ID: 1081968497

View in Genome Browser
Species Human (GRCh38)
Location 11:47183564-47183586
Sequence TGCAGGGCCCCTCGTATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 51
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 49}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081968497_1081968504 28 Left 1081968497 11:47183564-47183586 CCAGAAATACGAGGGGCCCTGCA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1081968504 11:47183615-47183637 ACATCCACTGAGGGCCCGCAAGG 0: 1
1: 0
2: 0
3: 12
4: 130
1081968497_1081968501 18 Left 1081968497 11:47183564-47183586 CCAGAAATACGAGGGGCCCTGCA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1081968501 11:47183605-47183627 CTCACTCCACACATCCACTGAGG 0: 1
1: 0
2: 0
3: 22
4: 219
1081968497_1081968502 19 Left 1081968497 11:47183564-47183586 CCAGAAATACGAGGGGCCCTGCA 0: 1
1: 0
2: 0
3: 1
4: 49
Right 1081968502 11:47183606-47183628 TCACTCCACACATCCACTGAGGG 0: 1
1: 0
2: 0
3: 19
4: 240

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081968497 Original CRISPR TGCAGGGCCCCTCGTATTTC TGG (reversed) Intronic
901758511 1:11455853-11455875 TCCAGGGCCCCTGATATTTAAGG - Intergenic
904037112 1:27564893-27564915 TCTAGGGCCCCTCGTTTTACAGG + Intronic
904889293 1:33766308-33766330 AGCAGGGCCTCTCATCTTTCGGG + Intronic
907900881 1:58740703-58740725 AGCAAGGCCCTTCCTATTTCTGG - Intergenic
1070741932 10:78908926-78908948 TTCGGGGGCCCTCGTTTTTCAGG + Intergenic
1074383183 10:112996636-112996658 TGGAGGGCACCTGGGATTTCCGG + Intronic
1076303951 10:129450152-129450174 TACAGGGCCCCTCTTACTGCAGG - Intergenic
1081968497 11:47183564-47183586 TGCAGGGCCCCTCGTATTTCTGG - Intronic
1085269744 11:75263213-75263235 TGCAGGGCCCCTTTCCTTTCTGG - Intergenic
1091407732 12:219850-219872 AGCCGGGCCCCACATATTTCTGG - Intergenic
1097269655 12:57766174-57766196 TGCAGGGCGCCGCGCACTTCGGG - Exonic
1107029075 13:35832555-35832577 TGCAGAGCACCTCCTAGTTCAGG - Intronic
1119840495 14:77789186-77789208 TGCAAGACCCCTCCTCTTTCAGG + Intergenic
1125796667 15:42408807-42408829 TCCAGGGCCCCTCTTCTATCCGG + Intronic
1125796681 15:42408844-42408866 TCCAGGGCCCCTCTTCTGTCTGG + Intronic
1127607071 15:60597222-60597244 TGCAGGGCTTCTGGGATTTCTGG + Intronic
1135113192 16:19706606-19706628 GGCAGGGCAGCTCATATTTCGGG - Exonic
1138505560 16:57476647-57476669 AGCAGGGCCCCTTACATTTCAGG - Intronic
1143705605 17:8695996-8696018 AGCAGGGCCCCTGGTCATTCAGG + Intergenic
1144662775 17:17081962-17081984 GGCTGGGCCCCTGGTTTTTCAGG + Intronic
1151313684 17:73309701-73309723 TGCAGGGACCCTAGGACTTCAGG + Intronic
1152729520 17:81962616-81962638 TCCAGAGCCCCTCCTAATTCAGG + Intergenic
926290281 2:11523676-11523698 TGCAGGTCCTCCCGTCTTTCTGG - Intergenic
940344108 2:152611783-152611805 TGCAGGGCTCCTGGGATCTCAGG + Intronic
942189469 2:173456194-173456216 TGCAGGGCACCTGATATTTGGGG + Intergenic
946402426 2:219475656-219475678 TTCAGGGCTCCTCCTATATCTGG - Intronic
948225430 2:236306051-236306073 TCCAGGGCCCCTAGGATTGCAGG - Intergenic
1171356165 20:24547152-24547174 AGCAGGGCCCCTCGTTTCCCTGG + Intronic
1174041160 20:47700590-47700612 TGCAGGGCAACTCCCATTTCCGG + Intronic
1175601761 20:60279949-60279971 TGCAGGGTCACTCTCATTTCTGG - Intergenic
1184803167 22:46774732-46774754 TTCGGGGCCCCTGATATTTCTGG + Intronic
950503139 3:13377029-13377051 TGCAGGGTTCCAGGTATTTCTGG + Intronic
953469621 3:43155666-43155688 TACAGGGCTGCCCGTATTTCAGG - Intergenic
961559305 3:127717740-127717762 TGCAGGGCCCCTCCTTTCTCTGG - Intronic
961739067 3:129021088-129021110 GGCAGGGCCCCTCATGTGTCAGG - Intronic
966465294 3:180225103-180225125 TGCCTGCCCCCTTGTATTTCAGG + Intergenic
967194807 3:187017043-187017065 TCCAGGGCCCCAGGAATTTCAGG - Intronic
973177870 4:47230347-47230369 TACAAGGTCCCACGTATTTCTGG + Intronic
978690866 4:111507615-111507637 TGAAGGCCCCCTCCTACTTCTGG - Intergenic
980419049 4:132535878-132535900 TGCAGGGCCTGTAGTATTTTGGG + Intergenic
987610488 5:20197302-20197324 TGCAGAGCCTCTCATTTTTCTGG + Intronic
992487345 5:77210088-77210110 TGTAGGGCCCCTGCCATTTCGGG + Intergenic
996346098 5:122490255-122490277 TGCATGGAGCCTCATATTTCTGG + Intergenic
1018171695 6:161148415-161148437 TGTAGGGCCCCTGGATTTTCAGG + Intronic
1026907424 7:74070584-74070606 TCCCGGGCCCCACGGATTTCTGG - Intergenic
1032056356 7:128687773-128687795 TGCAAAGCCCCTTGTATTGCTGG + Intergenic
1041097195 8:54361712-54361734 TGCAGGGCCCCCAGTGTTTGGGG - Intergenic
1046756367 8:117976936-117976958 TTCAGGGCCCCTCTCCTTTCAGG - Intronic
1057281991 9:93719983-93720005 AGGAGGGCCCCCTGTATTTCAGG - Intergenic
1185971805 X:4672896-4672918 TGCTGGCCCCCTTGTATTTGGGG - Intergenic
1192589068 X:72344961-72344983 TGCAGGCTCCCTTGAATTTCAGG - Intronic