ID: 1081970420

View in Genome Browser
Species Human (GRCh38)
Location 11:47194492-47194514
Sequence CGAAGAAAGCAGGCCAGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081970410_1081970420 21 Left 1081970410 11:47194448-47194470 CCCATTGTGTGACCAACACCAGG No data
Right 1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG No data
1081970415_1081970420 9 Left 1081970415 11:47194460-47194482 CCAACACCAGGCTGGGTGCTCAG No data
Right 1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG No data
1081970412_1081970420 20 Left 1081970412 11:47194449-47194471 CCATTGTGTGACCAACACCAGGC No data
Right 1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG No data
1081970416_1081970420 3 Left 1081970416 11:47194466-47194488 CCAGGCTGGGTGCTCAGTCCTTA No data
Right 1081970420 11:47194492-47194514 CGAAGAAAGCAGGCCAGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081970420 Original CRISPR CGAAGAAAGCAGGCCAGGTG CGG Intergenic
No off target data available for this crispr