ID: 1081966358

View in Genome Browser
Species Human (GRCh38)
Location 11:47172521-47172543
Sequence GGCACCCAGCAGAGTGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 402
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081966351_1081966358 22 Left 1081966351 11:47172476-47172498 CCAGCGGTGTCAAAGCCAAAGAC 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1081966358 11:47172521-47172543 GGCACCCAGCAGAGTGAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 381
1081966356_1081966358 7 Left 1081966356 11:47172491-47172513 CCAAAGACAGACGTGGCTGGGGT 0: 1
1: 0
2: 0
3: 3
4: 138
Right 1081966358 11:47172521-47172543 GGCACCCAGCAGAGTGAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 381
1081966350_1081966358 26 Left 1081966350 11:47172472-47172494 CCAACCAGCGGTGTCAAAGCCAA 0: 1
1: 0
2: 0
3: 7
4: 82
Right 1081966358 11:47172521-47172543 GGCACCCAGCAGAGTGAGACAGG 0: 1
1: 0
2: 1
3: 19
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081966358 Original CRISPR GGCACCCAGCAGAGTGAGAC AGG Intronic