ID: 1081968817

View in Genome Browser
Species Human (GRCh38)
Location 11:47185167-47185189
Sequence TCGGCTCCGAGAGGTCTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 90
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 83}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081968810_1081968817 -1 Left 1081968810 11:47185145-47185167 CCAGCCCCGGGAGCCAGCACGTT 0: 1
1: 0
2: 0
3: 8
4: 109
Right 1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1081968814_1081968817 -7 Left 1081968814 11:47185151-47185173 CCGGGAGCCAGCACGTTCGGCTC 0: 1
1: 0
2: 0
3: 4
4: 82
Right 1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1081968809_1081968817 0 Left 1081968809 11:47185144-47185166 CCCAGCCCCGGGAGCCAGCACGT 0: 1
1: 0
2: 2
3: 7
4: 160
Right 1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1081968813_1081968817 -6 Left 1081968813 11:47185150-47185172 CCCGGGAGCCAGCACGTTCGGCT 0: 1
1: 0
2: 1
3: 3
4: 61
Right 1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 83
1081968812_1081968817 -5 Left 1081968812 11:47185149-47185171 CCCCGGGAGCCAGCACGTTCGGC 0: 1
1: 0
2: 0
3: 0
4: 58
Right 1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG 0: 1
1: 0
2: 0
3: 6
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081968817 Original CRISPR TCGGCTCCGAGAGGTCTTCC TGG Intronic
900727016 1:4223219-4223241 TAAGCTCAGAGAGGGCTTCCAGG + Intergenic
901404463 1:9037168-9037190 GTGGCCCCGACAGGTCTTCCGGG - Exonic
901680221 1:10908767-10908789 TCTCCTCCGAGAAGTCCTCCTGG + Intergenic
901784795 1:11617400-11617422 TCGGAGCTGAGAGCTCTTCCTGG - Intergenic
911163220 1:94702367-94702389 TCAGCTCCTAGGGGTCTTGCAGG - Intergenic
911417338 1:97591170-97591192 TCTCATCGGAGAGGTCTTCCAGG + Intronic
912818714 1:112850150-112850172 CCGGCTCCCAGGCGTCTTCCCGG - Intergenic
914833714 1:151190074-151190096 CCGGTTCCCAGCGGTCTTCCGGG + Exonic
916383027 1:164234318-164234340 TCTGCTCCCAGAGGTCATCCAGG + Intergenic
923009249 1:230075055-230075077 TCTGCTCCAAGATGCCTTCCAGG - Intronic
1062812068 10:474484-474506 GGGGCTCCAAGAGGACTTCCAGG - Intronic
1063388902 10:5635797-5635819 TGGGCTCCCCGTGGTCTTCCAGG - Intergenic
1065184729 10:23160737-23160759 TCTGCTCCGTGTGGTCATCCAGG + Intergenic
1075654001 10:124149286-124149308 TCGGCTCGGAGAGGGCTCCAGGG - Intergenic
1081968817 11:47185167-47185189 TCGGCTCCGAGAGGTCTTCCTGG + Intronic
1084193261 11:67508484-67508506 TTCGCGCCGAGGGGTCTTCCCGG + Exonic
1089353125 11:117832598-117832620 CTTGCTCCGCGAGGTCTTCCCGG - Intronic
1089733591 11:120534802-120534824 TCTGCTCCCAGGGGTTTTCCTGG - Intronic
1090733831 11:129594162-129594184 TAGGCTCTGAGAAGTCTTGCAGG - Intergenic
1091616051 12:2052472-2052494 TCCGCTCACAGAGGCCTTCCCGG + Intronic
1091755618 12:3049546-3049568 TCGCCTCAGAGAGGCCTTCAAGG - Intergenic
1091823330 12:3492050-3492072 TGGGCTCCGTGAGGGCTCCCGGG + Intronic
1094644042 12:32303710-32303732 TCTGCTCCATGAGGTCATCCAGG - Intronic
1097288497 12:57895520-57895542 TGGGCCCTGAGAGGTCCTCCTGG - Intergenic
1100830892 12:98515879-98515901 TCAGGACCGAGGGGTCTTCCAGG - Exonic
1103060614 12:117855533-117855555 TCATCTCCAAGAGGTCCTCCAGG + Exonic
1104618458 12:130290894-130290916 TCGGCCTCCAGAGGTCGTCCTGG + Intergenic
1107467432 13:40664387-40664409 TCGGCTCCGGGGAGGCTTCCCGG - Intronic
1107634263 13:42376622-42376644 TCTGCTCCATGAGGTCCTCCAGG - Intergenic
1119057620 14:71439105-71439127 TCCTCTCCATGAGGTCTTCCTGG - Intronic
1121541012 14:94726623-94726645 TTGGCTCCCAGAAGTCTGCCTGG - Intergenic
1123047898 14:105527381-105527403 TGGGCCCAGAGAGGGCTTCCTGG + Intronic
1123701015 15:22914826-22914848 GTGGTTCCGAGAGTTCTTCCTGG - Exonic
1132214665 15:100053838-100053860 GTGGCTCCGAGAGGTCTACTAGG - Intronic
1132605301 16:791213-791235 TTGGCCACGAGAGGCCTTCCCGG + Exonic
1135381677 16:22001069-22001091 TCTGCTCCGGGAGGCCCTCCCGG - Exonic
1141751618 16:85962116-85962138 ACGGCTCAGAGATGTCCTCCAGG + Intergenic
1142131898 16:88434964-88434986 TCGGCTCCGCGGGGGCTCCCGGG - Exonic
1142593724 17:1019518-1019540 TCCGCTCAGAGAGGCCTGCCTGG + Intronic
1150008140 17:61482417-61482439 TTGGCTCCCTGAGGTCTTCCTGG + Intronic
1152330694 17:79670998-79671020 TTGGCTCCAGGAGGTCCTCCTGG + Intergenic
1152918036 17:83051993-83052015 GCGGCTCCGAGAGGTGACCCGGG - Intergenic
1161147653 19:2688647-2688669 TCGTCTCCGGGGGTTCTTCCAGG - Intronic
1161316426 19:3619630-3619652 TCTGCCCCGAGTGGTCTGCCTGG - Intronic
1162006497 19:7783779-7783801 GAGGATCCGAGAGGGCTTCCTGG - Intergenic
1162769297 19:12939258-12939280 TCAGATCCGGGAGGACTTCCTGG + Intronic
1163329433 19:16627503-16627525 CCCGCTCCGGGAGGGCTTCCCGG + Intronic
1163653089 19:18530166-18530188 TCCCCTGGGAGAGGTCTTCCTGG + Intergenic
1164987914 19:32662432-32662454 TCAGCTTCAAGAGGTCTTACAGG + Intronic
1165162513 19:33826037-33826059 GCGGCTCAGCGAGGCCTTCCTGG - Intergenic
1165706816 19:37982298-37982320 TTGGCTCCCAGAGGCCTTCCTGG + Intronic
1167035861 19:46994629-46994651 CCGGCTCCTCGAGGCCTTCCTGG - Intronic
927436638 2:23072120-23072142 TACGCTCCCAGAGGCCTTCCTGG + Intergenic
927640430 2:24842151-24842173 TGGGCTTCAAGAGGTTTTCCAGG - Intronic
930728820 2:54708963-54708985 CAGGCTCCGAGGGGTCTCCCAGG - Intergenic
936913280 2:117614451-117614473 TCTGATCCAAGAGGGCTTCCAGG + Intergenic
937208677 2:120253153-120253175 TCCGCTCCGGGAGGACTCCCTGG + Intronic
941044378 2:160655909-160655931 TCCTCTCCAGGAGGTCTTCCAGG + Intergenic
944692615 2:202171470-202171492 TCTGCTGCGCGAGGTCGTCCCGG + Intronic
1170321452 20:15103761-15103783 TCTGATCAGAGAGGGCTTCCAGG - Intronic
1172837863 20:37884640-37884662 CCTCCTCAGAGAGGTCTTCCAGG - Intergenic
1182923413 22:34101067-34101089 CCAGCTCAGAGAAGTCTTCCTGG - Intergenic
950670936 3:14525054-14525076 TCGGGTCAGGGAGGGCTTCCTGG + Intronic
954390963 3:50267735-50267757 TCAGGTTCTAGAGGTCTTCCAGG - Intronic
958120769 3:89285265-89285287 TGGGCTCAGAGAAGTCTTCCTGG + Intronic
968061518 3:195729691-195729713 TGGGGTCAGTGAGGTCTTCCGGG - Exonic
968598183 4:1496043-1496065 TGGGCTGCGTGAGGTCTTCCAGG + Intergenic
969491316 4:7500724-7500746 TCAGCTCAGAGAGGTCCTCTTGG - Intronic
978166862 4:105619751-105619773 TTGGCTCAGAGAGGCCTTCTCGG - Intronic
978833347 4:113116363-113116385 TGGGCTCAGCGAGGTTTTCCTGG - Intronic
986707440 5:10463544-10463566 TGGGGTCCCTGAGGTCTTCCCGG + Intronic
991198342 5:63961167-63961189 CGGGGTCCGAGCGGTCTTCCGGG + Exonic
1005409013 6:25522591-25522613 GGGCCTCTGAGAGGTCTTCCTGG - Intronic
1012341879 6:98136605-98136627 TAGGCTCTAAGAGGTCTTACAGG + Intergenic
1014495805 6:122120622-122120644 TCTGCTCCAATAGGTCTTTCAGG - Intergenic
1017759436 6:157556689-157556711 TCGGCTCTGAGCTGTCTCCCTGG - Intronic
1019963869 7:4483506-4483528 TGGGCTCTGAGAGGTGTCCCAGG - Intergenic
1024524637 7:50337440-50337462 TCCACACAGAGAGGTCTTCCTGG + Intronic
1024942540 7:54777439-54777461 TCTCCTCAAAGAGGTCTTCCCGG + Intergenic
1034131830 7:148725629-148725651 TCTGCTCCGAGAGCCCTGCCTGG + Intronic
1034781475 7:153886460-153886482 TGGGCTGCGGGAGGTCTTCGGGG + Intergenic
1037625354 8:20601650-20601672 TAGGCTCAGAGATGTATTCCTGG + Intergenic
1038032366 8:23653663-23653685 TCTGCTCTGGTAGGTCTTCCAGG + Intergenic
1039964137 8:42271537-42271559 GCGGCACAGAGGGGTCTTCCGGG - Intronic
1055315311 9:75028397-75028419 TGGGCTCCGCCAGGTCTTCAGGG + Intronic
1058840424 9:108902245-108902267 CTGCCTCCGAGAGGCCTTCCTGG + Intronic
1060389751 9:123268093-123268115 GCGGTGCCGGGAGGTCTTCCGGG - Intronic
1061909019 9:133713059-133713081 TGAGCTCCGAGGGTTCTTCCTGG - Exonic
1186091334 X:6052044-6052066 TCAGCTCCTAGAGGTCCCCCAGG - Intronic
1197774184 X:130109523-130109545 TCGGCTCAGCGAGGTCCTCCTGG - Intronic