAGGGAGAGG + Intronic
962240954 3:133750480-133750502 GAAGGCTGGAGGGAAGCCAAGGG - Intronic
963282496 3:143398402-143398424 GAAGCGTGGAAGGCAGGCAGCGG + Intronic
965134324 3:164741952-164741974 GAAGCCTGGTGGGCAGCTGTTGG + Intergenic
965611593 3:170549533-170549555 GCAGCCTGGATTGCAGAGAGGGG - Intronic
967067980 3:185937692-185937714 GAAGCCGGGAGGGCAGGCAAGGG - Intronic
968519649 4:1029700-1029722 GAAGCCAGGAGGGCCGGGCGGGG - Intergenic
968663788 4:1809996-1810018 GAGGCCTGCAGGGCAGTGGGGGG + Intergenic
969293199 4:6253492-6253514 TGAGCCTGGAGGGCAGACAGGGG + Intergenic
969398351 4:6937827-6937849 GAAGCCTGGAGGGTAGTGGGGGG + Intronic
970407772 4:15779491-15779513 GAAGCCGGGAAGGCAGGCAGGGG + Intronic
973230842 4:47837524-47837546 GATGCTTGGAGGGCACCGTGCGG + Intronic
973596043 4:52490784-52490806 GAAGGCAGGAAGGCAGGGAGGGG + Intergenic
976008233 4:80456386-80456408 CAAGCAGGGAGAGCAGCGAGAGG + Intronic
977931782 4:102757692-102757714 GAAGCCTGGAGACCAACCAGGGG - Intronic
979553265 4:122015433-122015455 GAAGCGTGGATGGCAGCCTGAGG + Intergenic
979624220 4:122827404-122827426 GCAGGCTGGAGGGGAGAGAGCGG - Intronic
981221999 4:142248028-142248050 GGAGCCTGGAGGGCAGGGGCAGG - Intronic
982251684 4:153413636-153413658 CCAGGCTGGAGGGCAGTGAGTGG - Intronic
984822858 4:183898269-183898291 GAAGCAGGGAGAGCAGTGAGAGG + Intronic
984831849 4:183983233-183983255 GAAGCATGGAGGGAACTGAGAGG - Intronic
985385859 4:189447673-189447695 GAGGCCTGGAGGCCAGTGAAGGG - Intergenic
985898402 5:2764722-2764744 GAAGCGTGGCTGGCAGGGAGAGG - Intergenic
987123017 5:14785289-14785311 GAGGCCTGGAGGGAGGTGAGAGG + Intronic
991130890 5:63121290-63121312 GACCCCTGGAGTGCAGGGAGTGG + Intergenic
992257918 5:74940571-74940593 GAAGAGTGGAGGGCTGGGAGCGG + Intergenic
992412528 5:76520745-76520767 GCAGGCTGGAGTGCAGTGAGTGG + Intronic
992529971 5:77644545-77644567 GGAGCCGGGCGGGGAGCGAGCGG - Intergenic
992750492 5:79856701-79856723 GAAGCCTGGGGGAGACCGAGGGG + Intergenic
992910218 5:81389167-81389189 GAAGGCTGGAGGGCAGAGGAGGG + Intronic
993695485 5:91056697-91056719 GAAGCCTAGTGGGCAGCCATCGG - Intronic
997210079 5:132072068-132072090 GGAGGCTGGAGGGCAGGGAAGGG - Intergenic
997625915 5:135330491-135330513 GGAGCATGGAGGGCAGGGCGGGG + Intronic
997690790 5:135826180-135826202 GCAGCCTGGTGGGCTGAGAGGGG - Intergenic
998178115 5:139914460-139914482 GAACCCTGGAAAGCAGCGAGAGG - Intronic
998445885 5:142198079-142198101 GAAGCGGGGCGGGCAGGGAGAGG - Intergenic
1001083772 5:168685795-168685817 GAAGCCTGGTGGGCAGCGGCAGG + Exonic
1001115070 5:168932609-168932631 GCAGCCTGGTGGGCAGCCAATGG + Intronic
1002359946 5:178662432-178662454 TCAGCCTGGAGGGCAGTGAGGGG + Intergenic
1002527179 5:179821228-179821250 GACGCCTGGCGGGCCGTGAGGGG + Intronic
1002737065 5:181401473-181401495 GAATCCTGGTGGGGAGTGAGGGG - Intergenic
1002747632 6:73306-73328 GAATCCTGGTGGGGAGTGAGGGG + Intergenic
1003028518 6:2579924-2579946 GTAGCCTGGGGTACAGCGAGAGG - Intergenic
1003422740 6:5973252-5973274 AAATCCTGGAGGCCAGCGATGGG + Intergenic
1003540272 6:7012526-7012548 GAAGGAAGGAGGGCAGCAAGGGG + Intergenic
1005632833 6:27724866-27724888 CCAGGCTGGAGGGCAGTGAGTGG + Intergenic
1005813856 6:29534838-29534860 TAAGCCTGGAAGTCAGAGAGTGG + Intergenic
1005895015 6:30170650-30170672 GAAGACAGGAGGGCAGCTAATGG - Intronic
1006473749 6:34242499-34242521 GAAACCTGCAGGGAAGCAAGGGG + Intronic
1006665202 6:35688619-35688641 GAAGCCTCGAGGGGAGCGCGCGG - Intronic
1007363570 6:41374732-41374754 GAGGAGTGGAGGCCAGCGAGCGG - Intergenic
1007673389 6:43575602-43575624 GAGGCGCGGAGGGCCGCGAGGGG + Intronic
1010569906 6:77463874-77463896 AAAGCTTGCAGGCCAGCGAGAGG + Intergenic
1012126157 6:95430132-95430154 GAAGCCAAGAGGGCAGAGAATGG - Intergenic
1014069927 6:117169078-117169100 GAAGGATGGTGGGCAGGGAGAGG - Intergenic
1015429165 6:133110140-133110162 GATGCCAGGAGGCCAGTGAGAGG + Intergenic
1016401332 6:143684146-143684168 TGAGCCTGGAGTGCAGAGAGAGG - Intronic
1016741921 6:147537710-147537732 CCAGGCTGGAGGGCAGTGAGTGG - Intronic
1017124243 6:151050999-151051021 GAAGGGTGGAGGGCGGGGAGTGG - Intronic
1018869301 6:167769089-167769111 GAAGTCTGGGAGGCAGTGAGGGG - Intergenic
1019242161 6:170677043-170677065 GAATCCTGGTGGGGAGTGAGGGG - Intergenic
1019582797 7:1775636-1775658 GAAGCCTTGAGGGCAGCTGGAGG - Intergenic
1019890317 7:3941128-3941150 GAAACCTGGAGAGAAGCAAGGGG + Intronic
1021334998 7:19389383-19389405 CCAGGCTGGAGGGCAGCGGGCGG + Intergenic
1022103959 7:27185374-27185396 GAAGCCGGGAGGGAGGGGAGAGG - Intergenic
1022692607 7:32671361-32671383 CAAGCCTGAAGGACAGCGACGGG + Intergenic
1023681707 7:42694066-42694088 GAAGCTTGGAGGCCAACTAGAGG - Intergenic
1024130714 7:46350196-46350218 GAAGCCTGGAGAGCAGTAAGAGG + Intergenic
1024579091 7:50787601-50787623 TAGGCCTGCAGGGCAGTGAGTGG - Intronic
1024834521 7:53500428-53500450 TGAGCTTGGAGGGCAGAGAGAGG + Intergenic
1026032136 7:66803514-66803536 CAAGCCTGGGGGACAGCGAAGGG - Intronic
1026126918 7:67587237-67587259 GAAGGTTGGAGGGCAGTGAAGGG + Intergenic
1026567357 7:71500624-71500646 GATGCTTGGAGGACAGCCAGTGG - Intronic
1026675415 7:72424248-72424270 GAAACCTGGAGGGCTGCCTGGGG - Intronic
1026970147 7:74462840-74462862 GAGGCCCGGAGGGCAGCGGCAGG - Intronic
1027051628 7:75024874-75024896 GAAGGCAGGAGGGCATGGAGAGG - Intergenic
1027269591 7:76512408-76512430 GAAGCCGGGAAGGCAGGGCGTGG + Intronic
1027320301 7:77006302-77006324 GAAGCCGGGAAGGCAGGGCGTGG + Intergenic
1029154322 7:98504211-98504233 GAAGCCAGGAAGGAAGCAAGGGG + Intergenic
1029513217 7:101009781-101009803 GAAGCCCAGAGGGGAGAGAGAGG + Intronic
1031640174 7:124153374-124153396 AAAGGCTGGAGGGCAGGAAGAGG + Intergenic
1031910407 7:127511121-127511143 GAAGGCAGGAGGTCAGAGAGAGG + Intergenic
1032024321 7:128429613-128429635 AAAGCCTTGAGGGCAGTGACTGG - Intergenic
1032080810 7:128857594-128857616 GAAGCCAGGAGGGAAGAAAGTGG - Intronic
1032091443 7:128913566-128913588 GAAGCCAGGAGGGAAGAAAGTGG + Intergenic
1033899408 7:146116721-146116743 GGAGCCTGGAGGGGGGTGAGGGG + Exonic
1033991125 7:147288122-147288144 GAAGCCTGAAGGACAACAAGAGG - Intronic
1034328524 7:150260645-150260667 GAAGCTTAGGGGGCAGCCAGAGG - Intronic
1034764689 7:153708743-153708765 GAAGCTTAGGGGGCAGCCAGAGG + Intergenic
1034974350 7:155439245-155439267 TCAGCCTGGAGGGCAGAGACAGG - Intergenic
1035171145 7:157018063-157018085 GGAGCCGGGAGGGTAGAGAGGGG + Intergenic
1035505957 8:131108-131130 GAATCCTGGTGGGGAGTGAGGGG + Intergenic
1035535253 8:386152-386174 GCAGCCTGGGGGCCAGAGAGCGG - Intergenic
1035786590 8:2266144-2266166 GGAGCCTGGAGGGCACCGCTGGG + Intergenic
1035806217 8:2455572-2455594 GGAGCCTGGAGGGCACCGCTGGG - Intergenic
1036143039 8:6225721-6225743 GCAGCCTGGAGGACTGCGTGGGG - Intergenic
1036807210 8:11843611-11843633 CAAGGCTGGAGGGCATCCAGGGG + Exonic
1039546204 8:38413323-38413345 ACTGCCTGGAGGGCAGGGAGTGG - Exonic
1040600450 8:48878691-48878713 GTGGCCTGGAGGGCAGCCATGGG + Intergenic
1042307048 8:67343405-67343427 GAGGCGTGGAGGGCAGCGGCAGG + Exonic
1043502526 8:80872602-80872624 GAAGTTTTGAGGGCAGCAAGTGG - Intronic
1044630586 8:94274478-94274500 GAAGCCTGGAAGGCAGAGCCTGG + Intergenic
1045564450 8:103299045-103299067 GAAGCGGGGAGGGCCTCGAGGGG + Intronic
1048734726 8:137486589-137486611 GGAGCCTGGTGGGCAGTGATTGG - Intergenic
1049199797 8:141334479-141334501 AAGGCCTGGAGGACAGAGAGGGG - Intergenic
1049385648 8:142341701-142341723 GCAGCCTGCCGGGCAGTGAGTGG - Intronic
1049427437 8:142543706-142543728 AAGGTCTGGAGGGCAGGGAGGGG + Exonic
1049537285 8:143188267-143188289 GAACCATTGGGGGCAGCGAGCGG + Intergenic
1049552494 8:143267075-143267097 GAGGCCTGGAGTGCACGGAGGGG + Intronic
1049554743 8:143276185-143276207 GGAGCCGGCAGGGCAGCGCGCGG + Exonic
1049600162 8:143503905-143503927 GAAGGCTGGAGGACAGCGTCAGG - Intronic
1049748384 8:144272571-144272593 GAACCCGGGTGGGCAGCGGGGGG - Intronic
1049797783 8:144504480-144504502 GTGACCTGGAGGGCAGCGAGGGG - Intronic
1050643250 9:7691965-7691987 GAAGCCTGGTGGGAAGTGATTGG + Intergenic
1052928341 9:34036893-34036915 GAACCCTGGAGGGGAGGCAGAGG - Intronic
1053070116 9:35096244-35096266 GCCGCCTGGCGGGCACCGAGGGG + Exonic
1053173640 9:35907629-35907651 GAGGGCTGGGAGGCAGCGAGTGG + Intergenic
1053884791 9:42636012-42636034 TAGGACTGCAGGGCAGCGAGGGG + Intergenic
1054223812 9:62443463-62443485 TAGGACTGCAGGGCAGCGAGGGG + Intergenic
1055055770 9:72022426-72022448 GAAGCCTGGTGGGAAGTGATTGG + Intergenic
1056034236 9:82586475-82586497 CTAGCCTGGAGGGTAGCTAGTGG - Intergenic
1056135127 9:83623376-83623398 GCAGGCTGGAGGGCGGGGAGAGG - Intronic
1057245645 9:93452001-93452023 GCAGCCTGGTGGGCGGCGGGCGG + Exonic
1057302723 9:93896053-93896075 GCAGCCTGGAGGAGACCGAGGGG + Intergenic
1058799872 9:108535124-108535146 GAAGACTGGAGGGCAGGACGAGG - Intergenic
1059461027 9:114430183-114430205 CAGGCCAGGAGGGCAGTGAGGGG + Intronic
1059485256 9:114622056-114622078 GATGCCAGGAGGGCACAGAGTGG + Intronic
1059676769 9:116547864-116547886 GATGCCTGGAGGGGAGGGAATGG - Intronic
1060478171 9:124000276-124000298 GGGGCCTGGAGGGCTGCGCGTGG + Intergenic
1060826803 9:126692328-126692350 CCAGCCTGGGGGGCAGCGGGAGG + Intronic
1060890558 9:127185267-127185289 GAAGCCTGGAGTTCAACGAGGGG - Intronic
1061268617 9:129523279-129523301 GGGGCCTGGAGTGCAGGGAGGGG + Intergenic
1061575543 9:131503621-131503643 GAAGCCTGGAGGAGAACGTGGGG + Intronic
1061748343 9:132756399-132756421 GAAGCCAGGCGGGGAGCCAGAGG + Intronic
1062500010 9:136848252-136848274 GGAGCCTGGAGGGCAAAGCGTGG + Exonic
1203770143 EBV:45742-45764 GAATCCTGGAGGGCATGAAGAGG + Intergenic
1203602352 Un_KI270748v1:26265-26287 GAATCCTGGTGGGGAGTGAGGGG - Intergenic
1185778831 X:2828912-2828934 GAGGCCCCGAGGGCAGCGATTGG - Exonic
1188204955 X:27344574-27344596 GGAGCCTGGTGGGCAGTGATTGG + Intergenic
1188263302 X:28041784-28041806 GAAGCCTGTAGGGAGGTGAGGGG + Intergenic
1189361017 X:40351440-40351462 GGAGCCTGAAGGGCAGCCAGAGG + Intergenic
1190065826 X:47241183-47241205 GAAGCCAGGAGGAAAGAGAGAGG - Intronic
1192152051 X:68718550-68718572 GATGCCTGGAGTCCAGCCAGGGG - Exonic
1195687658 X:107600993-107601015 GAAGGCTGGAGGCCAGCATGGGG + Exonic
1200090999 X:153635937-153635959 GAAGCCTGGAGGTCACCCAAGGG + Intergenic
1200252613 X:154561756-154561778 GCAGCGTGGTGGGCAGTGAGCGG + Exonic
1200265154 X:154642660-154642682 GCAGCGTGGTGGGCAGTGAGCGG - Intergenic
1201291193 Y:12421592-12421614 GGGGCCCGGAGGGCAGCGATTGG + Intergenic