ID: 1081970914

View in Genome Browser
Species Human (GRCh38)
Location 11:47198123-47198145
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081970911_1081970914 -2 Left 1081970911 11:47198102-47198124 CCATTTGGGCATGGGTTCTCAGT No data
Right 1081970914 11:47198123-47198145 GTCTCTTCCTGGTTTAGGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081970914 Original CRISPR GTCTCTTCCTGGTTTAGGTA AGG Intergenic
No off target data available for this crispr