ID: 1081967885

View in Genome Browser
Species Human (GRCh38)
Location 11:47180441-47180463
Sequence CTGAAGGAGGTGAGGCTGGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 989
Summary {0: 1, 1: 0, 2: 12, 3: 119, 4: 857}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081967885_1081967900 29 Left 1081967885 11:47180441-47180463 CCACCCAGCCTCACCTCCTTCAG 0: 1
1: 0
2: 12
3: 119
4: 857
Right 1081967900 11:47180493-47180515 GGAAGCCGTCCTCGGCCGCCCGG 0: 1
1: 0
2: 1
3: 4
4: 119
1081967885_1081967895 0 Left 1081967885 11:47180441-47180463 CCACCCAGCCTCACCTCCTTCAG 0: 1
1: 0
2: 12
3: 119
4: 857
Right 1081967895 11:47180464-47180486 CCTCTTCAGCCAGGGCTTCTGGG 0: 1
1: 0
2: 2
3: 15
4: 289
1081967885_1081967896 8 Left 1081967885 11:47180441-47180463 CCACCCAGCCTCACCTCCTTCAG 0: 1
1: 0
2: 12
3: 119
4: 857
Right 1081967896 11:47180472-47180494 GCCAGGGCTTCTGGGCCTTGCGG 0: 1
1: 0
2: 4
3: 35
4: 379
1081967885_1081967890 -9 Left 1081967885 11:47180441-47180463 CCACCCAGCCTCACCTCCTTCAG 0: 1
1: 0
2: 12
3: 119
4: 857
Right 1081967890 11:47180455-47180477 CTCCTTCAGCCTCTTCAGCCAGG 0: 1
1: 0
2: 5
3: 75
4: 449
1081967885_1081967891 -8 Left 1081967885 11:47180441-47180463 CCACCCAGCCTCACCTCCTTCAG 0: 1
1: 0
2: 12
3: 119
4: 857
Right 1081967891 11:47180456-47180478 TCCTTCAGCCTCTTCAGCCAGGG 0: 1
1: 0
2: 2
3: 21
4: 347
1081967885_1081967893 -1 Left 1081967885 11:47180441-47180463 CCACCCAGCCTCACCTCCTTCAG 0: 1
1: 0
2: 12
3: 119
4: 857
Right 1081967893 11:47180463-47180485 GCCTCTTCAGCCAGGGCTTCTGG 0: 1
1: 0
2: 0
3: 16
4: 242
1081967885_1081967898 21 Left 1081967885 11:47180441-47180463 CCACCCAGCCTCACCTCCTTCAG 0: 1
1: 0
2: 12
3: 119
4: 857
Right 1081967898 11:47180485-47180507 GGCCTTGCGGAAGCCGTCCTCGG 0: 1
1: 0
2: 0
3: 1
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081967885 Original CRISPR CTGAAGGAGGTGAGGCTGGG TGG (reversed) Exonic
900415519 1:2532750-2532772 CTGCCGGAGGTGAGGGTGGTGGG + Intergenic
900460140 1:2798790-2798812 TTGAAGGCTGAGAGGCTGGGAGG - Intronic
900525204 1:3125167-3125189 CTCAAGGAGGTGCAGCTGCGGGG - Intronic
901167285 1:7229596-7229618 CAGGAGGAGGGGAGGCTAGGAGG + Intronic
901262677 1:7885532-7885554 CAGCAGGAGTGGAGGCTGGGTGG - Intergenic
901413144 1:9098944-9098966 CAGAAGGAGGTGACCCTGTGGGG + Intergenic
901574698 1:10191495-10191517 GTGTTGGAGGTGAGGCTTGGTGG - Intergenic
901689192 1:10961385-10961407 CTGAAGGAGCAGGGGCTGAGCGG - Intronic
901689759 1:10965111-10965133 CTGAATGAGGGCAGCCTGGGAGG - Intronic
901913858 1:12482265-12482287 CTGGATAAGGGGAGGCTGGGTGG - Intronic
902316522 1:15623963-15623985 CTGAAGCAGGAGAACCTGGGAGG + Intronic
903017328 1:20369421-20369443 CTGGTGGGGGTGAGGCAGGGAGG - Intergenic
903129125 1:21266914-21266936 CTCAACGATGTGAGGATGGGAGG - Intronic
903134230 1:21298803-21298825 ATGGAGCAGGTGAGGCAGGGTGG - Intronic
903693864 1:25193288-25193310 CTGAAGGAGGTGCTGCTGCCAGG + Intergenic
903805898 1:26005466-26005488 CAGAAGGAGGCCAGGCTGAGGGG + Intergenic
904421562 1:30397793-30397815 CTGAAGGAGGGGTTGGTGGGTGG - Intergenic
904424697 1:30415817-30415839 AGGAGGGAGCTGAGGCTGGGAGG - Intergenic
904609364 1:31716589-31716611 CTGAGGGAGGTGGAGCTGGATGG - Intergenic
904625830 1:31801544-31801566 CTGGGGGAGGGCAGGCTGGGTGG + Intronic
904937328 1:34140935-34140957 CTGCAGGAAGTGAGGCTGGAGGG - Intronic
905293375 1:36938651-36938673 CTAAAAGAGGTGGGGCTGGGGGG - Intronic
905389036 1:37624470-37624492 CTGAGGGAGGTGGGGTTGGGGGG - Intronic
905460668 1:38120846-38120868 CTGAAGGGGGTGATGGAGGGAGG - Intergenic
905915509 1:41681735-41681757 CTGAGGGAGGAGGGGCTGGGAGG + Intronic
906035622 1:42748693-42748715 CTGCAGGAGATGGGGCTGAGTGG + Intronic
906465898 1:46078962-46078984 CTGAGGGAGGGGAGAATGGGGGG + Intronic
906603004 1:47145398-47145420 CTGGGGGAGTTGAGGCTTGGTGG - Intronic
906719415 1:47994675-47994697 CAGAGGGAGGTGGGGATGGGAGG + Intronic
906815623 1:48875295-48875317 CTGAAGGCAGTGAGGTTGAGAGG - Intronic
907049221 1:51318414-51318436 CTTGAGGGGGTCAGGCTGGGTGG - Intronic
908007312 1:59740074-59740096 CTGAAGGAGGACAGGGAGGGAGG - Intronic
908768016 1:67571551-67571573 CTGAAGGAGAAGGGGCTGGGAGG + Intergenic
909817827 1:80018636-80018658 ATGAAGGAGCTGAGAATGGGGGG - Intergenic
910457252 1:87411116-87411138 CCAAAGGAAGTGAGGCAGGGTGG - Intergenic
911039649 1:93581909-93581931 CTGATGGAGCTGAGGCAAGGGGG + Intronic
911247013 1:95529362-95529384 GTGAAGGAGGTGAGTCAGGTAGG - Intergenic
911318765 1:96386921-96386943 ATAAAGGAGGTGACGGTGGGGGG - Intergenic
911725187 1:101235853-101235875 CTTAAGAACGTGAGGCTGAGAGG - Intergenic
911757751 1:101579735-101579757 CTGAAGAAGGTGAAGCTCCGAGG + Intergenic
912904833 1:113693357-113693379 GTAAAGGAGGTGAAGCTGGAAGG + Intergenic
913682734 1:121202324-121202346 CTGGAGGAAGTGAGGAGGGGAGG - Intronic
913686269 1:121234971-121234993 GTGAAGGAAGTGAGGGAGGGAGG - Intronic
914034576 1:143989950-143989972 CTGGAGGAAGTGAGGAGGGGAGG - Intergenic
914151334 1:145045347-145045369 GTGAAGGAAGTGAGGGAGGGAGG + Intronic
914154876 1:145078018-145078040 CTGGAGGAAGTGAGGAGGGGAGG + Intronic
914250966 1:145920985-145921007 CTGAAGGAGGTGAGATTGGGAGG - Intergenic
914919317 1:151837112-151837134 CAGAAGGAGGTGGGGGTGGGGGG - Intergenic
915328314 1:155092687-155092709 CTGAGGGAGAGGGGGCTGGGGGG + Intergenic
915396608 1:155589997-155590019 GTAAAGGGGGTGAGGCGGGGCGG + Intergenic
916258771 1:162819478-162819500 CTGATGGAAGTGATGGTGGGAGG + Intergenic
916323704 1:163533847-163533869 GTTAAGAAGGTGGGGCTGGGTGG - Intergenic
916561217 1:165935337-165935359 AAGCAGGAGGTGAGGCTGGCTGG - Intergenic
916817334 1:168366720-168366742 CTTATGGAGATGAGGTTGGGAGG + Intergenic
916853182 1:168724782-168724804 TTGAAGGTGGAGAGGTTGGGTGG - Intronic
917199453 1:172499678-172499700 CTGCAGGAGGTGAGGAAGTGAGG + Intergenic
917248024 1:173025557-173025579 CTCATGGAGGTGAGGCCTGGTGG - Intergenic
917444047 1:175091831-175091853 CTTTGGGAGGTGAAGCTGGGTGG - Intronic
918454161 1:184689722-184689744 CTCAAGAAGCTGAGGTTGGGAGG - Intergenic
919471890 1:197989160-197989182 CTGGAGGAGGTGAGACAGAGTGG + Intergenic
919777163 1:201201824-201201846 CTGTATAAGGTGAGGCTGGAGGG + Exonic
919819722 1:201465561-201465583 CTGAAGGTGGTGGGGGTGAGGGG - Exonic
919856748 1:201711383-201711405 GTCAGGGAGGGGAGGCTGGGTGG - Intronic
920106444 1:203556622-203556644 ATGCAGGAGGTGGGGCCGGGAGG - Intergenic
920470046 1:206220838-206220860 CTGGAGGAAGTGAGGAGGGGAGG - Intronic
920473591 1:206253518-206253540 GTGAAGGAAGTGAGGGAGGGAGG - Intronic
921104073 1:211958961-211958983 CTGAAGGGGAGGAAGCTGGGAGG + Intronic
921158899 1:212459006-212459028 CTGATGGGGGTGTGGCTGAGGGG + Intergenic
921368805 1:214401107-214401129 CTGAAGTGGGTGTGGTTGGGGGG - Intronic
922423904 1:225476746-225476768 CTCTAGGAGGTGAGGTTGTGAGG + Intergenic
922467261 1:225852919-225852941 GTGAAGCAGGGCAGGCTGGGAGG - Intronic
922770070 1:228176871-228176893 CTGCAGCGGGTGAGGCTGGACGG - Exonic
923084815 1:230695209-230695231 CTGCAGGAGGTGGGGTGGGGTGG - Intergenic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
923540666 1:234886011-234886033 CTGAAGATGCTGAGTCTGGGTGG - Intergenic
923590154 1:235310776-235310798 CTCAGGAAGTTGAGGCTGGGAGG - Intronic
924457426 1:244229892-244229914 TTGAAAGAGATGAGGCTGGGTGG + Intergenic
924474864 1:244374182-244374204 CTGAGGGAGGCCAGGCTGGAGGG - Intronic
1062979765 10:1712454-1712476 CTGCATGAGGAGAGGCTGTGTGG + Intronic
1063143577 10:3276489-3276511 CTGCAGGACGTGAGGCTTGCTGG - Intergenic
1063482125 10:6385223-6385245 CTGAAGGAGGTGTGGGCAGGAGG + Intergenic
1063965807 10:11344826-11344848 CGGAAGCAGGTGAGGCAGAGTGG + Intergenic
1064031336 10:11885260-11885282 ATGGAGGAGGCCAGGCTGGGAGG + Intergenic
1064587058 10:16849778-16849800 TGGAAGGAGAGGAGGCTGGGAGG - Intronic
1064997920 10:21312862-21312884 GGGAAGGAGGTGTGGGTGGGAGG - Intergenic
1065364097 10:24918027-24918049 TAGAAGGGGATGAGGCTGGGTGG + Intronic
1065504325 10:26414301-26414323 ATGAAGAAGGAGAGGGTGGGAGG + Intergenic
1066432805 10:35368864-35368886 CCAGAGGAAGTGAGGCTGGGAGG + Intronic
1067314822 10:45151465-45151487 CTGAGGGAGGTGGAGCTGGCTGG + Intergenic
1067570503 10:47368021-47368043 CCCAGGGAGGTGAGGGTGGGTGG + Exonic
1067964073 10:50889246-50889268 CTGAAGGATGTGTGGATGGGAGG + Intergenic
1068144583 10:53051254-53051276 CTGAAAGAGATGGGGCGGGGGGG - Intergenic
1068731919 10:60367642-60367664 CTGAAGGTGATTAGGCTGGTAGG + Intronic
1068942108 10:62690391-62690413 CTGAGCCAGGTGTGGCTGGGAGG - Intergenic
1069678759 10:70268646-70268668 CTGGAGGATGAGAGGCTGAGTGG - Intronic
1070433079 10:76360769-76360791 CTGTAGCAGGTGAGGGAGGGAGG - Intronic
1070485324 10:76924954-76924976 CTGAAGTGGGTAAGGCTGGTGGG - Intronic
1070793423 10:79203158-79203180 CTCAAGGAGGGAAGGCTGGGTGG - Intronic
1071054656 10:81495083-81495105 CTGAAGGAAGTGAAGATGTGAGG + Intergenic
1071149965 10:82622306-82622328 CTTCAGGAGGTGGGGGTGGGAGG + Intronic
1071249617 10:83803612-83803634 GTGATGGAGGTGAGGCCTGGCGG - Intergenic
1071296588 10:84224890-84224912 CTGAGGGAGCTGAGACTGGAGGG - Exonic
1071471544 10:85987357-85987379 TTGGAGGAGGTAAGGCTGGGAGG - Intronic
1071736225 10:88303705-88303727 CTGATGGAGGTAAGGCTGGCTGG - Intronic
1072005939 10:91247571-91247593 ATGAAGGAGATGAGGCAGGAAGG + Intronic
1072011529 10:91306418-91306440 GTGAAGGAGAAGGGGCTGGGAGG + Intergenic
1072685982 10:97537282-97537304 CAGCTGGAGGTGGGGCTGGGGGG - Intronic
1073212860 10:101818659-101818681 CCGAAGGAGGGGAGTATGGGAGG + Intergenic
1073253456 10:102135989-102136011 CTGATGGAGGTGAAGATGAGTGG + Intronic
1073583989 10:104691273-104691295 ATGATGGGGGTGAGGGTGGGAGG + Intronic
1073667005 10:105544965-105544987 CTGCAGGAGATGATGCAGGGAGG - Intergenic
1074399312 10:113128749-113128771 ATGAAGGAGGGGAGTGTGGGAGG - Intronic
1075023714 10:118968711-118968733 CTGGAGGAGGTGGAGCTGCGAGG - Intergenic
1075081937 10:119390122-119390144 CTGGTGGGGGTGAGGATGGGTGG + Intronic
1075450646 10:122549752-122549774 CTGCAGGAGCTGAGGTTGTGGGG + Intergenic
1075644003 10:124085838-124085860 CTGAAGGCAGTGGGGGTGGGGGG + Intronic
1075715068 10:124551165-124551187 AGGGAGGAGGCGAGGCTGGGGGG - Intronic
1075717617 10:124566148-124566170 CTGGAGAAGGTGATGCTGGGAGG - Intronic
1075981285 10:126742267-126742289 CTGAAAGAAGCCAGGCTGGGAGG - Intergenic
1076300998 10:129426131-129426153 CTGAAGGGGGTGAGGATGGTGGG + Intergenic
1076355710 10:129851345-129851367 CTGACAGATGTGAGGGTGGGGGG - Intronic
1076453502 10:130573477-130573499 CTGAAGGAGGTCAGTCTTTGTGG - Intergenic
1076693591 10:132236401-132236423 ATGAGGAAGCTGAGGCTGGGTGG + Intronic
1076807559 10:132866633-132866655 CTTAGCGAGGAGAGGCTGGGGGG - Intronic
1077010899 11:378880-378902 CTGGAAGAGGAGTGGCTGGGAGG + Intronic
1077036617 11:498535-498557 CTGAAGGAGCTCAGCCTGGCCGG - Exonic
1077273092 11:1690956-1690978 CTGTGGGAGGTGGGGCTGGCAGG + Intergenic
1077299227 11:1839519-1839541 TTGAAGGAGGTGAGAGTAGGGGG + Exonic
1077327720 11:1970934-1970956 CAGAAGGAGCTGAGGGTGGCAGG + Intronic
1077459742 11:2703061-2703083 GAGAAGCATGTGAGGCTGGGCGG + Intronic
1077480355 11:2811703-2811725 CTGGAGGAGGTCAGTGTGGGGGG + Intronic
1077538206 11:3134507-3134529 CAGCAGGAGGAGGGGCTGGGGGG - Intronic
1077939491 11:6825380-6825402 GTGAATGAGGTAATGCTGGGAGG + Intergenic
1078082920 11:8217175-8217197 CTGCTGGAGGTGGGGGTGGGTGG + Intergenic
1078132826 11:8626903-8626925 CTGAAGGGGGTGAGGATAGTGGG - Intronic
1078195146 11:9130943-9130965 CTGAGGGAGCTGGGGCTGGCTGG - Intronic
1079224705 11:18595384-18595406 CTGGGGGAGGTGGGGCTAGGTGG - Intergenic
1079312344 11:19377977-19377999 ATTAAGGAGGTGAGGCTGGGAGG + Intronic
1079833355 11:25299973-25299995 ATGATGGAGGTGGGGCTTGGTGG + Intergenic
1081023696 11:37981860-37981882 CAGCAGGAGGTGAGCGTGGGTGG + Intergenic
1081755039 11:45538398-45538420 ATCAGGGAGTTGAGGCTGGGAGG + Intergenic
1081967885 11:47180441-47180463 CTGAAGGAGGTGAGGCTGGGTGG - Exonic
1082108712 11:48248402-48248424 CTGAAAGAGGTGGGGCAAGGTGG - Intergenic
1082794417 11:57369338-57369360 CTGGAGGAGGAGAGGCAGGGCGG - Intronic
1083186669 11:61021781-61021803 ATGAAGGAGGTGGGGCTGTGTGG + Intergenic
1083187640 11:61026866-61026888 CTGGAGGGGGAGAGGGTGGGTGG + Intergenic
1083539645 11:63503655-63503677 AGGAAGGAAGTGAGGCTGGATGG + Intergenic
1083731994 11:64657270-64657292 CTGAAGGAGGTGACGCCTTGTGG + Intronic
1083749288 11:64752621-64752643 CTGGAGGAGGAGGGGCTGGGAGG - Intronic
1083763865 11:64832980-64833002 GTGGATGAGGTGAGGCTGGGAGG + Intronic
1083821250 11:65172597-65172619 TGTGAGGAGGTGAGGCTGGGAGG + Exonic
1083864289 11:65445399-65445421 AGGTAGGAGGTGAGCCTGGGAGG + Intergenic
1084145749 11:67264454-67264476 CTGGAGGAGGTGAGTCTTAGCGG + Intergenic
1084193604 11:67510508-67510530 CAGAAGGAGTTGGGGCTTGGTGG - Intergenic
1084400539 11:68940429-68940451 CTGAAGATGCTGAGGCTGTGGGG - Exonic
1084485820 11:69447581-69447603 TTGAAGGAGGTGAGGCAGAGGGG - Intergenic
1084793247 11:71488385-71488407 CTGCGGGAGGCGAGGGTGGGTGG + Intronic
1084932888 11:72571073-72571095 CTGGAGGTGGTGAGGGTCGGGGG - Intergenic
1084954099 11:72682313-72682335 CTGGAGGAGGTGAGTCTGAAAGG - Intergenic
1085032723 11:73282436-73282458 TTGCAGGAGGTAAGGCTGTGGGG - Intronic
1085418183 11:76333707-76333729 CTGAAGGAGCCAAGGGTGGGAGG + Intergenic
1086045283 11:82524970-82524992 CTGAAGGAGGTGGAGGGGGGTGG - Intergenic
1087301243 11:96439032-96439054 GTGTTGGAGGTGAGGCTTGGTGG - Intronic
1088410267 11:109526288-109526310 ATGGAGGAGGTGAGGCCTGGTGG + Intergenic
1088591625 11:111408381-111408403 CAGAAGCAGGTGAGGCTGCTCGG + Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089055578 11:115582232-115582254 CTGGAGGTGGGGAGGCTGGGTGG + Intergenic
1089335998 11:117724402-117724424 CTGTGGAAGGTGAGGGTGGGAGG + Intronic
1089430542 11:118420626-118420648 CTGAAGGAGTTCATGCTGGATGG - Intronic
1089593701 11:119561218-119561240 CTGAGGTAGGTGGGGCTGGCTGG - Intergenic
1089694897 11:120210974-120210996 CTGAAGGAAGTGACGGGGGGTGG + Exonic
1089937300 11:122377338-122377360 CTGAAGGAGGCGGGGGGGGGGGG + Intergenic
1090257996 11:125299266-125299288 GTGTCGGAGGTGGGGCTGGGCGG - Intronic
1090635005 11:128685605-128685627 CTGAAGAAAGTGCGCCTGGGCGG + Intergenic
1091078468 11:132643313-132643335 CTGAAGGAGCTCAGGCAGAGCGG + Intronic
1091238865 11:134039297-134039319 CTAACGGGGGTGAGGCTGGTGGG - Intergenic
1202810702 11_KI270721v1_random:26114-26136 CAGAAGGAGCTGAGGGTGGCAGG + Intergenic
1091685328 12:2557454-2557476 GTGCAGGAAGTGAGGCTGGGAGG - Intronic
1091918948 12:4289205-4289227 ATGAAGGGGGTGGGGGTGGGAGG + Intronic
1092131985 12:6119201-6119223 CTGGAGGAGAGTAGGCTGGGAGG - Intronic
1092164678 12:6335745-6335767 GTGGAGTTGGTGAGGCTGGGTGG - Intronic
1092655563 12:10680835-10680857 CTGAAGGAAGTGATGGTGGTGGG - Intergenic
1092712343 12:11352533-11352555 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092716079 12:11392253-11392275 CTGAAGGAGGGGAGGCAGGTAGG + Intronic
1092761987 12:11818843-11818865 CAGGAGGAGGTGAGGCTGCCTGG - Intronic
1092791788 12:12076658-12076680 CTGATGGAAGTGAGCCTGGGAGG - Intronic
1093047171 12:14460711-14460733 CTGTAGAAGCTGAGGCTGGGAGG - Exonic
1093957014 12:25232003-25232025 CTGTAGGACTAGAGGCTGGGGGG - Intronic
1094231417 12:28108445-28108467 CTGAAAGAGAGGAGGATGGGAGG + Intergenic
1094316269 12:29139734-29139756 GTGAAGGAGAAGGGGCTGGGGGG + Intergenic
1095556768 12:43516038-43516060 CTGAAGGCGGTGGGGCGGTGGGG - Intronic
1095948433 12:47767072-47767094 CTGCAGGAGGGGGGCCTGGGTGG + Intronic
1096425955 12:51503136-51503158 CTGAAAGACGTCAGGCTGGCTGG - Intronic
1096570127 12:52518089-52518111 CTGAAGAAGGTGCGTGTGGGTGG - Exonic
1096695478 12:53345619-53345641 CTGAAAGTGGTGTGGCTTGGTGG - Intergenic
1096872076 12:54599239-54599261 CGGAATGAGATGAGGTTGGGGGG + Intergenic
1096973950 12:55687957-55687979 CTGTGGAAGGTGAGGCTTGGAGG - Exonic
1096996549 12:55841803-55841825 CTGAAGGAGGACAGGCTGTCAGG - Intronic
1097250347 12:57629034-57629056 CCCAGGGAGGTGAGGCTGGTAGG - Exonic
1097258497 12:57698783-57698805 GTGTAGGAGATGAGTCTGGGTGG + Intronic
1097262574 12:57727805-57727827 GAGAAGGAGGTGGGGCTTGGAGG - Intronic
1098041127 12:66355059-66355081 CTGAAAGTGGTGAGGCCGAGAGG - Intronic
1098903088 12:76132867-76132889 ATGTTGGAGGTGAGGCTGGTGGG - Intergenic
1099163537 12:79274589-79274611 ATAAAGGAGGTGAAGCTGTGTGG - Intronic
1099330293 12:81276263-81276285 CAGAAGGGTGGGAGGCTGGGAGG + Intronic
1099365144 12:81758953-81758975 CTCCAGGAGGGGAGACTGGGTGG - Intronic
1099974404 12:89531481-89531503 GTGAAGGATGTGTGGGTGGGAGG - Intergenic
1100662188 12:96711492-96711514 CACAAGGTGGTGAGGCTGGGTGG + Intronic
1101215198 12:102574710-102574732 ATGATGGAGCTGAGGCTGGTAGG + Intergenic
1101315085 12:103621631-103621653 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1101560066 12:105848551-105848573 TTGAAGGAGGTGAGCCTGCTGGG + Intergenic
1102002420 12:109565785-109565807 CTGGAGGAGGTGATGCTGGAGGG + Intronic
1102192459 12:110999016-110999038 CTGATTTAGGAGAGGCTGGGAGG + Intergenic
1102193649 12:111008482-111008504 CTTAGGGATGTTAGGCTGGGAGG + Intergenic
1102557276 12:113735484-113735506 CTGAAGGAGGTCAGGGTGGGGGG - Intergenic
1102625841 12:114234898-114234920 CTGAAGGAGGTAAGGGATGGAGG + Intergenic
1103576696 12:121882829-121882851 CTGAGGCAGGAGAAGCTGGGAGG - Intergenic
1103859664 12:124002300-124002322 GTGCAGGAGGTGAGGTTGGAAGG + Intronic
1103966948 12:124646095-124646117 GTGCAGGATGTGGGGCTGGGGGG + Intergenic
1104842390 12:131831337-131831359 CTGTAGGAGGTGGGGTGGGGCGG + Intronic
1104953122 12:132451309-132451331 CAGCAGGAGGGGAGACTGGGAGG - Intergenic
1105899061 13:24741194-24741216 CTGAGGGCTGTGTGGCTGGGGGG - Intergenic
1107519917 13:41169511-41169533 AAGAAGGAGGTCAGGCTTGGTGG - Intergenic
1107851209 13:44575481-44575503 CTGAGGAAGGTGGGGCTGGTTGG + Exonic
1109883878 13:68517224-68517246 CTGAAGGATCTGAGGATGGCAGG - Intergenic
1111255469 13:85661922-85661944 CTGAAGGAGCTGAAGTTGGAAGG - Intergenic
1111732070 13:92088543-92088565 CTGATTGAGGTGAGGCAAGGAGG - Intronic
1111762159 13:92480041-92480063 CTTTAGGAGGTGGAGCTGGGAGG + Intronic
1112029912 13:95447618-95447640 GTGAAGGAGCTGAAGCAGGGAGG - Intronic
1112260399 13:97873015-97873037 ATGTTGGAGGTGAGGCTTGGTGG - Intergenic
1112460625 13:99600670-99600692 TGCCAGGAGGTGAGGCTGGGAGG + Intergenic
1112726914 13:102315324-102315346 CTGAAGGGGTGCAGGCTGGGAGG - Intronic
1112984754 13:105434653-105434675 CTGAAGCAGGGGGGGCGGGGCGG - Intergenic
1112992075 13:105525998-105526020 CAGAGGGAGGTGATCCTGGGTGG - Intergenic
1113073372 13:106444432-106444454 CTGAAGTGGGTGAGGCTGAGGGG - Intergenic
1113104434 13:106757803-106757825 GGGAGGGAGGTGAGGGTGGGTGG + Intergenic
1113252477 13:108469459-108469481 CTGTTGGAAGTGGGGCTGGGTGG - Intergenic
1113279389 13:108772258-108772280 CTGAGGCAGGAGAGCCTGGGAGG + Intronic
1113949496 13:114064205-114064227 CTGCAGGAGCAGAGGCTGCGAGG + Intronic
1113976400 13:114231071-114231093 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976434 13:114231185-114231207 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976468 13:114231299-114231321 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976486 13:114231356-114231378 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1113976520 13:114231470-114231492 CTGCTGGAGGTGGGGCTGGTGGG + Intergenic
1114490087 14:23095081-23095103 CTGGAGGAGGTGACTCTGGACGG - Exonic
1114495846 14:23131600-23131622 ATGAAGGAGCTGGGGCTTGGTGG - Intronic
1114502565 14:23181956-23181978 CTGAAGGTGGGGAACCTGGGTGG - Intronic
1114659466 14:24335221-24335243 CTGAAGGGGCTGAAGCGGGGAGG - Intronic
1115469945 14:33758161-33758183 CTGGAGGAGGTGAAGCAGGCTGG - Intronic
1116019980 14:39448532-39448554 CTGGAGGAAGTGAGGCTGTTTGG + Intergenic
1116636920 14:47408434-47408456 GTAAAGGAGGTGAGGCAGAGGGG + Intronic
1117351243 14:54883881-54883903 CTAAAGAAGGTGAGGCAGGAAGG + Intronic
1117483632 14:56172545-56172567 CTTAAGGAGGGGAGGTTGGTTGG + Intronic
1118780601 14:69005312-69005334 CTAGGGAAGGTGAGGCTGGGAGG - Intergenic
1119119815 14:72064225-72064247 CTGAAGGAGGTGAAGGAGGAGGG + Intronic
1119768498 14:77205717-77205739 CTGGGGGAGGTGAGACTGGAGGG + Intronic
1121421811 14:93821205-93821227 CTGCAGGAGGTGGAGCGGGGAGG - Intergenic
1121432938 14:93900212-93900234 TGGACGGAGGTGAGGCTGGAGGG + Intergenic
1121465792 14:94114872-94114894 TTGGAGGAGGTGAGTCTGTGGGG + Exonic
1121578264 14:95006664-95006686 CAGCAGGAGAGGAGGCTGGGGGG + Intergenic
1121614176 14:95301723-95301745 CTCAAGTAGGTGGGGCTTGGTGG - Intronic
1122025535 14:98873138-98873160 TTGAAGGATTTGAAGCTGGGAGG - Intergenic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122159654 14:99773942-99773964 TTGGAGGAGGGGCGGCTGGGCGG + Intronic
1122553183 14:102561090-102561112 CTGAGTGAGGTGAGGCAGGATGG + Intergenic
1122931014 14:104933144-104933166 CTGGAGGAGGTGGGGCTCAGGGG - Exonic
1122931224 14:104933766-104933788 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1122931307 14:104933971-104933993 CTGAGTGAGGGGAGGGTGGGAGG + Exonic
1123670548 15:22652295-22652317 CTGATTGAGGTGAGGCAAGGAGG - Intergenic
1124526530 15:30458732-30458754 CTGATTGAGGTGAGGCAAGGAGG - Intergenic
1124772124 15:32548951-32548973 CTGATTGAGGTGAGGCAAGGAGG + Intergenic
1125457285 15:39872836-39872858 ATGCTGGAGGTGAGGCTTGGTGG - Intronic
1125520689 15:40346350-40346372 CTGCATGAGGTGGGGCTGGAGGG + Intergenic
1125672055 15:41480871-41480893 CTGGGGGAGGGGAGGCTGGTGGG - Exonic
1125811765 15:42548337-42548359 CTGACCGAGGTGAGACTGGGAGG - Exonic
1125833173 15:42730345-42730367 ATGCAGGAGGCGGGGCTGGGGGG - Intronic
1125911796 15:43446591-43446613 CTGAAAGAAGTGAGGCAGGGAGG + Intronic
1126675305 15:51155541-51155563 GTGAAAGAGCTGAGGCCGGGAGG + Intergenic
1127710808 15:61596076-61596098 GGGAAGGAAGTGAGGCTGAGAGG + Intergenic
1127850099 15:62904738-62904760 GTGCAGGAGGGGAGACTGGGAGG + Intergenic
1128537198 15:68500399-68500421 GTGAAGGAGGAGAGCCTGGGAGG - Intergenic
1128666197 15:69539958-69539980 CTGAAGGAAGTGAGGCTGAGCGG - Intergenic
1129114458 15:73357537-73357559 CCCTAGGAGGGGAGGCTGGGAGG + Intronic
1129360167 15:75019536-75019558 CTGAAGGAGGCGAGGCCTGGAGG - Exonic
1129496000 15:75981372-75981394 TTCAAGCAGGTGATGCTGGGTGG - Intronic
1129605647 15:77023759-77023781 ATGAAGGAGGCGGGGCTGGAGGG + Intronic
1130219961 15:82011171-82011193 CTTCAGGAGGTGAGGCAGGGAGG - Intergenic
1130330493 15:82918485-82918507 CCTCAGCAGGTGAGGCTGGGTGG + Intronic
1130553831 15:84909209-84909231 CTGAAGGAGGAGCGCCTGAGAGG - Intronic
1130656641 15:85795871-85795893 CTGACGGAGGTGGAGGTGGGAGG + Intergenic
1131076618 15:89499326-89499348 CTGGAGGAGGTCTGGATGGGAGG - Intergenic
1131244984 15:90783444-90783466 CTGGGGGAGGTGAGTCTGAGCGG - Intronic
1131313086 15:91308276-91308298 AGGAAGGAGGTGAGGATGGAGGG + Intergenic
1131828295 15:96337152-96337174 CTTAAGGGGGGGAGGCGGGGTGG - Intronic
1132520196 16:383757-383779 TTGGAGGAGGAGAGGCGGGGTGG + Intronic
1132572774 16:651258-651280 CTGAGGCAGGTGGGTCTGGGGGG + Exonic
1132981464 16:2740438-2740460 GTGAGGAAGGTGAGGCTGGAGGG - Intergenic
1133595129 16:7283603-7283625 CTGAGGACGGTGAGGCTGAGTGG - Intronic
1133612051 16:7442473-7442495 CTCAAGGAGGTTGGGCAGGGAGG + Intronic
1133661014 16:7917467-7917489 CTGAAGTAGATGAGCCTGGTGGG + Intergenic
1134452022 16:14369437-14369459 AGGAAGGAGCTGAGGATGGGTGG + Intergenic
1135134007 16:19874463-19874485 ATGGAGGAAGTGAGGATGGGAGG - Intronic
1135930539 16:26732589-26732611 GTGTTGGAGGTGAGGCTGGGTGG + Intergenic
1136282335 16:29221104-29221126 CTGCAGGTGGGGCGGCTGGGAGG + Intergenic
1136654646 16:31702684-31702706 GAGAATGAGGAGAGGCTGGGGGG + Intergenic
1136777440 16:32879401-32879423 CTGGGGGAGGTGGGGCGGGGTGG - Intergenic
1136893184 16:33982113-33982135 CTGGGGGAGGTGGGGCGGGGTGG + Intergenic
1137043630 16:35637277-35637299 CTGAAGGAGGAGAGGCTTGTGGG + Intergenic
1137366314 16:47862670-47862692 CTGCAGGAGGTGATGGTGGCTGG + Intergenic
1137717069 16:50604551-50604573 CTGGAGGGGGTGGGGCTGTGAGG - Intronic
1137721590 16:50630609-50630631 TGGAAGGAGGTGAGGCTGGAGGG + Intronic
1138030929 16:53558891-53558913 CTGAAGTAGGTGAGGCCAGCTGG + Intergenic
1139249574 16:65481953-65481975 CTCAAGGGAGTCAGGCTGGGAGG - Intergenic
1139439653 16:66959690-66959712 ATCAAGGGGGTGTGGCTGGGGGG + Intergenic
1139519767 16:67474422-67474444 CAGAAGAAGGTGAGGCTAGAAGG - Intronic
1139690413 16:68638169-68638191 CTGAAGGAGGTGAGGGAGAGGGG + Intronic
1140190514 16:72811891-72811913 CCGGAGCAGGTGAGGCTGGAAGG - Exonic
1141134130 16:81454882-81454904 CTGATGGAGATGAGGGTGGCAGG + Intronic
1141181170 16:81754235-81754257 GGGAAGGAGGTGGGGATGGGTGG - Intronic
1141490509 16:84369180-84369202 CTGTAGGAAGTGAGGCTGGGAGG - Intronic
1141552229 16:84813712-84813734 CGGTAGGAGGTGAGGGTGCGAGG + Intergenic
1141586621 16:85038110-85038132 TGGAAGGAGCTGAGGGTGGGAGG - Intronic
1141614316 16:85202082-85202104 CGGAAGGTGGTGGGGCTGGCCGG + Intergenic
1141615425 16:85207136-85207158 CTGAAGGTGGAGATGCTAGGTGG - Intergenic
1141665484 16:85463241-85463263 CTGAAGGTGATGGGGCTGGAGGG - Intergenic
1141746189 16:85927987-85928009 CCGAAGGAGGTGCGGATGAGGGG + Intergenic
1141826687 16:86485618-86485640 AGGAGCGAGGTGAGGCTGGGTGG - Intergenic
1141898005 16:86970987-86971009 GTGAAGGTGGTGAGTCTGTGTGG - Intergenic
1141921899 16:87141042-87141064 CAGCAGGAAGTGAGGCTGAGGGG - Intronic
1142076571 16:88121221-88121243 GTGAAGGGGGGGAGGTTGGGGGG + Intergenic
1142086707 16:88187022-88187044 CTGCAGGTGGGGCGGCTGGGAGG + Intergenic
1142194592 16:88733574-88733596 CTGAAGGAGGTGAGTGTGGCAGG - Exonic
1203079853 16_KI270728v1_random:1141510-1141532 CTGGGGGAGGTGGGGCGGGGTGG - Intergenic
1142472153 17:170500-170522 CTGCAGGTTGGGAGGCTGGGTGG + Intronic
1143019195 17:3907858-3907880 CAGAAGGAGCTGATGCAGGGGGG + Intronic
1143524549 17:7464459-7464481 CTGAAGGAACTGGGGCTGGAGGG + Intronic
1144083034 17:11781896-11781918 CTGAAGGCACTGAGGCTGGAAGG - Intronic
1144784765 17:17825390-17825412 CTGATGGGGGTGGGGCGGGGGGG + Intronic
1144793945 17:17878485-17878507 CTTATGGGGGTGAGGGTGGGTGG - Intronic
1146448879 17:32955714-32955736 CTCAGGGAGCTGAGGCAGGGAGG + Intergenic
1146952411 17:36916144-36916166 ATGAAGGAGGGCATGCTGGGAGG - Intergenic
1146953374 17:36921649-36921671 CTGTGGAAGGTGAGGCTTGGCGG - Intergenic
1146955725 17:36935539-36935561 CTGAAGGTGGTTGGGCTGGGCGG - Intergenic
1147706520 17:42429126-42429148 CTGAGGGAGGAGAATCTGGGAGG - Intergenic
1147864249 17:43542586-43542608 GTGAATGATGTGAGGCTAGGAGG - Intronic
1148108675 17:45132549-45132571 CAGCAGGAGGTGGGGCGGGGCGG + Intronic
1148338145 17:46855219-46855241 CCGAAGGGGGTGAGGGTGGAGGG + Intronic
1148510776 17:48167681-48167703 CTGAAGGAGGTACGGGTGGGAGG + Intronic
1148839107 17:50483423-50483445 ATGAAGGAGGTGATGCTGTTTGG + Exonic
1148938044 17:51180658-51180680 CTGAAGGAGGAGTTGCTGGATGG - Exonic
1149292334 17:55229541-55229563 CAGAAGGGGAAGAGGCTGGGAGG - Intergenic
1149374668 17:56031985-56032007 GTGCAGGAGGTGAGGATGGTGGG + Intergenic
1149498079 17:57132109-57132131 TTGGAGGGGGTGAGGGTGGGTGG + Intergenic
1149498169 17:57132349-57132371 TTGGAGGGGGTGAGGGTGGGCGG + Intergenic
1149498205 17:57132445-57132467 CTGGAGGGGGTGAGGGTGGGCGG + Intergenic
1149498262 17:57132589-57132611 CTGGAGGGGGTGAGGGTGGGTGG + Intergenic
1149498284 17:57132637-57132659 CTGGAGGGGGTGAGGGAGGGTGG + Intergenic
1149498295 17:57132661-57132683 CTGGAGGGGGTGAGGGAGGGTGG + Intergenic
1149663869 17:58352311-58352333 CAGCAGGCGGGGAGGCTGGGCGG + Intronic
1149870287 17:60174917-60174939 CTGAAGGTGGTGAGTCTGCATGG - Intergenic
1150339817 17:64357383-64357405 CTGCAGGGAGTGAGGCTGGCTGG - Intronic
1150642599 17:66959738-66959760 CTGATGGAGGGGAGGCTGGTAGG + Intergenic
1151288809 17:73133580-73133602 CTGATGGAGAAGAGGCTGGAGGG - Intergenic
1151334642 17:73432656-73432678 GTGAAGGAGGTAGGGCTGGAGGG + Intronic
1151554897 17:74841840-74841862 GGGAAGGAGGTGAGGCTGAGAGG - Intergenic
1151599251 17:75096278-75096300 CTGAGGGTGGTGTGGCCGGGCGG - Intronic
1152081485 17:78190247-78190269 CACACAGAGGTGAGGCTGGGAGG - Intronic
1152125683 17:78445200-78445222 TGGGAGGAGGGGAGGCTGGGGGG + Intronic
1152125693 17:78445219-78445241 GGGGAGGAGGGGAGGCTGGGGGG + Intronic
1152222221 17:79075082-79075104 GGGAAGGAGGTGGGGCTGCGGGG + Exonic
1152256751 17:79244479-79244501 CTGAAGGTGGGGAGGGTGGGTGG - Intronic
1152314617 17:79572870-79572892 CTGCATGGGGTGAGGGTGGGTGG - Intergenic
1152323486 17:79622392-79622414 CCAGAGGAGGTGGGGCTGGGAGG + Intergenic
1152451999 17:80387448-80387470 CTGAAGGAAGAGGGGCTGTGGGG - Intronic
1152576477 17:81143499-81143521 CTGGGGGAAGTGAGGCTGCGTGG - Intronic
1152932443 17:83116723-83116745 CAGAGGGATGTGTGGCTGGGCGG - Intergenic
1153094322 18:1383444-1383466 CTGATGGAGTTGGGGCTGGCTGG - Intergenic
1153310857 18:3675665-3675687 CAGATGGAGGTGGGGATGGGTGG - Intronic
1153598009 18:6748561-6748583 CTGATGGAGGAGAGGCTGGGAGG + Intronic
1153894011 18:9542951-9542973 CTGGTGTAGGTGAGGGTGGGAGG - Intergenic
1153995230 18:10434542-10434564 CTAGAGGAGGAGATGCTGGGTGG - Intergenic
1155563083 18:27101483-27101505 CTGGCGGGGGTGAGGGTGGGCGG + Intronic
1155913999 18:31537902-31537924 CTGAGGCAGGTGAACCTGGGAGG + Intronic
1156499275 18:37546833-37546855 CTGCAAGGGGTGAGGCTTGGTGG - Intronic
1156539428 18:37894838-37894860 CTGGAGGAGGAGGGGCTGAGTGG + Intergenic
1156606400 18:38672026-38672048 CTGAAGGAGAGAAGGCAGGGTGG - Intergenic
1157675083 18:49562642-49562664 GGGAAGGAGGTGGGGGTGGGAGG - Intronic
1157710780 18:49848315-49848337 CTGATGGTGGTGGGGCTGGAAGG + Intronic
1157898087 18:51487337-51487359 CTGGAGAAGCTGAGGCTGAGTGG - Intergenic
1158015358 18:52776617-52776639 TTGCAGGAGGTGGGGATGGGCGG + Intronic
1158504962 18:58039304-58039326 CTCAAGGAGCTGAGGCAGGAGGG - Intergenic
1159580420 18:70229498-70229520 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
1160021562 18:75185469-75185491 CTGAAGGGGGTGAGGTGGGAAGG - Intergenic
1160703259 19:518119-518141 AGGAAGGAGGCCAGGCTGGGTGG + Intronic
1161001238 19:1912304-1912326 CCGCTTGAGGTGAGGCTGGGCGG - Exonic
1161127869 19:2570008-2570030 ATGTTGGAGGTGAGGCTGGGTGG + Intronic
1161451730 19:4350124-4350146 CTGAAGGTGGGGAGGGAGGGAGG + Intronic
1161672603 19:5622516-5622538 CTCAAGAAGGTGAGGCGGCGCGG - Exonic
1161814973 19:6494448-6494470 CTGAGGGGAGTGAGGCAGGGAGG + Exonic
1161865764 19:6831119-6831141 CTGTGGTAGGTGAGGGTGGGAGG + Intronic
1162030236 19:7914199-7914221 CTGAAGGGGGTGGGGGTGGGCGG - Exonic
1162064293 19:8115694-8115716 AGGAAGTAGGTGAGGGTGGGAGG + Intronic
1162337872 19:10072840-10072862 CTGAAGGGAGGGAGGGTGGGGGG + Intergenic
1162525612 19:11204428-11204450 CTGGAGGAGGTGATGGAGGGTGG - Intronic
1162529900 19:11229724-11229746 GAGAAGAACGTGAGGCTGGGCGG + Intronic
1162752816 19:12838945-12838967 AGGAAGAAGGGGAGGCTGGGGGG + Intronic
1162992847 19:14314596-14314618 GTGCAGAAGGGGAGGCTGGGTGG + Intergenic
1163121505 19:15221006-15221028 CTGAATGAGGTTAAGCAGGGAGG - Intergenic
1163147657 19:15392075-15392097 CTTTAGGAGGTGAAGGTGGGAGG - Intronic
1163282227 19:16324990-16325012 CTGCAGGAGGTGAGGGCGGCGGG + Exonic
1163502722 19:17686352-17686374 TTGGAGGATGTGAGGCGGGGTGG + Intronic
1164551031 19:29212785-29212807 CTGAATCAGGTCGGGCTGGGCGG - Intronic
1164614918 19:29661559-29661581 CTTTAGGAGGTAAAGCTGGGAGG + Intergenic
1164676358 19:30104247-30104269 CTGAGGAAGGGGAGGCAGGGGGG - Intergenic
1164890010 19:31815151-31815173 CTGAGGGAAGTGAGTCAGGGAGG + Intergenic
1165191355 19:34066434-34066456 ATGTTGGAGGTGGGGCTGGGTGG + Intergenic
1165404532 19:35621701-35621723 CTGAAGCTGGTGAGGGTGGGGGG - Intronic
1165461825 19:35948449-35948471 CTGGAGGAGGGGAGGCCTGGCGG + Intergenic
1165470844 19:36003622-36003644 CTCCAGGATGTGAGGCTGGAGGG - Exonic
1165682567 19:37790313-37790335 CAGTAGGAGGCGAGTCTGGGTGG - Intronic
1165992795 19:39825896-39825918 CTGATGGATGTGAGCCTGGTGGG - Exonic
1166104128 19:40589302-40589324 TTGAAGGAGCAAAGGCTGGGAGG + Intronic
1166299401 19:41905665-41905687 CTGGAGGTGGGGAGGCAGGGAGG - Intronic
1166301228 19:41913139-41913161 CTGCGGGAGGAGAGGCTGGGAGG - Intronic
1166502640 19:43353301-43353323 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1166502693 19:43353449-43353471 CTGAAGGAGGAGGGGCTGAGGGG + Intergenic
1166662184 19:44654251-44654273 CTGAGGGAGGAGGGGCTGGGGGG + Intronic
1166676839 19:44746176-44746198 CTGAAGGAGGTGGGGGTCTGAGG - Intergenic
1166679693 19:44759043-44759065 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1166771730 19:45287509-45287531 CTGAAGGAGGAGCGGCTGCCAGG + Exonic
1167245942 19:48373269-48373291 CTGGAGGTGGGGAGGCTGGGAGG + Intronic
1167249648 19:48393223-48393245 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167327945 19:48836734-48836756 CTGAGGGAGGAGGGGCTGGGAGG - Intergenic
1167327959 19:48836771-48836793 CTGAGGGAGGAGGGGCTGGGAGG - Intergenic
1167327986 19:48836844-48836866 CTGAGGGAGGAGGGACTGGGAGG - Intergenic
1167428231 19:49440614-49440636 CTTGAGGGGGTGAGGCTGGGTGG - Intronic
1167584484 19:50365889-50365911 CTGAAGGATGGGGGGGTGGGAGG - Intronic
1167597434 19:50435061-50435083 CTGAGGGAGGAGGGGCTGGGGGG + Intronic
1167668971 19:50838919-50838941 CTGAGAGAGGAGGGGCTGGGGGG + Intergenic
1167669024 19:50839066-50839088 CTGAGAGAGGTGGGGCTGGGGGG + Intergenic
1167669189 19:50839615-50839637 CTGAAGGAGGAGGGGCTGGGGGG + Intergenic
1167678765 19:50906598-50906620 CTGAGGGAGGAGGGGCTGGGGGG + Exonic
1167678790 19:50906665-50906687 CTGAGGGAGGAGGGGCTGGGGGG + Exonic
1167678815 19:50906732-50906754 CTGAGGGAGGAGGGGCTGGGGGG + Exonic
1167688096 19:50968971-50968993 CTGAGGGAGGAGGGGCTTGGGGG + Exonic
1167689100 19:50974841-50974863 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167689134 19:50974925-50974947 CTGAGGAAGGAGGGGCTGGGGGG + Intergenic
1167689151 19:50974965-50974987 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689181 19:50975052-50975074 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689208 19:50975132-50975154 CTGAGGGAGGAGGGGCTGGCGGG + Intergenic
1167689243 19:50975218-50975240 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689259 19:50975259-50975281 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689272 19:50975300-50975322 CTGAGGGAGGAGGGGCTGGCAGG + Intergenic
1167689288 19:50975342-50975364 CTGAGGGAGGAGGGGCTGGAGGG + Intergenic
1167689301 19:50975382-50975404 CTGAGGGAGGAGGGGCTGGTGGG + Intergenic
1167689320 19:50975426-50975448 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689364 19:50975550-50975572 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689392 19:50975627-50975649 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167689407 19:50975667-50975689 CTGAGGGAGGAGGGGCTGGGGGG + Intergenic
1167705612 19:51079374-51079396 CTCCAGGAGGTGGAGCTGGGGGG - Intronic
1167799476 19:51730648-51730670 CTGAGGGAGGAGGGGGTGGGGGG + Intergenic
1167890581 19:52536375-52536397 CCGAAGACGGAGAGGCTGGGAGG - Intronic
1167915187 19:52734651-52734673 CTGAGGAGGGGGAGGCTGGGAGG + Intronic
1168155522 19:54471871-54471893 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155564 19:54471982-54472004 CTGAGGGAGGAAGGGCTGGGGGG - Intronic
1168155637 19:54472168-54472190 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155692 19:54472317-54472339 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155745 19:54472465-54472487 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155771 19:54472544-54472566 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155883 19:54472840-54472862 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168155911 19:54472914-54472936 CTGAGGGAGGAGGGGCTGGGGGG - Intronic
1168238703 19:55078756-55078778 CAGAGGGAGGAGGGGCTGGGGGG + Intronic
1168252260 19:55147578-55147600 CTGAGGGAGGAGGGGCTGGGGGG + Intronic
1168292055 19:55361783-55361805 CTGAGGGAGGAGGGGCTGTGGGG - Intronic
1168295257 19:55374917-55374939 CTGAGGGAGGAGGGGCTGGGGGG - Intergenic
1168295289 19:55374993-55375015 CTGAGGGAGGAGGAGCTGGGGGG - Intergenic
1168295322 19:55375075-55375097 CTGAGGGAGGAGGAGCTGGGGGG - Intergenic
1168295352 19:55375151-55375173 CTGAGGGAGGAGGGGCTGGGGGG - Intergenic
1168325507 19:55536789-55536811 CTGGCGGAGGAGGGGCTGGGGGG - Intronic
1168507999 19:56952493-56952515 CAGCAGGACGTGAGGGTGGGTGG - Intergenic
1168512507 19:56984318-56984340 CAGATGCTGGTGAGGCTGGGGGG - Intergenic
1168580787 19:57554067-57554089 CTCAAGGGGATGAGGTTGGGAGG + Intronic
925166125 2:1716740-1716762 CTGATGGAGAAGGGGCTGGGAGG - Intronic
925266060 2:2567129-2567151 CTGGAGGAGCTGAGGCTTCGAGG - Intergenic
925422676 2:3725278-3725300 CTGGAGGTGGAGAGGCTGTGGGG + Intronic
925476969 2:4227944-4227966 CAGAAGTAGGTGGGGCTGGGTGG + Intergenic
925775970 2:7336199-7336221 CTGAAGGAGGAGAGGGGGAGTGG + Intergenic
925810019 2:7690796-7690818 CTGAATGAGGTAAGCCTTGGTGG - Intergenic
925876061 2:8312213-8312235 GAGCAGGAGGTGGGGCTGGGAGG - Intergenic
926392440 2:12407021-12407043 ATGTTGGAGGTGAGGCTTGGTGG - Intergenic
926660672 2:15462612-15462634 GTGGAGGAGGTGAGGGAGGGAGG + Intronic
926940745 2:18133988-18134010 CTGAAGGAGATGAGGCCCAGGGG - Intronic
927110251 2:19859354-19859376 CTGGAGGAGCTGAGGCTTGCTGG - Intergenic
928490540 2:31778449-31778471 CTGGTGGAGGTGGGGCTGGCGGG - Intergenic
928778104 2:34790770-34790792 GTGAAGGAGAAGAGGTTGGGGGG - Intergenic
928925473 2:36574817-36574839 CTGGAGGAGCAGAGGATGGGGGG - Intronic
929298608 2:40275818-40275840 CTGCTGGAGGTCAGGCTGGATGG + Intronic
929531084 2:42753272-42753294 CTGAAGGTTGTGATGTTGGGAGG + Intronic
929925199 2:46201816-46201838 CTGAAGAAGGTGGGGGTGGAGGG + Intergenic
930491848 2:52083688-52083710 CTGAAGAAGGTGGGGGTGGGAGG - Intergenic
931862705 2:66373109-66373131 ATGTTGGAGGTGAGGCTTGGTGG + Intergenic
932331142 2:70899124-70899146 CGGCAGAAGGTGAGGTTGGGGGG - Intergenic
932501941 2:72190137-72190159 CTCAGGGAGGTGAAGGTGGGAGG - Intronic
932595796 2:73092837-73092859 CAGAGGGAGGTGGGGCTGGAAGG - Intronic
932635728 2:73386184-73386206 CTGGAGAAGGTGAGGCGGGCCGG + Exonic
933773917 2:85760349-85760371 CTGTAGGCGGTGCGGGTGGGTGG + Intronic
933861027 2:86467916-86467938 CTGGAGAAGCTGAGGCAGGGGGG + Intronic
934099720 2:88641264-88641286 CTGACAGAGGTGGGGCTGGCTGG - Intergenic
934907961 2:98222151-98222173 CTGAAGGAGGTAGTGCTAGGTGG + Intronic
935186530 2:100739299-100739321 TTAAAAGAGATGAGGCTGGGTGG + Intergenic
935663470 2:105489212-105489234 CAGAAGGAAGGGAGGCAGGGAGG + Intergenic
936073707 2:109388042-109388064 CTAAAGGAGTTCAGGCTGTGAGG - Intronic
936274196 2:111079250-111079272 CAGAAGGTCGAGAGGCTGGGGGG - Intronic
936332437 2:111560036-111560058 GGGAAGGAGGTGAGGGTGAGGGG - Intergenic
936586647 2:113764028-113764050 GTGTTGGAGGAGAGGCTGGGTGG - Intergenic
937110430 2:119363032-119363054 CTGAGGGAGGTGAGAGTTGGTGG - Intronic
937208033 2:120249274-120249296 CTTTAGGAGGTGAAGGTGGGTGG - Intronic
937309488 2:120893327-120893349 GTGGGGGAGGGGAGGCTGGGGGG - Intronic
938090309 2:128426833-128426855 CAGCAGGAGGAGAGGATGGGGGG + Intergenic
938132727 2:128731495-128731517 GTGAAGAAGGTGAGGCTGACAGG + Intergenic
938146734 2:128840661-128840683 TTGAGGGAGGTGAGGCTCAGGGG - Intergenic
938172172 2:129088842-129088864 CTGGAAAATGTGAGGCTGGGAGG - Intergenic
938199592 2:129362082-129362104 CTGGAGGAGCAGAGGCTGTGGGG - Intergenic
939490319 2:142868729-142868751 CTGAAGGGGGTGAGGATGACAGG - Intergenic
939566386 2:143790775-143790797 CTGAGCTAGGTGAAGCTGGGGGG + Intergenic
940078944 2:149778203-149778225 CTGAAGCAGGTGGGGTTGGGTGG + Intergenic
940854250 2:158717471-158717493 CTGGGTGAGGTGAGGCTGCGGGG - Intergenic
941185723 2:162319072-162319094 CTGAGGGTGGTGAGACTGCGAGG + Intronic
942168412 2:173265227-173265249 CTGAGGAAGCTGAGGCTGGGAGG + Intronic
942480390 2:176381550-176381572 CTGAAGCAGGTGTGGCAGGGAGG + Intergenic
943345272 2:186731513-186731535 CTGAAGGATTAGGGGCTGGGTGG + Intronic
944425047 2:199572272-199572294 CTGAAGGAGGAGCGGGGGGGCGG + Intergenic
944536284 2:200713638-200713660 AGAAAGGAGGTGAGGTTGGGAGG + Intergenic
944555067 2:200879985-200880007 TTACAGGAGTTGAGGCTGGGAGG - Intronic
944573866 2:201072148-201072170 GAGAAGGATGGGAGGCTGGGAGG + Intronic
944644751 2:201767573-201767595 CTGAAGGATGTGGGGCGTGGTGG + Intronic
945574280 2:211510307-211510329 CTAAAAGAGGAGAGGGTGGGAGG + Intronic
945690617 2:213030487-213030509 CTAAAGTAGTTGAGGGTGGGGGG + Intronic
945894408 2:215466029-215466051 CTAAAGGTAGTGGGGCTGGGAGG + Intergenic
945984083 2:216340397-216340419 CTGCAGGAGGAGAGCCAGGGAGG - Intronic
946074925 2:217065836-217065858 CTGGAGAAGAGGAGGCTGGGAGG - Intergenic
946395356 2:219441586-219441608 CGGGAGGAGGTGAGGGTGGGAGG + Intronic
946413937 2:219529991-219530013 CAGAAGGGAGAGAGGCTGGGTGG - Intronic
946722108 2:222620169-222620191 TGGTAGCAGGTGAGGCTGGGAGG - Intronic
948070145 2:235114240-235114262 CCAAAGCAGGTGGGGCTGGGTGG - Intergenic
948523737 2:238558060-238558082 CCCAAGGAGGTCAGGCTGGAAGG + Intergenic
948720065 2:239893900-239893922 ATGATGGAGTTGAGGATGGGAGG - Intronic
948720096 2:239894029-239894051 ATGATGGAGTTGAGGATGGGAGG - Intronic
948720144 2:239894240-239894262 ATGATGGAGCTGAGGATGGGAGG - Intronic
948759767 2:240183352-240183374 CTGCAGGATGGGAGCCTGGGAGG + Intergenic
1168913327 20:1467063-1467085 CCGAAGGATGAGAGGCGGGGCGG + Intronic
1169210630 20:3764488-3764510 CTGTCGAAGGTGTGGCTGGGAGG - Intronic
1169211219 20:3767266-3767288 CTGAGGGTGCTGAGGCTCGGAGG + Intronic
1169253089 20:4075127-4075149 CTGGAGGAGATGAGGATGGAGGG - Exonic
1169752668 20:9010656-9010678 ATGAATGAGGTTAGGATGGGTGG + Intergenic
1170414072 20:16121535-16121557 GTGAAGAAGGTGAGGCTTTGGGG - Intergenic
1170594143 20:17792845-17792867 CTGAGGGAGGGGAGGTTGGGTGG - Intergenic
1170736958 20:19021083-19021105 CTGGAGGAGGGGATGCTGTGTGG + Intergenic
1170814107 20:19698236-19698258 GTGTTGGAGGTGAGGCTTGGCGG - Intronic
1170840187 20:19918998-19919020 CTGAAGGCTGGGAGGCTGGAAGG + Intronic
1171386460 20:24772613-24772635 ATGAAGGAGCAGTGGCTGGGGGG - Intergenic
1171467856 20:25343703-25343725 CTGAAGCAGGAGAACCTGGGAGG + Intronic
1172093722 20:32450660-32450682 CTGAAATAGGTCATGCTGGGTGG + Intronic
1172173700 20:32959974-32959996 GACAAGCAGGTGAGGCTGGGAGG + Intronic
1172513418 20:35515907-35515929 CTGCTGGAGGTGAGGATGAGAGG + Exonic
1172642544 20:36449479-36449501 TTGAAGGTGGAGAGGCTGGCAGG - Intronic
1172649062 20:36490349-36490371 GGGAAGGATTTGAGGCTGGGTGG + Intronic
1172699757 20:36845825-36845847 CTGAAGGAGCTGGGGGTGGGGGG + Intronic
1172792847 20:37518187-37518209 GCAAAGGAAGTGAGGCTGGGCGG + Exonic
1172840309 20:37898965-37898987 CTCAAGGAGGGGAGGGAGGGTGG + Intergenic
1172848554 20:37944622-37944644 AGGAGGGAGGCGAGGCTGGGGGG - Exonic
1173242404 20:41309266-41309288 CTGAAGAAGGTGGGACTGGTGGG - Intronic
1173586346 20:44186313-44186335 CTGATGGAGGTGAGGCCAGCTGG - Exonic
1173912212 20:46678801-46678823 GTGTAGGAGGTGGGGCTGGTGGG + Intronic
1174367952 20:50067764-50067786 CTGCAGGAGGTGAGGGAGTGAGG - Intergenic
1174416952 20:50373747-50373769 CTGGAGGAGGTGAGAGAGGGAGG + Intergenic
1174444115 20:50579033-50579055 GTGTTGGAGGTGGGGCTGGGTGG - Intronic
1174484179 20:50851108-50851130 CTGCAGGAGGTGACTCGGGGAGG + Intronic
1174551756 20:51367284-51367306 CTGGAAGAGATAAGGCTGGGAGG + Intergenic
1174830792 20:53810547-53810569 GTGAAGGAGATGAGGGTGGGAGG + Intergenic
1175160759 20:57005895-57005917 TGGAAGGAGGTGAGGGAGGGAGG - Intergenic
1175522818 20:59613067-59613089 ATGTTGGAGGTGGGGCTGGGTGG - Intronic
1175737830 20:61399581-61399603 ATGATGGAGGTGAGGCTTTGGGG - Intronic
1175854260 20:62111918-62111940 CTGGGGGAGGTGAGGGTGGGAGG + Intergenic
1176025517 20:62983369-62983391 CTGGAGGAGGTGACCCTTGGGGG - Intergenic
1176030612 20:63009465-63009487 CAGCAGCAGGTGAGCCTGGGGGG + Intergenic
1176030732 20:63009940-63009962 CACCAGGAGGTCAGGCTGGGTGG + Intergenic
1176060488 20:63170361-63170383 CTGAGGGAGGGGAGGATGTGAGG - Intergenic
1176112133 20:63415557-63415579 GGGAGGGAGGGGAGGCTGGGTGG + Intronic
1176428594 21:6563148-6563170 CTGGAGAAGGTGGTGCTGGGGGG + Intergenic
1178021993 21:28419066-28419088 GTGAAGGAGGTGTGGGTAGGAGG + Intergenic
1178282026 21:31291910-31291932 CTGAAGAAGGAGAGTCTGGAAGG - Intronic
1178412651 21:32378305-32378327 TTGAAGGATGTGGGGCAGGGAGG - Intronic
1179339082 21:40487455-40487477 TTGCATGAGGTGAGGCTGGAGGG + Intronic
1179523762 21:41962173-41962195 CTGAAGCAGGGCAGGCTTGGTGG + Intergenic
1179564897 21:42241174-42241196 CTGACGGAGGTGACCCTGGCTGG + Intronic
1179643631 21:42762372-42762394 CTGGAGGAGGTGAGGAAGGAGGG - Intronic
1179704084 21:43171464-43171486 CTGGAGAAGGTGGTGCTGGGGGG + Intronic
1179963093 21:44782153-44782175 CTCAAGGAGGTGATTTTGGGAGG - Intronic
1179964239 21:44791848-44791870 CTGAAGGGGGTGGGTGTGGGAGG + Intronic
1179998628 21:44985204-44985226 AGGGTGGAGGTGAGGCTGGGCGG + Intergenic
1180178992 21:46109597-46109619 GTGCAGGAGGGGAGGCTTGGGGG - Intronic
1180195388 21:46190781-46190803 CTCAAGGTAGTGAGGCTAGGAGG - Exonic
1180568276 22:16693971-16693993 CTGAAGGAGGTCTGGGTGAGTGG - Intergenic
1181024518 22:20120436-20120458 CTGAGGGAGGTGAGGCCAGCAGG + Intronic
1181027145 22:20132749-20132771 GTGAAGAAGTTGAGGCTGGAGGG - Intronic
1181036166 22:20170700-20170722 CGGAAGGAGGTGATGCTGTTCGG + Intergenic
1181404395 22:22672447-22672469 GTGCAGGAGGTGGGGCAGGGAGG + Intergenic
1181529489 22:23508829-23508851 CTGAGGGTGGGGAGCCTGGGAGG - Intergenic
1181582826 22:23837413-23837435 CTGATGGGAGTGAGGATGGGAGG - Intronic
1181695267 22:24589807-24589829 CCCAAGAAGGTGAGGCTGGCAGG - Exonic
1181787244 22:25236119-25236141 CTGAGGGAGGCGAGGCGCGGAGG - Intergenic
1182352290 22:29705757-29705779 CTGAGCGGGGTGGGGCTGGGGGG - Intergenic
1182524295 22:30906061-30906083 CGGAGGAAGGTGAGGCCGGGCGG + Exonic
1183121174 22:35731420-35731442 GTGAAGGAGGTGAGGGTGTCTGG + Intergenic
1183245965 22:36693644-36693666 CAGAAAGGGGTGAGGCTGGAAGG - Intronic
1183267725 22:36839604-36839626 GTGAAGGAGGAAGGGCTGGGTGG - Intergenic
1183287745 22:36978177-36978199 AGGAAGGAGGCGGGGCTGGGAGG - Intergenic
1183587653 22:38762399-38762421 CTGAGGGAGCTGAGGAGGGGTGG - Intronic
1183664622 22:39240130-39240152 GTGAAGGAGCAGAGGCTGAGCGG - Intronic
1183697296 22:39430623-39430645 GTGAGGGAGGTGATGGTGGGAGG - Exonic
1183732777 22:39627930-39627952 CTGGAAGAGGTGGGGCTGGGTGG + Intronic
1183867293 22:40713950-40713972 CTGATTGAGGTGGGGCTTGGTGG - Intergenic
1184119542 22:42441103-42441125 CTGGAGAAGGGGAGGCTGGGTGG - Intergenic
1184167212 22:42736939-42736961 TTGGAGCAGGTGAGGCGGGGGGG - Intergenic
1184291249 22:43499154-43499176 GTGACGGAGGTGATGGTGGGAGG + Intronic
1184320332 22:43736989-43737011 AGGAAGGAAGTGAGGCTGAGAGG - Intronic
1184371168 22:44082992-44083014 CCCCAGGAGGTGAGGCTGGGGGG + Intronic
1184783187 22:46659220-46659242 CTGAGGGAGTGGAGGCTGAGAGG - Intronic
1185069953 22:48650793-48650815 CTGGGGGAGGGGAGGCTCGGTGG - Intronic
1185074059 22:48673711-48673733 ATGTAGGAGGTGAGGGAGGGTGG + Intronic
1185340451 22:50288591-50288613 CTGGATGAGGGGTGGCTGGGTGG - Intronic
949310773 3:2695414-2695436 CTGAAAAAGGTGAGGCTTGGGGG - Intronic
949379770 3:3431656-3431678 CTGCAGGAGGTGATGCTAGTGGG - Intergenic
949677042 3:6467377-6467399 ATGAAGGAGGGGAGGGAGGGAGG + Intergenic
949734766 3:7159431-7159453 GTGAAAGAGATGAGCCTGGGAGG + Intronic
949875453 3:8623535-8623557 CTGCAGCAGGTGAGCCAGGGCGG - Exonic
950008468 3:9705712-9705734 CTGCAGAAGGTGAGGCTGAATGG + Exonic
950245504 3:11413428-11413450 CTGAAGAAAGTGGGGCGGGGGGG - Intronic
950404697 3:12797173-12797195 CTGAAGGTGGTGGGGGCGGGGGG - Intronic
950442377 3:13017741-13017763 GAGAGGGAGGTGAGGCTGGCAGG + Intronic
950461571 3:13125325-13125347 CTGGTGGAGGTGGGGGTGGGAGG - Intergenic
950465929 3:13153637-13153659 CTGAAGGGGGTGGGTCTGGCAGG - Intergenic
951002672 3:17581951-17581973 CTGAAGGAGGTGAGAGAGTGAGG - Intronic
951186558 3:19720669-19720691 CTTTAGGAGGTGAAGGTGGGAGG + Intergenic
951652878 3:24971260-24971282 ATGAGGGAGCTGAGGCTAGGAGG + Intergenic
951990738 3:28673682-28673704 CTAAAGGAGGTCAGACTGGGTGG + Intergenic
952494704 3:33905551-33905573 CTTTAGGGGGTGAGGCGGGGCGG - Intergenic
953672409 3:44974624-44974646 CTGAAAGAGGTGAAGCCGGAAGG - Intronic
953693803 3:45142217-45142239 CTGATTGAGGTCAGGGTGGGTGG - Intronic
953882408 3:46697445-46697467 CTGAACGTGTGGAGGCTGGGTGG + Intergenic
954001970 3:47565036-47565058 ATGAAGGAGTTGAGGGTGGGAGG - Intronic
954034453 3:47843492-47843514 CTGAACCTGGTGAGGCCGGGAGG + Intronic
954501346 3:51019620-51019642 CTGTTGGAGGTGAGGGTGGAAGG - Intronic
954616049 3:51969081-51969103 CAGAAGGAGGAGTGGGTGGGAGG + Exonic
954661635 3:52229791-52229813 GGGCAGGAGGTGAGCCTGGGAGG + Intronic
956262810 3:67363789-67363811 TTGCAGGGGGTGAGGTTGGGGGG - Intronic
956899935 3:73704753-73704775 CAAAAGGAGGGGAGGCGGGGAGG + Intergenic
957442783 3:80272132-80272154 CTGAAGGAAGGGAGGGAGGGAGG + Intergenic
958912073 3:100005322-100005344 TTGAAAAAGGTGAAGCTGGGAGG + Intronic
960005435 3:112776687-112776709 CTTTGGGAGGTGAGGGTGGGCGG + Intronic
960295272 3:115935337-115935359 CTGAAAGAGGTGTGGCCGGGTGG + Intronic
960357747 3:116674351-116674373 CAGAAGGAGGTGGGGGTGGCTGG - Intronic
960834023 3:121885288-121885310 CTGGGGGAGGTGAGGCTAAGTGG - Intronic
961078358 3:124002986-124003008 CTGAAGGAGGTGGGGGCGGGGGG - Intergenic
961292656 3:125860054-125860076 CTGCAGGGAGTGGGGCTGGGAGG - Intergenic
961449606 3:126996573-126996595 CTGAAAGAGCTGGAGCTGGGGGG + Intronic
961958116 3:130825370-130825392 ATGAAGGAGGGAAGGCAGGGAGG + Intergenic
962198906 3:133385472-133385494 TGGAGGGAGGTCAGGCTGGGGGG - Intronic
962352510 3:134666188-134666210 CTGAACGTGCTGAGGCTGGAAGG - Intronic
962795447 3:138845856-138845878 ATGAAGGAGGCTGGGCTGGGTGG - Intergenic
963006142 3:140727672-140727694 CTGAAGGGCGTGAGCCTGGGAGG + Intergenic
963006196 3:140728221-140728243 CTGGAGCAGGTGAGGCTTTGGGG - Intergenic
963756352 3:149238737-149238759 CTGGAGGAGGTGAGGCTTCCAGG + Intergenic
963936619 3:151060425-151060447 CCAAAGGATGGGAGGCTGGGAGG + Intergenic
964492331 3:157250087-157250109 ATGAGAGTGGTGAGGCTGGGAGG - Intergenic
964664409 3:159156329-159156351 CTGAAGGAGGTGAGCATTGATGG + Intronic
964750809 3:160052191-160052213 CTGAAGGAGGCCAGGCGCGGTGG - Intergenic
965576512 3:170222827-170222849 CTGGAGGAGGGGAGGGTGAGGGG + Intronic
965689154 3:171337009-171337031 CTTAGAGAGGTGAGGCTGTGGGG - Intronic
966747856 3:183295569-183295591 CTGAGGGAGGTAGGGATGGGGGG - Intronic
967238101 3:187407901-187407923 CTGAAGCAAGTAAGTCTGGGTGG - Intergenic
967546153 3:190731262-190731284 CTGAAGGAGGTGAGGCTGTAGGG + Intergenic
968123147 3:196140470-196140492 GTGAAGGAGGACAGGCTGGCAGG - Intergenic
968875600 4:3266036-3266058 CTGTCGGAGGCGAGGCTGGGAGG + Intronic
968936532 4:3614039-3614061 CTGGAGAAGCTGAGGATGGGAGG - Intergenic
969178544 4:5419401-5419423 TGGAAGGAGTTGTGGCTGGGTGG + Intronic
969202778 4:5618896-5618918 CTGAATGAGGCCAGGCTGTGAGG + Intronic
969408336 4:7010449-7010471 CTGAAGGAGAGCAGGCCGGGTGG + Intronic
969809273 4:9635296-9635318 CTGCGGGAAGTGGGGCTGGGAGG - Intergenic
970171591 4:13295963-13295985 CTGAACGAGGTGGAGCTGGATGG - Intergenic
970504473 4:16713453-16713475 CTAAAGGATTTGAGGGTGGGTGG + Intronic
970643148 4:18090033-18090055 GTAAAGGAGGTTAGGCGGGGAGG - Intergenic
970903081 4:21182620-21182642 TGGAAGGATGTGAGGCTGGAAGG - Intronic
971044269 4:22787914-22787936 CAGAAGTTGGTGAGGCTGTGGGG - Intergenic
971275872 4:25196028-25196050 CTGGAGGCTGTGAGGATGGGTGG - Intronic
971367728 4:25991153-25991175 CTGAGAGAAGTGAGGCTTGGAGG + Intergenic
972228336 4:37041134-37041156 CTGAATTATGTGAGGCTGGATGG - Intergenic
972299169 4:37768935-37768957 CTAAAGAAGGTGAGGGTGGCCGG + Intergenic
972376349 4:38475519-38475541 CTGAAGCAGGGAAGGCTGAGGGG - Intergenic
972447636 4:39161041-39161063 CTGTGGGAGCTGAGGCTGGAAGG - Intergenic
972612439 4:40668188-40668210 GTGGATGAGGTGAGGCTGTGAGG - Intergenic
975067483 4:70086045-70086067 CTGAAGTGGGTGAAGGTGGGAGG + Intergenic
975143257 4:70939572-70939594 CTCAAGAGGCTGAGGCTGGGAGG + Intronic
975495399 4:75030839-75030861 ATGAGGAAGGTGTGGCTGGGGGG - Intronic
975740526 4:77425038-77425060 CTGAAGGAGATCAGTCAGGGTGG + Intronic
976378672 4:84374753-84374775 CTGAAGCAGGTGTAGCTGGGTGG - Intergenic
977312236 4:95401742-95401764 CCGAAGGAGGTGAGACTCAGTGG + Intronic
979614939 4:122732456-122732478 CTGCGGGAGGTGACGCCGGGAGG - Intergenic
979768164 4:124488479-124488501 CGGAAGGAGGGGAGGGAGGGAGG + Intergenic
980066247 4:128191876-128191898 ATGAAGAAGCTGAGTCTGGGAGG + Intronic
981135543 4:141207013-141207035 CAGAAGAAGGTGAGACTGGCTGG - Intronic
981619344 4:146676399-146676421 GAGAAGGAGGAGAGGGTGGGGGG - Intergenic
981922110 4:150096898-150096920 GTGAATGGGGTGGGGCTGGGCGG + Intronic
982207308 4:153006297-153006319 GTGGAGGAGGAGAGGGTGGGTGG + Intergenic
982623306 4:157732621-157732643 CTGAAGGAGAGAAGGCAGGGTGG + Intergenic
983001616 4:162421384-162421406 ATGAAGGTGGTAAGGATGGGGGG + Intergenic
984529181 4:180895156-180895178 CTTTAGGAGGTTAGGCTGTGAGG - Intergenic
984770361 4:183431956-183431978 CTGAAGGAGGTGCTGCTATGTGG + Intergenic
985019302 4:185670713-185670735 CTAAAGGATGTGTGGATGGGAGG - Intronic
985656313 5:1133361-1133383 CTGGAGGAGGTGGGGCTGACGGG - Intergenic
985698667 5:1357638-1357660 CTGAAGGAGGAAGGGATGGGTGG + Intergenic
986555784 5:9008702-9008724 GTGAAGGAGGAGGGGCTGAGGGG + Intergenic
988501062 5:31784145-31784167 CTGCAGGAGGTGAGGACGGGAGG - Intronic
988821360 5:34889505-34889527 CTGAAGGGGGTGTGGATAGGAGG - Intronic
989475719 5:41870524-41870546 TTAAAAGAAGTGAGGCTGGGCGG + Intergenic
990042432 5:51390122-51390144 CTGAGGGCGGGGAAGCTGGGAGG + Intronic
990237957 5:53788147-53788169 CTGTGGGAGTTTAGGCTGGGGGG + Intergenic
990485607 5:56257068-56257090 ATGAAGGAAGGGAGGCAGGGAGG - Intergenic
990876696 5:60494368-60494390 CTGCAGGTGGTGAGGCTCAGTGG - Intronic
991013772 5:61910625-61910647 CTGGAGGAGGGAAGGCAGGGTGG + Intergenic
991703457 5:69336210-69336232 CTGAACAAGGTGGGGCTTGGTGG + Intergenic
992494218 5:77276362-77276384 CTGGATGAGGTGATCCTGGGAGG - Intronic
992879411 5:81091341-81091363 ATGAAGGAGGTGAGGTGGGTGGG - Intronic
993344619 5:86767109-86767131 CTGCAGGTGGTGAAGCAGGGTGG + Intergenic
993956091 5:94234794-94234816 ATGTTGGAGGTGAGGCTGGTGGG - Intronic
994104882 5:95936490-95936512 CTCAAGAAGGTGGGGCTGGGTGG + Intronic
995142576 5:108749392-108749414 CTGATGGGCGTGAGGCGGGGTGG + Intronic
996614366 5:125422725-125422747 CAGAGGGAGGTGGGGGTGGGAGG - Intergenic
997199230 5:131999727-131999749 CAGATGGAGGTGGGGCTGGCGGG - Intronic
997282877 5:132659618-132659640 CTGGCGCAGGTGAGTCTGGGTGG - Intronic
997337929 5:133120867-133120889 CTGAAGGAAGTGAGGAAGGGAGG - Intergenic
997377733 5:133409341-133409363 CTGTAGCAGGTGAGCCTGAGAGG - Intronic
997697068 5:135869981-135870003 CAGAAGCAGGTGAGGTTGAGGGG - Intronic
998131318 5:139652485-139652507 CTGACAGAGATGAGGCTGTGTGG + Intronic
998148966 5:139746409-139746431 CTGCAGAAGGCGGGGCTGGGGGG + Intergenic
998349029 5:141489007-141489029 CTGGAGGAGGAGAGGCGGGCTGG - Intronic
998531632 5:142890439-142890461 TGGGAGGAGGTGAGGCTGGAGGG + Intronic
998661978 5:144248788-144248810 CTGAAAGAGGGAAGGCTGTGGGG + Intronic
999200743 5:149814564-149814586 CTGGAGGAGGTGGGGCGGAGGGG - Intronic
999359585 5:150971883-150971905 CTCTAGGAGTGGAGGCTGGGAGG - Intergenic
999442835 5:151615647-151615669 CTCAAGGTGTTGAGCCTGGGAGG + Intergenic
1000382521 5:160641968-160641990 CTGAATGGAGTGAGGCTGAGAGG - Intronic
1000422601 5:161055596-161055618 ATGTTGGAGGTGAGGCCGGGTGG - Intergenic
1001103661 5:168834595-168834617 GGGCAGGAGGTGAGCCTGGGAGG + Intronic
1001134477 5:169091030-169091052 CTCAAGGAGGTCAGCCTGGTAGG - Intronic
1001332771 5:170773764-170773786 CTGCAAGAGTTCAGGCTGGGAGG + Intronic
1001443588 5:171764703-171764725 ATGAAGGATGGGAGGCTGGAGGG - Intergenic
1001475682 5:172048990-172049012 CTGAAGGACCTGAGGGAGGGAGG - Intronic
1001558081 5:172649802-172649824 CTGAAAGTTCTGAGGCTGGGTGG - Intronic
1001794590 5:174491494-174491516 CAGCAAGAGGTGAGGCTGAGAGG - Intergenic
1001878356 5:175220387-175220409 GTGAAGAAACTGAGGCTGGGTGG - Intergenic
1001897185 5:175392645-175392667 GTGATGGAGGTGGGGTTGGGGGG - Intergenic
1002080171 5:176732992-176733014 CAGAAGGCAGTGAGGCTGGGAGG + Intergenic
1002181933 5:177435174-177435196 CAGAAGTGGGTGTGGCTGGGTGG - Intronic
1002305508 5:178280400-178280422 CTGAAGGGGCCGAGGCTTGGCGG + Intronic
1002843552 6:926072-926094 GTGAGGGAGGTGAGGCTCCGTGG + Intergenic
1002906412 6:1452762-1452784 CAGATCGAGGTGTGGCTGGGTGG + Intergenic
1003251500 6:4432618-4432640 CTGAAGGAGGTGAGCATGAGAGG - Intergenic
1003324553 6:5082781-5082803 CTGGCGGAGCTGAGGATGGGAGG - Intergenic
1003695870 6:8405888-8405910 CTGGAGGAGGGAAGGCAGGGTGG + Intergenic
1003975165 6:11336078-11336100 CTGAGGGAGGTGAGGGCAGGAGG - Intronic
1004256153 6:14066405-14066427 CTGAAGAACGTGAGCCTGAGGGG - Intergenic
1004573403 6:16869716-16869738 CTGAAGGAGGGGTGGGTGGGAGG + Intergenic
1005226786 6:23652470-23652492 CTGGAGGAGGTGAGGAGGTGAGG + Intergenic
1005905265 6:30257490-30257512 GAGAAGGGGGTGAGGGTGGGAGG + Intergenic
1006029009 6:31165557-31165579 CTTCAGGAGGTAAGGGTGGGAGG - Exonic
1006043641 6:31274468-31274490 GGGAAGGGGGTGAGGGTGGGAGG - Intronic
1006094154 6:31645312-31645334 CTGAAGGAGGTTAGGAAAGGAGG - Intronic
1006304399 6:33210355-33210377 CTTTGGGAGGTGAGGATGGGAGG + Intronic
1006380179 6:33692705-33692727 CTGCAGGGGATGAGGCAGGGAGG - Intronic
1006442027 6:34058960-34058982 CCGTACGAGGTAAGGCTGGGCGG - Exonic
1006477179 6:34263929-34263951 CTCAAGGAAGTGAAGATGGGAGG - Intergenic
1006509141 6:34512347-34512369 CTGACGGAGGGGTGGGTGGGAGG + Intronic
1006589774 6:35146010-35146032 CTGAAGGATGAGAGTCAGGGAGG - Intronic
1007302028 6:40874855-40874877 CTTAAGGAGGGGTGGCAGGGAGG - Intergenic
1007302196 6:40875916-40875938 CTGAGGGATGTGAGGTAGGGTGG + Intergenic
1007628610 6:43260230-43260252 CTTTAGGAGGTGAAGATGGGAGG + Intronic
1007952452 6:45884509-45884531 ATGAGAGAGGTGAGGCTGCGGGG - Intergenic
1008079348 6:47178307-47178329 CTGAGGGAGGATAGGCAGGGTGG + Intergenic
1008899075 6:56590785-56590807 GGGAAGGAGGTCAAGCTGGGAGG - Intronic
1009289744 6:61868138-61868160 CTCAAGCAGGGGTGGCTGGGAGG + Intronic
1009680254 6:66882321-66882343 GTGTTGGAGGTGGGGCTGGGTGG - Intergenic
1011184599 6:84660280-84660302 CTGAAGGAGATGATACTGTGAGG + Intergenic
1011396361 6:86913333-86913355 ATGAAGGAGGTGAAGCTTGAGGG + Intergenic
1011603734 6:89081828-89081850 ATGAAGGAGGCGAGGCCGGGTGG + Intronic
1011645656 6:89455535-89455557 ATGTTGGAGGTGGGGCTGGGTGG + Intronic
1012992223 6:105937984-105938006 GTGAAGGAGGGCAGGCTGGTGGG - Intergenic
1013054293 6:106568327-106568349 CTCAAGGAGGCAAGGCAGGGAGG - Intronic
1013133878 6:107261254-107261276 ATGCAGGAGGTGGGGCTGGTGGG + Intronic
1013279097 6:108618209-108618231 TTGAAGGTGGTGGGGCAGGGTGG - Intronic
1013599360 6:111690097-111690119 CTGAAGGAAGTGAGGGCTGGAGG + Intronic
1013899562 6:115138074-115138096 CAGACTGATGTGAGGCTGGGCGG + Intergenic
1014342790 6:120229718-120229740 CTGAAGGAAGTGAGGTAGGCTGG - Intergenic
1014374641 6:120658218-120658240 GTGCAGGAAGTGTGGCTGGGAGG + Intergenic
1015248190 6:131098752-131098774 CTGAAGGAGGCCAGGCATGGTGG - Intergenic
1015291955 6:131547517-131547539 CTAAAGGAGATGCGGCTGAGTGG + Intergenic
1015808719 6:137140258-137140280 GTGCTGGAGGTGAGGCTTGGTGG - Intergenic
1016330725 6:142949306-142949328 CTATGGGAAGTGAGGCTGGGTGG + Intergenic
1016414660 6:143820138-143820160 ATGCTGGAGGTGGGGCTGGGAGG - Intronic
1016843042 6:148543814-148543836 CAGGAGGAGGGCAGGCTGGGTGG + Exonic
1016909109 6:149179395-149179417 GTGGAGAAGGTGAGGCAGGGAGG + Intergenic
1017147743 6:151249999-151250021 CTTCGGGAGGTGAGGGTGGGAGG + Intronic
1017456273 6:154604106-154604128 AGGGTGGAGGTGAGGCTGGGTGG - Intergenic
1017595854 6:156027826-156027848 CTGGAGGACGTGAGGCCGGGAGG - Intergenic
1017756958 6:157537896-157537918 CTGAAGGAGGTGAGACTAATGGG - Intronic
1017865054 6:158435797-158435819 CGGAGGGAGGAGAGGCAGGGGGG - Intronic
1017876849 6:158531863-158531885 CTGGAGGATGAGAGGCTGTGTGG - Intergenic
1018036588 6:159887455-159887477 ATGATTGAGGGGAGGCTGGGGGG + Intergenic
1018399522 6:163408774-163408796 CTGAAGAAGCAGAGGCTGAGAGG - Intergenic
1018477420 6:164157531-164157553 TTGAAGGAGGTGAGGAAGAGAGG + Intergenic
1018640095 6:165897627-165897649 CTGGAGGTGGGGGGGCTGGGGGG - Intronic
1018805807 6:167258639-167258661 CTGACGGTACTGAGGCTGGGAGG + Intergenic
1018973681 6:168547161-168547183 ATGAAGAAGGTGAGCCGGGGTGG + Exonic
1019366752 7:636998-637020 TTGAAGGAGGTGAGGTGTGGTGG + Intronic
1019493710 7:1326601-1326623 CTGGAGGAGGGCGGGCTGGGGGG - Intergenic
1019649918 7:2151375-2151397 CTGAGGGGTGTGAGGCGGGGTGG - Intronic
1019824111 7:3269270-3269292 CTGGAAGAGGTGGGACTGGGGGG - Intergenic
1019990050 7:4683855-4683877 CTGAAGGAGCAGAGGCCTGGCGG + Intronic
1020013307 7:4817849-4817871 CGGCTGGAGCTGAGGCTGGGGGG + Intronic
1020143164 7:5623404-5623426 CTGAAGGATGTCTGGCTGGGTGG - Intronic
1020263930 7:6547830-6547852 CTGAAGGAGGCCAGAGTGGGTGG + Intronic
1021256035 7:18393529-18393551 ATGGATGAGGTGAGGCAGGGAGG + Intronic
1021825567 7:24547370-24547392 TGGAAGGAAATGAGGCTGGGTGG + Intergenic
1022336266 7:29424835-29424857 GTAAAGGAGGTGAGGGAGGGTGG - Intronic
1022547577 7:31203120-31203142 CTGATGAAGGTGAGTCTGAGAGG + Intergenic
1023737701 7:43249120-43249142 CTGATGGAGGTGGGGACGGGCGG - Intronic
1023972186 7:44999914-44999936 CTGAAGGACGCGGGGCGGGGTGG + Intronic
1023975938 7:45030089-45030111 CTGAAGAAACTGAGGCTGTGAGG - Intronic
1023980763 7:45068734-45068756 CAGAGAGAGGTGGGGCTGGGTGG - Intronic
1024240054 7:47427785-47427807 ATGAGGGAGGTGAGGCTCAGAGG - Intronic
1024312232 7:47979672-47979694 CCGGAGGAGGTGGGGCTAGGGGG + Intergenic
1024608870 7:51046049-51046071 CAGAAGCAGGTGGGGGTGGGGGG + Intronic
1025027937 7:55533607-55533629 CTGAAGAAGCTGAGGCTCAGGGG - Intronic
1025253750 7:57369300-57369322 CTGGAGGAGGTGAGAGAGGGAGG - Intergenic
1026115256 7:67490470-67490492 GTGCTGGAGGTGAGGCTTGGTGG + Intergenic
1026233370 7:68505022-68505044 CTGCAGGAGCTGAGGCTGCCAGG + Intergenic
1026464856 7:70645226-70645248 ATGAATGAGGGGAGGTTGGGAGG - Intronic
1027182086 7:75947985-75948007 CTCAAGGAGGTTAAGCTTGGAGG - Intronic
1027522680 7:79229946-79229968 CTGAAGACTGTGAGGGTGGGGGG - Intronic
1027538151 7:79432968-79432990 CAGAAGAAGGTGAGGTTGGGAGG + Intronic
1028581982 7:92418106-92418128 GAGAGGGAGGGGAGGCTGGGTGG - Intergenic
1029127283 7:98303366-98303388 GTGAAGGGGAGGAGGCTGGGTGG - Intronic
1029375396 7:100174279-100174301 AGGCAGAAGGTGAGGCTGGGAGG + Intronic
1029440344 7:100583775-100583797 CAGGTGGAGGCGAGGCTGGGAGG - Intronic
1029479666 7:100804942-100804964 CAGGAGGAGGTGAGGCGGGCAGG + Intronic
1029506730 7:100967550-100967572 GTGAAGGACGTGAGGATTGGAGG - Exonic
1029514371 7:101016675-101016697 GTGGAGGAAGTGAGGCTGAGGGG + Intronic
1029514385 7:101016724-101016746 CTGGTGGAGATGAGGCTGAGTGG + Intronic
1029729631 7:102430777-102430799 ATGAAGGAAGTGAGGGAGGGAGG + Intergenic
1029998308 7:105031462-105031484 CTGAAAAAGGTGAGGCACGGTGG + Intronic
1030063846 7:105643918-105643940 CTGAAGGACCTGCGTCTGGGGGG + Intronic
1031567344 7:123317129-123317151 CAAAAGGAGGGGAGGGTGGGAGG + Intergenic
1031716806 7:125118455-125118477 GTGTTGGAGGTGAGGCTTGGTGG + Intergenic
1031946900 7:127851911-127851933 CTTAAGGAGGTGGAGGTGGGTGG + Intronic
1032757206 7:134902456-134902478 CTGAAGGTTTTGGGGCTGGGAGG + Intronic
1033210810 7:139458936-139458958 CTGCAGGTGCTGAGGCAGGGTGG - Intronic
1033414115 7:141147312-141147334 GCAGAGGAGGTGAGGCTGGGTGG + Intronic
1034143326 7:148844160-148844182 CTGAAGTAGGTCAGGTAGGGAGG - Intronic
1034163163 7:149007063-149007085 TGGAAGGAAGTGAAGCTGGGGGG + Intronic
1034376514 7:150649580-150649602 CAAAAGCAGGTGAGGCTGGCTGG + Intergenic
1034614506 7:152403912-152403934 CAGAAGGTTGGGAGGCTGGGAGG + Intronic
1035040081 7:155920859-155920881 CAGAAGGAGCTGATGCTGGGTGG + Intergenic
1035453114 7:158991875-158991897 CTGAGGGAGGGGAGGGAGGGAGG + Intergenic
1035946511 8:3969280-3969302 CTGCAAAAGATGAGGCTGGGTGG + Intronic
1036284505 8:7431954-7431976 GGGAAGGAGGTGAGTGTGGGTGG + Intergenic
1036336971 8:7879576-7879598 GGGAAGGAGGTGAGTGTGGGTGG - Intergenic
1036731056 8:11265169-11265191 GTGCTGGAGGTGGGGCTGGGTGG + Intergenic
1036764331 8:11537662-11537684 CTGAAGAAGGCGAGGCGAGGTGG - Intronic
1037569666 8:20147771-20147793 ATGGAGGAGGAGAGGCGGGGTGG - Intronic
1037785067 8:21897886-21897908 CTGAAGGAGGTGAGCCTGGCTGG + Intergenic
1037951332 8:23020088-23020110 CAGGAGGAGGGGAGGTTGGGGGG + Intronic
1038631128 8:29245055-29245077 TTGAAGGAGGTGCAGCTGGCTGG - Intronic
1039568500 8:38567583-38567605 CTCAAGGAGGTGAGGCTGGTCGG - Intergenic
1040668546 8:49659006-49659028 CTGATGGGGGTGGGGCTGGCTGG - Intergenic
1040941299 8:52835967-52835989 TTAAAGGAGGTGAGGCAGAGTGG + Intergenic
1041522221 8:58769291-58769313 CTGTTGGAGGTGGGGCTTGGTGG - Intergenic
1041886708 8:62817431-62817453 CAGAAGAAGGTGAATCTGGGAGG - Intronic
1042103932 8:65304194-65304216 CAGAAGGAATTGAGGCTGCGTGG - Intergenic
1042155510 8:65841292-65841314 GTAGAGGAGGTGAAGCTGGGTGG + Intronic
1043973927 8:86564093-86564115 CTGAAGGAGGTGAGGGAGCAAGG - Intronic
1044242362 8:89902395-89902417 CTGATGGAGCCGAGGCTGCGCGG - Intronic
1044728468 8:95211998-95212020 CTGAAGGAGCTAAGTCTTGGAGG + Intergenic
1045554040 8:103197870-103197892 GTGTTGGAGGTGGGGCTGGGTGG - Intronic
1046949493 8:120006234-120006256 AAGAAGGAAGTGAGGCTGGGCGG + Intronic
1047340360 8:123975048-123975070 CAGAGGGAGGAGAGCCTGGGAGG + Intronic
1047705295 8:127493178-127493200 CAGAGGGAGGTGAGTGTGGGAGG + Intergenic
1047970734 8:130082100-130082122 CTGAAGAGGGAGAGGCTGGCAGG + Intronic
1048385752 8:133911084-133911106 CTTCAGGAGGTGAAGGTGGGAGG + Intergenic
1048516288 8:135114427-135114449 ATGTTGGAGGTGGGGCTGGGGGG + Intergenic
1049002046 8:139832457-139832479 CCGAAGCAGGGGAGGCTGGTGGG + Intronic
1049056177 8:140239191-140239213 CTGAGGGTGGTGCGTCTGGGTGG - Intronic
1049199545 8:141333306-141333328 TGGAGGGAGGTGAGGCTGGAGGG + Intergenic
1049315463 8:141964654-141964676 CTGGGAGAGATGAGGCTGGGTGG + Intergenic
1049361948 8:142216125-142216147 CTGGAGGAGCTGGGGCTGAGGGG - Intronic
1049362048 8:142216510-142216532 CTCAGGGAGATGAGGCTGGAGGG + Intronic
1049651528 8:143771957-143771979 CTGAAGGAGGTCAGCGGGGGCGG + Intergenic
1049850916 8:144829652-144829674 CTGATGGAGGCCTGGCTGGGTGG - Intronic
1050042865 9:1514098-1514120 CTGAAGAAGGTGAGGCATAGAGG + Intergenic
1050436438 9:5615359-5615381 TTGAAGGGGGTGAGGAGGGGAGG - Intergenic
1050664300 9:7918098-7918120 CTGAAACAGGTGAGCCTGGGAGG - Intergenic
1051154231 9:14123003-14123025 CTGTGGGAGGTCAGGGTGGGTGG + Intronic
1051193566 9:14538921-14538943 GTGAAAGAGGTGGGGTTGGGAGG - Intergenic
1051836987 9:21350496-21350518 ATGCAGGAGGTGTGGGTGGGAGG - Exonic
1052228118 9:26114389-26114411 CTGAAAGAGGTGAAGATGGAGGG + Exonic
1052997805 9:34560349-34560371 CTGTAGGATGGGAGGCTGTGTGG + Intronic
1053225597 9:36353226-36353248 CTGATGGAGGTAATGTTGGGGGG + Exonic
1053409115 9:37904201-37904223 CCGAGGGAGGGGAGGCGGGGCGG - Intronic
1053533610 9:38905121-38905143 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1054205834 9:62129550-62129572 CTGAATGAGGGGAGCCTGGCAGG - Intergenic
1054632526 9:67458820-67458842 CTGAATGAGGGGAGCCTGGCAGG + Intergenic
1056810526 9:89760482-89760504 CTGATGGAGGTGAGGCTGGCAGG - Intergenic
1056954771 9:91073208-91073230 CTAGAGGAGCTGAGGCTGGGCGG - Intergenic
1056992426 9:91423986-91424008 CTGAGGGCGGGGAGGCGGGGCGG - Intergenic
1057141462 9:92729010-92729032 CTGAAGGAGGTGAGGGGGTGAGG - Exonic
1057329635 9:94101404-94101426 CTGGAAGTGGAGAGGCTGGGAGG + Intronic
1057724303 9:97557344-97557366 CTCAGGGAGGTGATGCTGGCTGG + Intronic
1057986028 9:99715087-99715109 CTGAAGCAGGAGAACCTGGGAGG - Intergenic
1058777603 9:108300374-108300396 CTGAAGGAGATGGGGCTCTGCGG - Intergenic
1058989589 9:110242141-110242163 ATGAGTGAGGTGAGGATGGGAGG - Intergenic
1059348585 9:113648945-113648967 CTGCTGGAGGGGAGGCTGAGGGG - Intergenic
1059464597 9:114459913-114459935 GTGTTGGAGGTGGGGCTGGGAGG + Intronic
1059971774 9:119675794-119675816 ATGAAGGAAGGGAGGCTTGGGGG + Intergenic
1060205435 9:121680163-121680185 GTGTAGGAGGTGAGGCTGGGAGG + Intronic
1060632932 9:125176095-125176117 CTAAAGGAGGTAAGGCTATGGGG + Intronic
1061216445 9:129224603-129224625 ATGGAGGAGGCGAGCCTGGGAGG + Intergenic
1061714668 9:132511236-132511258 CTGAAGGAGGTTTAGCTTGGGGG - Intronic
1061773838 9:132947252-132947274 CTGAAAGAATTGAGGATGGGCGG - Intronic
1061851289 9:133417606-133417628 CTGCAAGAGGTGAGGCTTGAGGG - Exonic
1062187778 9:135227840-135227862 CTGAAGGAGGACAGGCGGAGAGG - Intergenic
1062199870 9:135296870-135296892 CAACAGGAGGTGAGGCAGGGCGG + Intergenic
1062323965 9:136003810-136003832 CTAAGGGAGGTGACTCTGGGTGG - Intergenic
1062423711 9:136496596-136496618 CTGCACCAGGTGAGGCTGGGTGG + Exonic
1062463370 9:136671065-136671087 CTGGAGGAGGTGAGGTGTGGAGG + Intronic
1062463384 9:136671112-136671134 CTGGAGGAGGTGAGGCATCGGGG + Intronic
1062463401 9:136671164-136671186 CTGGAGGAGGTGAGGCGTCGGGG + Intronic
1062463417 9:136671212-136671234 CTGGAGGAGGTGAGGCGTCGGGG + Intronic
1062506274 9:136878744-136878766 CTGAATGAGGTGGGGTTTGGTGG + Intronic
1062568305 9:137172968-137172990 CCAGAGGAGGGGAGGCTGGGAGG - Intergenic
1203779903 EBV:95551-95573 ATGAAGGGGATGAGGGTGGGGGG + Intergenic
1185672425 X:1823827-1823849 GTGATGGAGGTGGGACTGGGTGG - Intergenic
1185672623 X:1824807-1824829 ATGTTGGAGGTGGGGCTGGGTGG - Intergenic
1185672656 X:1824981-1825003 TTGTTGGAGGTGGGGCTGGGTGG - Intergenic
1186933070 X:14416056-14416078 CTGAAGGTTGGGAGGGTGGGAGG + Intergenic
1187173164 X:16870625-16870647 CTGATGGAGGCGCGGCTGGCCGG + Intergenic
1187200348 X:17128397-17128419 CTGCTGGAGGTGGGGGTGGGAGG + Intronic
1187290902 X:17952342-17952364 CTGAAGGAGGTGAGAGCGTGAGG - Intergenic
1189101423 X:38194101-38194123 ATGTAGGAGGTGAGGGTGAGGGG - Intronic
1189362898 X:40366865-40366887 CTGGAGGAGGCAGGGCTGGGAGG + Intergenic
1190056706 X:47185419-47185441 CTGTAGAGGGTGAGGGTGGGCGG - Intronic
1190121448 X:47663106-47663128 CTTGAGGGGGTGAGGCAGGGAGG - Intergenic
1190603651 X:52118379-52118401 TTAAAGGAGGTGTGTCTGGGTGG - Intergenic
1190794577 X:53729107-53729129 CTTTGGGAGGTGAGGTTGGGGGG - Intergenic
1192191956 X:68996368-68996390 CTGCTGGAGGTGGGGCAGGGAGG - Intergenic
1192359749 X:70431996-70432018 CTGAAGGAGCTGGGGCTGTGGGG + Intronic
1192378510 X:70588823-70588845 CTTAAGGAGGTCAAGGTGGGAGG + Intronic
1192446525 X:71215307-71215329 CTGAGGGAGGTGGGCCAGGGAGG + Intronic
1192502995 X:71665474-71665496 CTGGAAGAGAGGAGGCTGGGGGG + Intergenic
1193610947 X:83631046-83631068 CTGGTGGAGGTGGGGCTGGTTGG + Intergenic
1194354352 X:92862710-92862732 CTCAGGGAGGTAAGGATGGGAGG + Intergenic
1194739748 X:97558485-97558507 AGGTAGGAGATGAGGCTGGGGGG + Intronic
1195873195 X:109508249-109508271 CTCAAGAAGCTGAGGTTGGGAGG + Intergenic
1196034388 X:111128083-111128105 AAGAAGCAGGTGAGGCTGCGAGG + Intronic
1196603504 X:117628477-117628499 ATAAAGGAGGTGGGGCGGGGGGG - Intergenic
1197183780 X:123563687-123563709 CTGAGGGGAGTGAGGCAGGGAGG - Intergenic
1197236178 X:124067267-124067289 CAGAAGGTGGTGGGGGTGGGGGG - Intronic
1197432139 X:126379030-126379052 CTGCAGGAGGTGAGTGTGTGTGG + Intergenic
1197728530 X:129792305-129792327 CTGCAGGAGATGGGGCAGGGAGG - Intronic
1198087187 X:133292745-133292767 CTGCAGGAGGTGGGGCTCAGTGG + Intergenic
1198533305 X:137565680-137565702 CTCAAGGTGGTGAGGCAGCGGGG + Intergenic
1199209797 X:145194585-145194607 ATGAAGGAACTGAGGCTTGGTGG - Intergenic
1200102415 X:153694641-153694663 CTGGGGGAGGTGGGGCAGGGCGG + Intronic
1200114159 X:153762843-153762865 CTCCAGGAGGGGAGGCTTGGGGG - Intergenic
1200134274 X:153867342-153867364 CTGAGGCAGGTGAGTCAGGGTGG - Exonic
1200662705 Y:5979740-5979762 CTCAGGGAGGTAAGGATGGGAGG + Intergenic
1200787513 Y:7273659-7273681 CGGAAGATGGGGAGGCTGGGTGG - Intergenic
1200980562 Y:9259921-9259943 CTGCAGGTTCTGAGGCTGGGTGG - Intergenic
1201577776 Y:15478799-15478821 CTGATGGAGGTGAGGGTTGAGGG + Intergenic
1202588682 Y:26459184-26459206 ATGAAGGAAGTGAGGCTTGGAGG - Intergenic