ID: 1081976939

View in Genome Browser
Species Human (GRCh38)
Location 11:47241431-47241453
Sequence CACTTACACCCGGGAGGCGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 146901
Summary {0: 4, 1: 117, 2: 5642, 3: 38167, 4: 102971}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081976933_1081976939 8 Left 1081976933 11:47241400-47241422 CCAGCTACTCGGGAGGCTGAGGC 0: 94911
1: 257638
2: 218586
3: 135882
4: 139272
Right 1081976939 11:47241431-47241453 CACTTACACCCGGGAGGCGGAGG 0: 4
1: 117
2: 5642
3: 38167
4: 102971
1081976931_1081976939 9 Left 1081976931 11:47241399-47241421 CCCAGCTACTCGGGAGGCTGAGG 0: 99957
1: 284367
2: 226920
3: 125442
4: 164576
Right 1081976939 11:47241431-47241453 CACTTACACCCGGGAGGCGGAGG 0: 4
1: 117
2: 5642
3: 38167
4: 102971
1081976929_1081976939 17 Left 1081976929 11:47241391-47241413 CCTGTAATCCCAGCTACTCGGGA 0: 44204
1: 206428
2: 253404
3: 185491
4: 423321
Right 1081976939 11:47241431-47241453 CACTTACACCCGGGAGGCGGAGG 0: 4
1: 117
2: 5642
3: 38167
4: 102971

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081976939 Original CRISPR CACTTACACCCGGGAGGCGG AGG Intronic
Too many off-targets to display for this crispr