ID: 1081970918

View in Genome Browser
Species Human (GRCh38)
Location 11:47198153-47198175
Sequence GAGGTCATAAAATTTCCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081970918_1081970921 -7 Left 1081970918 11:47198153-47198175 CCTATGGGAAATTTTATGACCTC No data
Right 1081970921 11:47198169-47198191 TGACCTCTTTTAGGTAGAAAGGG No data
1081970918_1081970923 -2 Left 1081970918 11:47198153-47198175 CCTATGGGAAATTTTATGACCTC No data
Right 1081970923 11:47198174-47198196 TCTTTTAGGTAGAAAGGGAGAGG No data
1081970918_1081970920 -8 Left 1081970918 11:47198153-47198175 CCTATGGGAAATTTTATGACCTC No data
Right 1081970920 11:47198168-47198190 ATGACCTCTTTTAGGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081970918 Original CRISPR GAGGTCATAAAATTTCCCAT AGG (reversed) Intergenic
No off target data available for this crispr