ID: 1081967844

View in Genome Browser
Species Human (GRCh38)
Location 11:47180231-47180253
Sequence GCGCAGCTGCTCCTGGGAGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 397
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 343}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081967833_1081967844 29 Left 1081967833 11:47180179-47180201 CCTGTACCTTCTCGGCCTCCTTG 0: 1
1: 0
2: 1
3: 15
4: 193
Right 1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG 0: 1
1: 0
2: 4
3: 49
4: 343
1081967837_1081967844 11 Left 1081967837 11:47180197-47180219 CCTTGGCACAGCGTTCCACCCGT 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG 0: 1
1: 0
2: 4
3: 49
4: 343
1081967835_1081967844 23 Left 1081967835 11:47180185-47180207 CCTTCTCGGCCTCCTTGGCACAG 0: 1
1: 0
2: 2
3: 27
4: 263
Right 1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG 0: 1
1: 0
2: 4
3: 49
4: 343
1081967836_1081967844 14 Left 1081967836 11:47180194-47180216 CCTCCTTGGCACAGCGTTCCACC 0: 1
1: 0
2: 0
3: 8
4: 111
Right 1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG 0: 1
1: 0
2: 4
3: 49
4: 343
1081967839_1081967844 -7 Left 1081967839 11:47180215-47180237 CCCGTTCCTGCAGTTTGCGCAGC 0: 1
1: 0
2: 0
3: 7
4: 104
Right 1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG 0: 1
1: 0
2: 4
3: 49
4: 343
1081967840_1081967844 -8 Left 1081967840 11:47180216-47180238 CCGTTCCTGCAGTTTGCGCAGCT 0: 1
1: 0
2: 0
3: 8
4: 144
Right 1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG 0: 1
1: 0
2: 4
3: 49
4: 343
1081967838_1081967844 -4 Left 1081967838 11:47180212-47180234 CCACCCGTTCCTGCAGTTTGCGC 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1081967844 11:47180231-47180253 GCGCAGCTGCTCCTGGGAGACGG 0: 1
1: 0
2: 4
3: 49
4: 343

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081967844 Original CRISPR GCGCAGCTGCTCCTGGGAGA CGG Exonic