ID: 1081978771

View in Genome Browser
Species Human (GRCh38)
Location 11:47253254-47253276
Sequence AGGTATAAGACTGGGTGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1461
Summary {0: 1, 1: 0, 2: 17, 3: 201, 4: 1242}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081978771 Original CRISPR AGGTATAAGACTGGGTGTGG TGG (reversed) Intronic
900133418 1:1101782-1101804 AGTTTTAGGGCTGGGTGTGGTGG + Intronic
900673332 1:3869346-3869368 AGATAACAGGCTGGGTGTGGTGG - Intronic
900758929 1:4457398-4457420 AGGTTTAAGGCTGGGTGTGGTGG + Intergenic
901087287 1:6618932-6618954 AGGCATTAGGCTGGGTGCGGGGG - Intronic
901619989 1:10577027-10577049 AGCAATTAGGCTGGGTGTGGTGG - Intronic
901700098 1:11040725-11040747 AGGTAGAAGACTGGGTGGATGGG + Intronic
901713665 1:11135845-11135867 AGAAAAAAGGCTGGGTGTGGTGG + Intronic
901807819 1:11749142-11749164 AGGTGTAAGGCTGGGTGAGTGGG - Intronic
902293274 1:15448776-15448798 GGGAATGAGACCGGGTGTGGTGG - Intronic
902450440 1:16493477-16493499 TGATACTAGACTGGGTGTGGTGG + Intergenic
902859321 1:19233503-19233525 AGGTATGAGTGTGGGGGTGGAGG + Intronic
902863752 1:19263932-19263954 AAGAAATAGACTGGGTGTGGTGG + Intergenic
903277894 1:22233241-22233263 AGGGCCAAGGCTGGGTGTGGGGG + Intergenic
903386027 1:22927266-22927288 ATGAATTAGGCTGGGTGTGGTGG - Intergenic
903413097 1:23162952-23162974 AAGAATAAGGCTGGGTGCGGTGG + Intronic
903430488 1:23294374-23294396 AGGCATTAGGCTGGGTGCGGTGG - Intergenic
903549669 1:24149232-24149254 AAGTTTGAGTCTGGGTGTGGTGG + Intergenic
903793237 1:25908762-25908784 AAGGATCAGACTGGGTGTGGTGG - Intergenic
903843917 1:26265404-26265426 ATGTATATGGCCGGGTGTGGTGG - Intronic
903893337 1:26585326-26585348 AGTTACTAGGCTGGGTGTGGTGG + Intergenic
904020175 1:27457908-27457930 AAATATTAGGCTGGGTGTGGTGG - Intronic
904465072 1:30702712-30702734 AGGTGTAAGGATGGCTGTGGAGG - Intergenic
904519927 1:31087123-31087145 AGGAATCAGACCAGGTGTGGTGG + Intergenic
904683241 1:32243137-32243159 AGGAATAGGGCTGGGTGCGGTGG + Intergenic
904707391 1:32401635-32401657 AGTTATAGAGCTGGGTGTGGTGG + Intergenic
904841170 1:33372867-33372889 AGGGAAAAGAATGGGGGTGGAGG + Intronic
904892420 1:33789273-33789295 GGGTTTAAGCATGGGTGTGGGGG + Intronic
905055562 1:35090657-35090679 ACTTATTTGACTGGGTGTGGTGG + Intronic
905082501 1:35336690-35336712 AGGTAATTGGCTGGGTGTGGTGG - Intronic
905192657 1:36247611-36247633 ATTTTTAAGGCTGGGTGTGGTGG - Intronic
905696789 1:39980574-39980596 AGGTTTAGGACTGGGTGTGTTGG + Intergenic
905702301 1:40026661-40026683 ATTTATAAGACTGGGTGCAGTGG + Intergenic
906058129 1:42931536-42931558 AGGTACAAGACCAGGTGTGGTGG + Intronic
906113960 1:43343339-43343361 AAATATTAGGCTGGGTGTGGTGG - Intronic
906312644 1:44764794-44764816 AGATATACGACTGGGCGTGGTGG - Intronic
906321054 1:44815860-44815882 AGGAAATAGGCTGGGTGTGGTGG - Intergenic
906495275 1:46301281-46301303 AGGAAGATGACTGGGTGCGGAGG - Intronic
906630105 1:47359797-47359819 AGGTTTCAGGCTGGGTGTGGTGG - Intronic
906800217 1:48730513-48730535 AGGCAGGAGAGTGGGTGTGGTGG + Intronic
907036830 1:51223455-51223477 ATGAAGAACACTGGGTGTGGTGG + Intergenic
907128591 1:52074647-52074669 GGGTATGGGGCTGGGTGTGGTGG - Intronic
907452443 1:54554633-54554655 TGGTATAAAGCTGGGTGTGGTGG - Intronic
908208776 1:61878554-61878576 AAGTTTTAGGCTGGGTGTGGTGG + Intronic
908242800 1:62202011-62202033 AGGGATGAGGCTGGGTGAGGTGG + Intronic
908274568 1:62456782-62456804 GGGTATAAGACTGGGAGAGGGGG + Intronic
908377242 1:63556023-63556045 ACATATAAGGCTGGATGTGGTGG - Intronic
908401481 1:63775511-63775533 AGGTTTAGGGCTGGGAGTGGGGG - Intronic
908631556 1:66114921-66114943 TTTTATATGACTGGGTGTGGTGG - Intronic
908731589 1:67231730-67231752 TTGAATAAGGCTGGGTGTGGTGG + Intronic
909321949 1:74301110-74301132 AAGGGTAAGGCTGGGTGTGGTGG + Intronic
909814077 1:79968819-79968841 AATAATAAGACTGGGAGTGGTGG - Intergenic
910188080 1:84566915-84566937 AAAGATAAGGCTGGGTGTGGTGG - Intronic
910306118 1:85766076-85766098 ATGAATAGGACTGGGTGCGGTGG + Intronic
910894120 1:92049809-92049831 TGGTATAAGACCAGGCGTGGTGG + Intronic
911104700 1:94120679-94120701 AGGTGTAAAACGGGGGGTGGGGG + Intronic
911436103 1:97859921-97859943 AAATATTAGGCTGGGTGTGGTGG + Intronic
911607015 1:99918609-99918631 AGGCAAATGGCTGGGTGTGGTGG - Intronic
911611335 1:99961778-99961800 AAGAATTAGGCTGGGTGTGGTGG + Intergenic
912349794 1:109001005-109001027 ATACATAAGACCGGGTGTGGTGG + Intronic
912639306 1:111329839-111329861 GGGATTATGACTGGGTGTGGTGG - Intergenic
913015195 1:114725920-114725942 AGGGGTCTGACTGGGTGTGGTGG - Intronic
913265780 1:117042381-117042403 AGTGTTAAGGCTGGGTGTGGTGG - Intergenic
913280274 1:117178875-117178897 ATTCATAAGGCTGGGTGTGGTGG - Intronic
913303417 1:117397937-117397959 AGTTGTAAGGCCGGGTGTGGTGG - Intronic
913459243 1:119066188-119066210 AGCTACAAGGCTGGGTGCGGTGG + Intronic
913460677 1:119082939-119082961 AGGCTTCAGGCTGGGTGTGGTGG + Intronic
914399125 1:147299747-147299769 AGGGATCAGGCTGGGTGTGGTGG + Intergenic
914404167 1:147354362-147354384 AGGTAACAGGCTGGGTGAGGTGG + Intergenic
915157348 1:153889167-153889189 ATGTATCAGGCCGGGTGTGGTGG + Intronic
915472317 1:156133283-156133305 AAGCATACGGCTGGGTGTGGTGG + Intronic
915493822 1:156267059-156267081 AGGGATAGGACTGGATGTGAAGG - Intronic
916101353 1:161395834-161395856 AAATTTAAGGCTGGGTGTGGTGG + Intergenic
916162847 1:161936737-161936759 AGGGATTAGAGTGGGTTTGGAGG - Intronic
916952715 1:169796944-169796966 AAGTGTAAGACTGCGTTTGGGGG - Intronic
917591809 1:176483754-176483776 ATGTCTGAGGCTGGGTGTGGTGG - Intronic
917895076 1:179479488-179479510 AGGAAAAAGGCTGGGTGTGGTGG + Intronic
918187526 1:182141544-182141566 AGAAAAAAGGCTGGGTGTGGTGG - Intergenic
918323290 1:183384902-183384924 TGGAATAGGATTGGGTGTGGTGG + Intronic
918615887 1:186542874-186542896 AAATATATGACTGGGTGCGGTGG - Intergenic
918830343 1:189387850-189387872 AAGAGTAAGGCTGGGTGTGGTGG - Intergenic
918830359 1:189387956-189387978 AAGAGTAAGGCTGGGTGTGGTGG - Intergenic
919049427 1:192494939-192494961 AGCTACAAGACTGGGTGTGGTGG - Intergenic
919891837 1:201981273-201981295 AGATTTTAGGCTGGGTGTGGTGG - Intergenic
920003906 1:202818632-202818654 AGAAAGAAGGCTGGGTGTGGTGG + Intergenic
920144411 1:203845987-203846009 AGATTTCAGACTGGGTATGGTGG + Intronic
920161344 1:204000460-204000482 GTGAAGAAGACTGGGTGTGGTGG + Intergenic
920331052 1:205208584-205208606 AAGTTGAGGACTGGGTGTGGTGG + Intronic
920762846 1:208802345-208802367 AGGCATGGGGCTGGGTGTGGTGG - Intergenic
920852344 1:209636646-209636668 AGGTATATGACTGGGGTTGGGGG - Intronic
921025011 1:211270348-211270370 AGATAAAAGTCTGGGTGTGGTGG - Intronic
921135137 1:212253299-212253321 AGTTAAAGGGCTGGGTGTGGTGG + Intergenic
921240659 1:213178250-213178272 AGGAAAAATGCTGGGTGTGGTGG + Intronic
921484294 1:215697806-215697828 AAATAAAAGCCTGGGTGTGGTGG - Intronic
921585992 1:216946982-216947004 AGAAATCAGGCTGGGTGTGGTGG - Intronic
921682118 1:218045960-218045982 AGATACCAGGCTGGGTGTGGTGG - Intergenic
921733493 1:218600068-218600090 AAATATGAGGCTGGGTGTGGTGG + Intergenic
922038358 1:221871702-221871724 AATTATTGGACTGGGTGTGGTGG - Intergenic
922278170 1:224098625-224098647 AGGTTCTAGGCTGGGTGTGGTGG - Intergenic
922357935 1:224794648-224794670 AGGAAGAAGTCTGGGTGTGGTGG + Intergenic
922479316 1:225928047-225928069 AGGTAACAGGCTGGGTGCGGTGG - Intergenic
922564429 1:226592334-226592356 AGGAAAAAGGCTGGGCGTGGTGG - Intronic
922594597 1:226804052-226804074 AAATATAAGGCTGGGTGCGGTGG + Intergenic
922628917 1:227084238-227084260 ATGAAAAAGGCTGGGTGTGGTGG + Intronic
923248527 1:232157545-232157567 AGGACTAAGGCTGGGTGCGGTGG - Intergenic
923541440 1:234891066-234891088 AGATATAGGAGTGGGTCTGGAGG - Intergenic
924042848 1:240000410-240000432 TGCTATCAGGCTGGGTGTGGTGG + Intergenic
924057856 1:240141655-240141677 AAGTATATGGCTGGGCGTGGTGG - Intronic
924195971 1:241607225-241607247 TGGTATAAGGCTGGGCGTGGTGG + Intronic
924227034 1:241930576-241930598 AGGAATGAGGCTGGGCGTGGTGG + Intergenic
924308382 1:242715204-242715226 ATGTATTTGGCTGGGTGTGGTGG + Intergenic
924484563 1:244468377-244468399 ACCAATAAGGCTGGGTGTGGTGG - Intronic
924545323 1:245020915-245020937 CAGTATAAGGCTGGGTGTGGTGG - Intronic
924665267 1:246064527-246064549 AGGTATTAGACTGGGAGACGGGG - Intronic
924725377 1:246664711-246664733 AGTGTTAAGGCTGGGTGTGGTGG - Intronic
924726203 1:246673543-246673565 AACTACAAGGCTGGGTGTGGTGG + Intergenic
924757851 1:246957879-246957901 AAATACAAGGCTGGGTGTGGTGG - Intronic
924802718 1:247339167-247339189 AAGTATCTGGCTGGGTGTGGTGG + Intergenic
1062909579 10:1204122-1204144 AGGTGTGAGACAGGGTTTGGAGG - Intronic
1063679808 10:8175986-8176008 AAGGAAAAGGCTGGGTGTGGTGG - Intergenic
1063746547 10:8890435-8890457 AGGTAATGGGCTGGGTGTGGTGG + Intergenic
1064059524 10:12126329-12126351 AAAAATTAGACTGGGTGTGGTGG - Intergenic
1064172932 10:13050124-13050146 AGGTATTAACCTGGGTGTGAGGG + Intronic
1064287447 10:14004253-14004275 AAATACAAGACTGGGTGCGGTGG + Intronic
1064389697 10:14931271-14931293 ACGAATGAGGCTGGGTGTGGTGG + Intronic
1064428724 10:15253289-15253311 TGGTTTAAGGCTGGGTGCGGTGG - Intronic
1064690593 10:17913628-17913650 AAGAAAAAGGCTGGGTGTGGTGG + Intergenic
1064697873 10:17986717-17986739 ACTTATAAGACTGGGTGCTGTGG + Intronic
1065005582 10:21377050-21377072 AGATCCCAGACTGGGTGTGGTGG + Intergenic
1065069838 10:22011877-22011899 AGGTAGAAGGCTGGGTGCGGTGG - Intergenic
1065245832 10:23756248-23756270 AGGACTCAGGCTGGGTGTGGTGG - Intronic
1065675234 10:28166692-28166714 AAAGATAAGGCTGGGTGTGGTGG - Intronic
1065707924 10:28488297-28488319 AGGTGTAAGACTGGGAGAGCTGG + Intergenic
1065715566 10:28563987-28564009 AAGAAAAAGGCTGGGTGTGGTGG + Intronic
1065830914 10:29612888-29612910 AGGGATGAGGCTGGGCGTGGTGG + Intronic
1065868852 10:29938289-29938311 TGCTATCAGGCTGGGTGTGGTGG - Intergenic
1065875443 10:29993639-29993661 AGCTTTGAGACTGGCTGTGGCGG + Intergenic
1066290527 10:34010498-34010520 AAGTTTAGGGCTGGGTGTGGTGG + Intergenic
1066382946 10:34917242-34917264 AGGGAAAGGACTGGGTGCGGTGG + Intergenic
1066389605 10:34968133-34968155 AGGTTTGAGGCTGGGAGTGGTGG - Intergenic
1067108445 10:43381430-43381452 AAGTGTTAGGCTGGGTGTGGTGG + Intergenic
1067413600 10:46086447-46086469 GGGCAGAAGGCTGGGTGTGGTGG - Intergenic
1067489404 10:46684277-46684299 ACGTTTTAGGCTGGGTGTGGTGG - Intergenic
1067605265 10:47656107-47656129 ACGTTTTAGGCTGGGTGTGGTGG + Intergenic
1067977663 10:51044152-51044174 AGATATAAGAGTGAGTGTGTTGG - Intronic
1067983536 10:51115550-51115572 AAGAAGAAGGCTGGGTGTGGTGG + Intronic
1068081604 10:52325009-52325031 TGAAAAAAGACTGGGTGTGGTGG - Intergenic
1068672854 10:59741669-59741691 AGGAAATAGGCTGGGTGTGGTGG - Intergenic
1068717677 10:60206183-60206205 ATGTCTCAGGCTGGGTGTGGTGG + Intronic
1069034591 10:63633282-63633304 AGAAATACGACTGGGCGTGGTGG - Intergenic
1069177094 10:65305023-65305045 AAATGTAAGGCTGGGTGTGGTGG - Intergenic
1069332096 10:67304987-67305009 AGGTATTAGGCTGGGTGCGGTGG + Intronic
1069611731 10:69777481-69777503 AGATAACAGGCTGGGTGTGGTGG + Intergenic
1069670985 10:70203693-70203715 AGTTTGAAGGCTGGGTGTGGTGG - Intronic
1069671542 10:70209079-70209101 AGATACAAGGCTGGGTGCGGTGG - Intronic
1070099369 10:73370265-73370287 AGATATAAGGCCAGGTGTGGTGG + Intergenic
1070125671 10:73619600-73619622 ACATATTAGGCTGGGTGTGGTGG - Intronic
1070197680 10:74174013-74174035 AGTTTAAAGGCTGGGTGTGGTGG + Intronic
1070200925 10:74205386-74205408 AATTAGAAGACTGGGCGTGGTGG + Intronic
1070434562 10:76377170-76377192 AGACATACGGCTGGGTGTGGTGG - Intronic
1070738517 10:78884902-78884924 AGGGATGAGGCTGGGTGTGGTGG + Intergenic
1071119305 10:82259638-82259660 ATGAATTAGGCTGGGTGTGGTGG + Intronic
1071801449 10:89066565-89066587 AAGTCAAAAACTGGGTGTGGGGG - Intergenic
1072062137 10:91823613-91823635 AAGTTTTGGACTGGGTGTGGTGG - Intronic
1072122654 10:92418154-92418176 AGATAACAGGCTGGGTGTGGTGG - Intergenic
1072185305 10:93032121-93032143 AGATTGCAGACTGGGTGTGGTGG + Intronic
1072228110 10:93388512-93388534 GGGTAAAAGACTGGCTGTGGAGG - Intronic
1072233288 10:93431318-93431340 AGGTCTAAGGCCGGGCGTGGTGG - Intronic
1072298875 10:94039671-94039693 AGAAATCAGGCTGGGTGTGGTGG - Intronic
1072351426 10:94561213-94561235 AGGTATGGGTGTGGGTGTGGGGG - Intronic
1072444184 10:95483931-95483953 AGGTATCAGGCTGGGCGTGGTGG + Intronic
1072680552 10:97503201-97503223 ATTTTTAAGGCTGGGTGTGGCGG - Intronic
1072698953 10:97626045-97626067 AGGCATGAGGCTGGGTGTGGTGG - Intronic
1072702437 10:97652586-97652608 ATCTTTAAGGCTGGGTGTGGTGG - Intronic
1072770159 10:98131363-98131385 TGGTATGAGGCTGGGGGTGGTGG + Intergenic
1072820115 10:98548327-98548349 AGAGATGAGACTGGGTGCGGTGG + Intronic
1073156276 10:101349527-101349549 ATGGATCTGACTGGGTGTGGTGG - Intergenic
1073259484 10:102178147-102178169 AGGGAAAAGAGTGGCTGTGGGGG + Intergenic
1073561391 10:104499887-104499909 AGGCATCAGGCTGGGTGTGGTGG + Intergenic
1073821005 10:107264250-107264272 AGGTGTAAGACTGGGATGGGTGG + Intergenic
1074316656 10:112367616-112367638 GGGTATGAGAGTGGGTGTGTGGG - Intergenic
1074369006 10:112883778-112883800 AAGTTTAAGGCTGGGTGTGGTGG - Intergenic
1074699753 10:116082763-116082785 GGGTTTGAGGCTGGGTGTGGTGG - Intronic
1074755088 10:116618530-116618552 AGGTTTCTGGCTGGGTGTGGTGG - Intergenic
1074807175 10:117065397-117065419 AAATATTAGGCTGGGTGTGGTGG + Intronic
1074878965 10:117636748-117636770 ATGTTAGAGACTGGGTGTGGTGG + Intergenic
1075305145 10:121361227-121361249 GGGTATCAGGCCGGGTGTGGTGG + Intergenic
1075760741 10:124854210-124854232 AGGAATAAGGCTGGGTGCAGTGG - Intergenic
1076397596 10:130152304-130152326 ATGTAACAGACTGGGTGTAGTGG - Intronic
1076716079 10:132364544-132364566 GGGTGTAAGTGTGGGTGTGGAGG - Intronic
1076946235 10:133652669-133652691 AGATATTTGACTGAGTGTGGTGG - Intergenic
1077234801 11:1475580-1475602 ATGAATTACACTGGGTGTGGTGG - Intronic
1078126255 11:8566879-8566901 ATGTTTAAGGCTGGGCGTGGCGG + Intronic
1078140813 11:8691742-8691764 ATGAATAAGGCTGGATGTGGTGG + Intronic
1078378836 11:10820987-10821009 AGATATGGGGCTGGGTGTGGTGG - Intronic
1078696757 11:13641623-13641645 AGAAACAAAACTGGGTGTGGTGG - Intergenic
1078697660 11:13650627-13650649 AAGGAAAAGACTGGATGTGGTGG - Intergenic
1079191945 11:18285947-18285969 GAGGATAAAACTGGGTGTGGGGG - Intronic
1079318704 11:19431908-19431930 ATTGATAAGACTGGGTGCGGTGG + Intronic
1080013751 11:27483646-27483668 AGAAATAAGGCTGGGTGTGGTGG + Intergenic
1080428999 11:32181645-32181667 AGAGATCAGGCTGGGTGTGGTGG - Intergenic
1080611545 11:33908418-33908440 AGATTTTAGACCGGGTGTGGTGG - Intergenic
1080838726 11:35964698-35964720 AGGGTTGAGCCTGGGTGTGGTGG + Intronic
1081168002 11:39830353-39830375 AAATATTAGGCTGGGTGTGGTGG + Intergenic
1081805689 11:45888985-45889007 AAGTATGACACTGGGCGTGGTGG - Intronic
1081924327 11:46811761-46811783 TGGTATTAGGCTGGGTGTGGTGG - Intronic
1081930523 11:46867746-46867768 AACTTTAAGGCTGGGTGTGGTGG - Intronic
1081978771 11:47253254-47253276 AGGTATAAGACTGGGTGTGGTGG - Intronic
1082032404 11:47614863-47614885 AAATAAAAGACTGGGTGCGGTGG - Intergenic
1082128809 11:48462512-48462534 GGCTTTTAGACTGGGTGTGGTGG + Intergenic
1082248592 11:49954877-49954899 AGCTTTTAGACTGGGTGTGGTGG - Intergenic
1082562356 11:54633491-54633513 AGCTTTTAGACTGGGTGTGGTGG + Intergenic
1082780023 11:57280022-57280044 AGGTGTGAGGCTGGGGGTGGGGG + Intergenic
1083015747 11:59452105-59452127 AAGAAACAGACTGGGTGTGGTGG - Intergenic
1083034191 11:59621307-59621329 TGGTAGAAGGCTGGGTGTGGTGG - Intergenic
1083080923 11:60092581-60092603 ACGAATAAGGCTGGGTGTGGTGG - Intronic
1083297176 11:61721106-61721128 AGGTTTTAGGCTGGGTGTGGTGG + Intronic
1083307241 11:61767536-61767558 AGACATGAGGCTGGGTGTGGTGG + Intronic
1083331789 11:61902025-61902047 AGATGTAAGGCTGGGCGTGGTGG + Intronic
1083460993 11:62811772-62811794 GGGGATGAGGCTGGGTGTGGTGG - Intronic
1083557990 11:63647478-63647500 ACTTTTAAGACTGGGTGTGGTGG - Intronic
1084018436 11:66401782-66401804 GGATATATGGCTGGGTGTGGTGG - Intergenic
1084035009 11:66504373-66504395 AGGCTTCAGGCTGGGTGTGGTGG - Intronic
1084097413 11:66920755-66920777 AGGCATGAGGCTGGGCGTGGTGG + Intronic
1084131882 11:67142361-67142383 AAAAATAAGGCTGGGTGTGGTGG + Intronic
1084391216 11:68878411-68878433 AGCTATAAGGCTGGGTGTGGTGG + Intergenic
1084511449 11:69607091-69607113 AGACACTAGACTGGGTGTGGTGG - Intergenic
1084651924 11:70494579-70494601 AAGTGTATGGCTGGGTGTGGTGG - Intronic
1084932300 11:72566421-72566443 ATTTAAAAGGCTGGGTGTGGTGG - Intergenic
1085006318 11:73093921-73093943 AAAGATAGGACTGGGTGTGGTGG + Intronic
1085337169 11:75705221-75705243 AGGTAGGAGGCTGGGTGCGGTGG + Intergenic
1085437630 11:76522795-76522817 ACATATAATACTGGGTTTGGGGG + Intronic
1085486934 11:76872361-76872383 TGCTTCAAGACTGGGTGTGGTGG - Intronic
1085565519 11:77509740-77509762 AGGAGTAAGAGTGAGTGTGGTGG - Intergenic
1086180212 11:83941679-83941701 ATGTAGCAGACCGGGTGTGGTGG - Intronic
1086447596 11:86884587-86884609 GAGTGCAAGACTGGGTGTGGTGG - Intronic
1086476488 11:87180400-87180422 AAGTATATGAGTGTGTGTGGAGG + Intronic
1086943709 11:92824067-92824089 ATTTTTAAGGCTGGGTGTGGTGG + Intronic
1087116908 11:94535198-94535220 AGATTTAAGGCCGGGTGTGGTGG - Intergenic
1087710703 11:101546357-101546379 AGTTATAAGGCCGGGTGCGGTGG - Intronic
1087739466 11:101871027-101871049 AGGCATAAAACTAGGTGTGCTGG + Intronic
1087740735 11:101883883-101883905 AGGTATCAGACTGGGTAAAGCGG - Intergenic
1088274603 11:108071839-108071861 AGTGATCAGGCTGGGTGTGGTGG - Intronic
1088409050 11:109513331-109513353 AGGAATCAGGCTGGATGTGGTGG + Intergenic
1088512258 11:110589831-110589853 AGGCATTAGGCTGGGTGCGGTGG + Intronic
1088584727 11:111352646-111352668 TGGTAAAAGGCTGGGTGCGGTGG + Exonic
1088634262 11:111804436-111804458 AACAATAAGACTGGGTGTGGTGG + Intronic
1088861702 11:113806384-113806406 GGGGTTAAGGCTGGGTGTGGTGG - Intronic
1089048236 11:115522788-115522810 ATGTATGAGGCTGGGTATGGTGG + Intergenic
1089380395 11:118026677-118026699 AGGTCTTAGGCTGGGCGTGGTGG + Intergenic
1089960714 11:122615139-122615161 AGCTCTTAGGCTGGGTGTGGTGG + Intergenic
1090382099 11:126334629-126334651 AGGTGTGAGGCTGGGTGCGGTGG - Intronic
1090563491 11:127959869-127959891 AGATAATAGGCTGGGTGTGGTGG - Intergenic
1090800011 11:130164704-130164726 AATAATAAGGCTGGGTGTGGGGG - Intronic
1091166022 11:133476942-133476964 AGGCACTAGACTGGGTGTGAAGG + Intronic
1091336419 11:134771583-134771605 AGGTATAAAAATGGGGGTGCAGG - Intergenic
1091469882 12:717523-717545 TGGTCTATGTCTGGGTGTGGTGG - Intergenic
1091491738 12:938393-938415 AGGCTTAAGGCTGGGTGTGGTGG + Intronic
1091501075 12:1018500-1018522 ATGAATTAGGCTGGGTGTGGTGG - Intronic
1091518698 12:1213447-1213469 AGTTTTAAGACCGGGTGCGGTGG + Intronic
1091547912 12:1516484-1516506 TGGTCTTAGACTGGGCGTGGTGG - Intergenic
1091851991 12:3706889-3706911 AGCTGACAGACTGGGTGTGGTGG - Intronic
1091885497 12:4014237-4014259 AAATAAAAGTCTGGGTGTGGTGG + Intergenic
1092097048 12:5851398-5851420 AGGTGTCTGGCTGGGTGTGGTGG + Intronic
1092188825 12:6502660-6502682 AGATATAAGGCCGAGTGTGGTGG + Intronic
1092585312 12:9894467-9894489 AGGTATCAGGCTGGGAGTGGTGG - Intronic
1092620104 12:10254599-10254621 AGGCAAAAGGCTGGGCGTGGTGG + Intergenic
1092624805 12:10315828-10315850 AGGATTTGGACTGGGTGTGGTGG + Intergenic
1092889968 12:12960238-12960260 AAATTTTAGACTGGGTGTGGTGG + Intergenic
1093029711 12:14276950-14276972 AGGGATAAGGCTGGGTGCAGTGG - Intergenic
1093456626 12:19371292-19371314 AGAAAAAAGGCTGGGTGTGGTGG - Intronic
1093457667 12:19380595-19380617 AGGTATAGGGCTGGGTATGGTGG - Intergenic
1093639854 12:21513598-21513620 AGAGGTAAGGCTGGGTGTGGTGG - Intronic
1093866677 12:24235900-24235922 AAGTAACAGGCTGGGTGTGGTGG + Intergenic
1094100549 12:26757501-26757523 ATGAATAAGACCGGGTGTGGTGG - Intronic
1094552520 12:31466070-31466092 TGGAATGAGGCTGGGTGTGGTGG + Intronic
1094562536 12:31569039-31569061 AGGTATGTTGCTGGGTGTGGTGG - Intronic
1094569882 12:31632341-31632363 AGAAAGAAGGCTGGGTGTGGTGG - Intergenic
1094650566 12:32371873-32371895 GGGTGTAAGACCAGGTGTGGTGG - Intronic
1095053473 12:37574811-37574833 AGAGACAAGGCTGGGTGTGGTGG + Intergenic
1095164887 12:38960312-38960334 AGTTCTAAGACTGAGTGTTGAGG + Intergenic
1096129153 12:49143697-49143719 AAATAAAAGGCTGGGTGTGGTGG - Intergenic
1096325393 12:50656319-50656341 AGGTATAATTCTAGGTCTGGAGG + Intronic
1096332899 12:50730008-50730030 AGGAATGGGACTGGGTGTGGTGG - Intronic
1096615317 12:52829611-52829633 AGGTTTTAGGCTGGGTGCGGTGG + Intronic
1097003454 12:55897964-55897986 AAGAAGAAGGCTGGGTGTGGTGG + Intergenic
1097041151 12:56156761-56156783 AAGTACAAGGCTGGGCGTGGTGG + Intronic
1097044479 12:56177229-56177251 ATGAACAAGGCTGGGTGTGGTGG - Intronic
1097095325 12:56543158-56543180 AAGTATGGGGCTGGGTGTGGTGG - Intronic
1097112154 12:56668449-56668471 TGTTATAAGGCTGGGGGTGGTGG + Intronic
1097117266 12:56706824-56706846 ATATATAAGACTGGGCATGGTGG - Intergenic
1097640300 12:62173123-62173145 GTGTAAAAGGCTGGGTGTGGTGG + Intronic
1097849262 12:64395259-64395281 AGGTTTAGGGCTGGGTGTGGCGG - Intergenic
1097902345 12:64885707-64885729 AAGAAAAAGGCTGGGTGTGGTGG - Intergenic
1098162662 12:67660735-67660757 AAGTATAAGACTTGGTTTGGTGG + Exonic
1098239967 12:68457029-68457051 AAGGAGAAGACTGGGGGTGGGGG - Intergenic
1098256618 12:68622987-68623009 TAGTTTAAGGCTGGGTGTGGTGG - Intronic
1098410783 12:70181308-70181330 TGGGATCAGGCTGGGTGTGGTGG + Intergenic
1098529883 12:71529666-71529688 AGGCAAATGGCTGGGTGTGGTGG + Intronic
1099662706 12:85585654-85585676 AGGTATCAGGCTTAGTGTGGTGG + Intergenic
1099746035 12:86706543-86706565 TAGTATAAGGCTGGGTGTGGTGG - Intronic
1099837022 12:87919668-87919690 AAGTATAGGGCTAGGTGTGGTGG + Intergenic
1099964060 12:89426538-89426560 AAATGTAAGGCTGGGTGTGGTGG + Intronic
1100553369 12:95668700-95668722 AAGTCTCAGGCTGGGTGTGGTGG + Intronic
1100683442 12:96957121-96957143 AGTTATGAAGCTGGGTGTGGTGG + Intergenic
1101092429 12:101301378-101301400 AAAAATAAGGCTGGGTGTGGTGG + Intronic
1101383992 12:104239768-104239790 AGAAATGAGGCTGGGTGTGGTGG - Intronic
1101659786 12:106755381-106755403 AGGGAAAAGTCTAGGTGTGGTGG - Intronic
1101869056 12:108547105-108547127 CGTTTTAAGGCTGGGTGTGGTGG - Intronic
1102335174 12:112072649-112072671 AAATATAAGGCTGGGTGTGGTGG + Intronic
1102489796 12:113283345-113283367 AGAAATGAGGCTGGGTGTGGTGG + Intronic
1102510322 12:113410734-113410756 ATGTATCAGGCTGGGCGTGGTGG + Intronic
1102954709 12:117052060-117052082 AGTTAGAGGGCTGGGTGTGGTGG - Intronic
1103081905 12:118030916-118030938 AGGTATCAGGCCGGGCGTGGTGG - Intronic
1103165762 12:118769094-118769116 ATGTGTGAGACTGTGTGTGGTGG + Intergenic
1103372347 12:120429255-120429277 ATGTATAAAGCTGGGTGTAGTGG + Intergenic
1103421292 12:120785681-120785703 AAGAAAAAGGCTGGGTGTGGTGG + Intronic
1103489528 12:121306054-121306076 ATTTAAAAGGCTGGGTGTGGTGG - Intergenic
1103630215 12:122253965-122253987 GGGTATTGGGCTGGGTGTGGTGG - Intronic
1103753641 12:123185089-123185111 AGGCACTAGGCTGGGTGTGGTGG - Intronic
1103892868 12:124253179-124253201 AGGAATGAGGCTGGGTGTGGTGG + Intronic
1104011221 12:124931610-124931632 AAATATGAGGCTGGGTGTGGTGG + Intergenic
1104011870 12:124936720-124936742 AGATATTAGGCTGGGTGAGGTGG + Intergenic
1104283664 12:127402794-127402816 AGAAATAAGGCTGGGCGTGGTGG - Intergenic
1104470437 12:129025521-129025543 AGGTGTAAGTGTGGGGGTGGGGG - Intergenic
1104500787 12:129283477-129283499 TAATATAAGGCTGGGTGTGGTGG - Intronic
1105515367 13:21085077-21085099 AGCAATAAGACTGGACGTGGTGG + Intergenic
1105552119 13:21407279-21407301 AGGAAAGAAACTGGGTGTGGTGG - Intronic
1105958591 13:25307499-25307521 AGATTTCAGGCTGGGTGTGGTGG - Intronic
1105972879 13:25447006-25447028 AGGTTTAAGGCCAGGTGTGGTGG - Intronic
1106313026 13:28570239-28570261 AGAAATAAGCCTGGGCGTGGTGG + Intergenic
1107283020 13:38757873-38757895 AGGAATGGGACCGGGTGTGGTGG - Intronic
1107338323 13:39379764-39379786 ATGTATCAGGATGGGTGTGGGGG - Intronic
1107557799 13:41533012-41533034 AGGTAAGAGACTGGGAGTGGTGG - Intergenic
1107738092 13:43419233-43419255 AAGAAAAAGGCTGGGTGTGGTGG + Intronic
1107909655 13:45093434-45093456 AAGTATATGGCCGGGTGTGGTGG - Intergenic
1108046813 13:46391223-46391245 AGCAAAAAGGCTGGGTGTGGTGG - Intronic
1108213199 13:48158843-48158865 AGGGCTCAGGCTGGGTGTGGTGG - Intergenic
1108253225 13:48587490-48587512 AGAAAAAAGGCTGGGTGTGGTGG + Intergenic
1108258844 13:48637024-48637046 AGGGGTTAGGCTGGGTGTGGTGG + Intergenic
1108398056 13:50009318-50009340 ACGAAGAAGGCTGGGTGTGGTGG + Intronic
1108479116 13:50849314-50849336 AAATATAACACCGGGTGTGGTGG - Intergenic
1108808233 13:54186489-54186511 AAATAATAGACTGGGTGTGGTGG + Intergenic
1109208342 13:59506186-59506208 AGGAAGAAGGCTGGGTGTGGTGG - Intergenic
1110836406 13:80088476-80088498 TGGTAAAAGGCCGGGTGTGGTGG - Intergenic
1111190825 13:84804321-84804343 AGTTCTAGGGCTGGGTGTGGTGG + Intergenic
1111670243 13:91320861-91320883 AATTTTAAGGCTGGGTGTGGTGG + Intergenic
1111687719 13:91522010-91522032 ATATATAAGGCTGGGTATGGAGG + Intronic
1111868159 13:93795920-93795942 AGGGTTAAGGCTGGGTGTGGTGG + Intronic
1111949344 13:94698382-94698404 AGGAATTCAACTGGGTGTGGTGG - Intergenic
1112058684 13:95715867-95715889 AAGTTTAAGGCTGGGCGTGGTGG + Intronic
1112385087 13:98931883-98931905 AAGAATAAGGCTGGGTGTGGTGG - Intronic
1112469732 13:99676575-99676597 ATGAAGAAGGCTGGGTGTGGTGG - Intronic
1112565208 13:100546521-100546543 AGGAAATAGACTGGGTGCGGTGG + Intronic
1112769347 13:102779147-102779169 ATGAATAAGGCTGGGTGTGGTGG + Intergenic
1113117649 13:106890647-106890669 AGGAAGGAGGCTGGGTGTGGTGG - Intergenic
1113438328 13:110309698-110309720 AGGTATTAGCCTGGGCATGGCGG + Intronic
1113540957 13:111109024-111109046 ATGAATAAGATTGGGTGTGGTGG + Intergenic
1114175875 14:20319048-20319070 CGGTATAAGGCTGGGCATGGTGG - Intronic
1114274994 14:21135000-21135022 AGAAATAAGGCTGGGTGTGGTGG + Intergenic
1114370327 14:22079603-22079625 AGGTATAAAACTGGTTCTGGTGG - Intergenic
1114601341 14:23957836-23957858 ATGAATGAGGCTGGGTGTGGTGG - Intronic
1114605530 14:23992965-23992987 ATGAATGAGGCTGGGTGTGGTGG - Intronic
1114611028 14:24040618-24040640 ATGAATGAGGCTGGGTGTGGTGG - Intergenic
1114839054 14:26240984-26241006 ATTTATAGGTCTGGGTGTGGTGG - Intergenic
1115332541 14:32213487-32213509 AGCTTTAAGGCTGGGCGTGGTGG + Intergenic
1115608818 14:35032794-35032816 AGAAATTAGGCTGGGTGTGGTGG + Intergenic
1115938252 14:38579166-38579188 TTTGATAAGACTGGGTGTGGTGG - Intergenic
1116190588 14:41660311-41660333 AGTCATATGGCTGGGTGTGGTGG - Intronic
1116436712 14:44902605-44902627 AGATATTAGGCTGGGTGTGGTGG - Intronic
1116842622 14:49834909-49834931 AGTTCTTAGACTGGGTGCGGTGG + Intronic
1116889949 14:50258508-50258530 AAAAATAAGACTGGGCGTGGTGG - Intronic
1116893842 14:50296024-50296046 TGCTATGAGGCTGGGTGTGGTGG - Intronic
1116989693 14:51262297-51262319 ATATATAAGGCTAGGTGTGGTGG - Intergenic
1117196207 14:53342392-53342414 AGGTTTAATCCTGGGTATGGTGG - Intergenic
1117388986 14:55244885-55244907 ATAAATAAGACTGGGTGTGGTGG - Intergenic
1117707768 14:58489505-58489527 AGGTTTCAGGCTGGGTGAGGTGG - Intronic
1117895401 14:60480132-60480154 ATGAATAAGGCTGGGTGCGGTGG + Intronic
1118011303 14:61613152-61613174 AAGTTTCTGACTGGGTGTGGTGG - Intronic
1118062037 14:62150204-62150226 AGGTGGAAGAATGGGAGTGGGGG - Intergenic
1118145539 14:63131104-63131126 AATTATAAGGCTGGGTGCGGTGG + Intergenic
1118216501 14:63813634-63813656 AAAAATTAGACTGGGTGTGGTGG + Intergenic
1118216523 14:63813764-63813786 AAGTATTAGACCGGGTGTGGTGG + Intergenic
1118240993 14:64058766-64058788 AGTTATTAGGCTGGATGTGGTGG - Intronic
1118357010 14:65022652-65022674 AAGTATTTGGCTGGGTGTGGTGG - Intronic
1118630633 14:67699267-67699289 AGATAAAAGGCTGGATGTGGTGG + Intergenic
1118634103 14:67732147-67732169 AAATTTAAGGCTGGGTGTGGCGG + Intronic
1118674542 14:68169578-68169600 AGATATCAGACTGGGGGAGGAGG - Intronic
1118674778 14:68171992-68172014 AGAAATATGGCTGGGTGTGGTGG - Intronic
1118724476 14:68619185-68619207 AGTTAAAAGGCTGGGCGTGGTGG + Intronic
1119098312 14:71855060-71855082 AGGCAGAAGGCTGGGTGTAGTGG - Intergenic
1119253751 14:73180270-73180292 AAGGATAAGGCTGGGCGTGGTGG - Intronic
1119255269 14:73190198-73190220 AATTTTAAGGCTGGGTGTGGTGG + Intronic
1119289786 14:73486408-73486430 ACTTATGAGGCTGGGTGTGGTGG + Intronic
1119523049 14:75300439-75300461 AGTCATGAGACTGGGCGTGGTGG + Intergenic
1119734133 14:76970493-76970515 ATATATAAGGCTGGGTGCGGTGG - Intergenic
1119761902 14:77157820-77157842 AGGTAGCAGGCTGGGCGTGGGGG - Intronic
1120347668 14:83310560-83310582 TGGGAAAAGGCTGGGTGTGGTGG - Intergenic
1120613650 14:86674826-86674848 AAGTATGCAACTGGGTGTGGTGG + Intergenic
1120790302 14:88574528-88574550 AAATATGAGGCTGGGTGTGGTGG - Intronic
1120797004 14:88645003-88645025 AGAGAAAAGGCTGGGTGTGGTGG - Intronic
1120803297 14:88717469-88717491 ACAAATAAGGCTGGGTGTGGTGG + Intronic
1120962950 14:90141743-90141765 GGGCATAAGGCTGGGCGTGGTGG - Intronic
1121075436 14:91064341-91064363 AGGGAGAAGCCTGGGTGCGGTGG + Intronic
1121178991 14:91913430-91913452 ATGTATGAGACTGGGTGTGATGG + Intronic
1121385915 14:93525155-93525177 AGGTAACTGGCTGGGTGTGGTGG + Intronic
1122564192 14:102640130-102640152 ATATATATGGCTGGGTGTGGCGG - Intronic
1122684772 14:103496698-103496720 AAATAAAAGGCTGGGTGTGGTGG - Intronic
1122979818 14:105186431-105186453 GGGTATGTGAGTGGGTGTGGGGG + Intergenic
1122979858 14:105186567-105186589 GGGTATGTGAGTGGGTGTGGGGG + Intergenic
1122979898 14:105186703-105186725 GGGTATGTGAGTGGGTGTGGGGG + Intergenic
1122992412 14:105243151-105243173 GGGTGTGAGGCTGGGTGTGGTGG + Intronic
1123203414 14:106690510-106690532 AGGTAAAGGAGTGGATGTGGTGG + Intergenic
1202920339 14_KI270723v1_random:25294-25316 AGATATTTGACTGAGTGTGGTGG - Intergenic
1202924592 14_KI270724v1_random:12351-12373 AGATATTTGACTGAGTGTGGTGG + Intergenic
1123769642 15:23515905-23515927 AGATTTAAGACTGGGCATGGTGG - Intergenic
1123779008 15:23607068-23607090 AGGCATAGGGCTGAGTGTGGGGG - Intronic
1124102601 15:26709802-26709824 AGGTTTATGACTGGGTGTGGTGG - Intronic
1124267239 15:28247713-28247735 ATGTAGGAGGCTGGGTGTGGTGG - Intronic
1124997899 15:34741683-34741705 ATGGTTAAGGCTGGGTGTGGTGG - Intergenic
1125018682 15:34963264-34963286 AGGTCTAAGGCCAGGTGTGGTGG - Intronic
1125432956 15:39615598-39615620 ATGAAAGAGACTGGGTGTGGTGG + Intronic
1125466285 15:39956289-39956311 GGGAATGAGGCTGGGTGTGGTGG - Intronic
1125494008 15:40172986-40173008 AGATTGGAGACTGGGTGTGGTGG + Intronic
1125498784 15:40223823-40223845 ATGGATTAGGCTGGGTGTGGTGG + Intergenic
1125559292 15:40614518-40614540 AGGGAATAGGCTGGGTGTGGTGG - Intronic
1125630183 15:41140937-41140959 AAGTATGAGGCTGGGAGTGGTGG - Intergenic
1125633601 15:41168665-41168687 AGGTAAAAGCCCGGGTGTAGTGG - Intergenic
1125700956 15:41683178-41683200 AGTTATAAACCTTGGTGTGGTGG + Intronic
1125809075 15:42520779-42520801 ATGTTTAAGGCCGGGTGTGGTGG - Intronic
1125820404 15:42625312-42625334 AGCTTTAAGGCTGGGGGTGGTGG - Intronic
1125908135 15:43412631-43412653 AGGTCTAAGACTGGGACTGTGGG - Intronic
1125964491 15:43862793-43862815 AGAAATTAGGCTGGGTGTGGTGG - Intronic
1125992881 15:44127377-44127399 ATTTATTAGGCTGGGTGTGGTGG - Intronic
1126065746 15:44825030-44825052 AGGTAGAAGTCAGTGTGTGGAGG - Intergenic
1126094089 15:45075537-45075559 AGGTAGAAGTCAGTGTGTGGAGG + Exonic
1126574579 15:50184278-50184300 AGGAAAGAGGCTGGGTGTGGTGG - Intronic
1126606978 15:50487890-50487912 AAGTATAAGCCTAGGTGTGGTGG + Intronic
1126728996 15:51662296-51662318 AAATACAGGACTGGGTGTGGTGG - Intergenic
1126754573 15:51913257-51913279 AAGAATAAGGCTGAGTGTGGTGG - Exonic
1127416861 15:58766493-58766515 AGCTATGAGGCTGGGTGTGGTGG + Intergenic
1127419450 15:58790890-58790912 AGCGATCAGGCTGGGTGTGGTGG + Intronic
1127532290 15:59855537-59855559 AGATACAAGGCTGGGTGTGGTGG + Intergenic
1127912761 15:63431690-63431712 AGGTACAAGAATGGATGTTGAGG + Intergenic
1128117183 15:65116708-65116730 AGTGATCAGGCTGGGTGTGGTGG - Intergenic
1128561315 15:68669767-68669789 ATAAATAAGGCTGGGTGTGGTGG + Intronic
1128894451 15:71359518-71359540 GGGTATGTGGCTGGGTGTGGTGG + Intronic
1129095862 15:73207007-73207029 AGGGATGTCACTGGGTGTGGTGG - Intronic
1129494761 15:75968298-75968320 AAGTCTAAGGCTGGGTGTGGTGG + Intronic
1129655392 15:77520914-77520936 TGGTATAAGGCCGGGAGTGGTGG + Intergenic
1130316625 15:82801994-82802016 AGGCAAAACACTGGCTGTGGAGG - Intronic
1130328747 15:82903323-82903345 AAGTAAAAGGCTGGGTGCGGTGG + Intronic
1130425081 15:83789096-83789118 AGGAACACGGCTGGGTGTGGTGG - Intronic
1130826390 15:87551121-87551143 AACTATAAGGCAGGGTGTGGTGG + Intergenic
1131853854 15:96571179-96571201 AAATATCAGGCTGGGTGTGGTGG - Intergenic
1131921077 15:97329296-97329318 ATACATAAGGCTGGGTGTGGTGG - Intergenic
1133045335 16:3085228-3085250 AGATCTCAGGCTGGGTGTGGTGG + Intergenic
1133202200 16:4210768-4210790 AGATATGAGGCTGGGTGTGGTGG - Intronic
1133238356 16:4400209-4400231 ATGTATCAGGCTGGGTATGGTGG + Intronic
1133419468 16:5633584-5633606 GGGTAAAGGGCTGGGTGTGGTGG + Intergenic
1133477107 16:6134222-6134244 AGAAATTAGGCTGGGTGTGGTGG - Intronic
1133755533 16:8759829-8759851 AGAAATACAACTGGGTGTGGTGG - Intronic
1133785592 16:8970742-8970764 AGTTTTAAGGCTGGGTATGGTGG - Intergenic
1133881209 16:9784140-9784162 AATTATATGGCTGGGTGTGGTGG + Intronic
1134268747 16:12715370-12715392 AGCTTTTAGGCTGGGTGTGGAGG + Intronic
1134477408 16:14587619-14587641 AATTAGAAGGCTGGGTGTGGTGG - Intronic
1134478440 16:14596445-14596467 AGGGAAAGGGCTGGGTGTGGTGG + Intronic
1134600666 16:15531192-15531214 AGGTTTAAGGCTGGGCGTGATGG - Intronic
1135023531 16:18982191-18982213 AGGCTGGAGACTGGGTGTGGTGG - Intergenic
1135041195 16:19118175-19118197 AGCTTTAAGGCTGGGCGTGGTGG + Exonic
1135267407 16:21039503-21039525 TAGTATAAGGCCGGGTGTGGTGG - Intronic
1135675337 16:24410535-24410557 AGTTAATAGGCTGGGTGTGGTGG + Intergenic
1135678670 16:24438797-24438819 AGAGATATGGCTGGGTGTGGTGG + Intergenic
1135739778 16:24964819-24964841 AGCTATGAGGCTGGGTGCGGTGG + Intronic
1135879326 16:26238860-26238882 AGGCAGAGGGCTGGGTGTGGTGG - Intergenic
1135981441 16:27150624-27150646 AGTCATAAGGCTGGGCGTGGTGG - Intergenic
1136052747 16:27664508-27664530 AGGTATAGAACTGGATTTGGAGG + Intronic
1137350161 16:47706360-47706382 AGGCATAAGGCTGGGTATGGTGG - Intergenic
1137407205 16:48198749-48198771 AGTTATAAGGCTGGGTGCAGTGG + Intronic
1137857388 16:51808457-51808479 AGGAACATGGCTGGGTGTGGTGG - Intergenic
1138238349 16:55405145-55405167 AGTTTTAAGGCTGGGTGTGGTGG + Intronic
1138399202 16:56731696-56731718 AAACAGAAGACTGGGTGTGGTGG - Intronic
1138833435 16:60403966-60403988 TGGTATTAGGCTGGGTGTGGTGG + Intergenic
1139395888 16:66638569-66638591 AGATTTTAGGCTGGGTGTGGTGG + Intronic
1139399909 16:66673196-66673218 AAAAAAAAGACTGGGTGTGGTGG - Intronic
1139411562 16:66765743-66765765 ATGTATTAGGCCGGGTGTGGTGG - Intronic
1139439827 16:66960777-66960799 AGGCTTGGGACTGGGTGTGGTGG - Intergenic
1139839287 16:69865335-69865357 AGATTTGAGGCTGGGTGTGGTGG - Intronic
1140429707 16:74891633-74891655 AACAAAAAGACTGGGTGTGGTGG + Intronic
1140579408 16:76211324-76211346 AGTTCTTAAACTGGGTGTGGTGG + Intergenic
1140666180 16:77229714-77229736 GGGGAAAAGACTGGGCGTGGTGG - Intergenic
1140878811 16:79178602-79178624 AGGAATCAGGCTGGGTGTGGTGG - Intronic
1141083479 16:81074668-81074690 AGTTATAGGGTTGGGTGTGGTGG - Intronic
1141710246 16:85694772-85694794 AGTTTTAAGGCTGGGTGTGGTGG - Intronic
1141953059 16:87351575-87351597 AGGGATAGGGCTGGGTGCGGTGG + Intronic
1142664281 17:1453617-1453639 TTGTGTTAGACTGGGTGTGGTGG + Intronic
1142726533 17:1819067-1819089 AAGAATACGGCTGGGTGTGGTGG + Intronic
1143008143 17:3850567-3850589 AGGGAGAGGGCTGGGTGTGGTGG - Intergenic
1143150506 17:4805141-4805163 AAGTTTAAGACCGGGTGCGGTGG + Intergenic
1143470345 17:7170290-7170312 AGGTATTCCACTGGGTATGGGGG + Intergenic
1144273961 17:13646954-13646976 CAGTATCAGACTGGGTGTGGTGG + Intergenic
1144602166 17:16626463-16626485 AGCTATAAGGCTGGGTGTGGTGG + Intronic
1145076959 17:19863649-19863671 AAGAATCAGGCTGGGTGTGGTGG - Intronic
1145795557 17:27653529-27653551 AGGTATAGTAGTGGGTGTGTGGG - Intergenic
1145803457 17:27707563-27707585 AAAAATAAGTCTGGGTGTGGTGG + Intergenic
1145809993 17:27758860-27758882 AGGTATAGTAGTGGGTGTGTGGG - Exonic
1145899681 17:28482337-28482359 AGGTAATAGGCTGGGTGCGGTGG - Intronic
1146049484 17:29537824-29537846 AGAGATACGGCTGGGTGTGGCGG + Intronic
1146106491 17:30042294-30042316 ATGTTTATGGCTGGGTGTGGTGG - Intronic
1146130073 17:30265413-30265435 AGGTAGAGGAGGGGGTGTGGAGG - Intronic
1146187584 17:30735330-30735352 AGAAATGAGGCTGGGTGTGGTGG + Intergenic
1146317421 17:31819025-31819047 AGCAATATGACTGGGCGTGGTGG + Intergenic
1146331660 17:31932769-31932791 AAGTAAAAGGCTGGGTGTGTTGG - Intergenic
1146332639 17:31940723-31940745 AGAAATGAGGCTGGGTGTGGTGG + Intronic
1146335659 17:31967877-31967899 AAATATTAGACTGGGCGTGGTGG + Intronic
1146633352 17:34486292-34486314 ATGGTTAAGGCTGGGTGTGGTGG + Intergenic
1146698646 17:34933067-34933089 AGTCATAAGGCCGGGTGTGGTGG - Intronic
1146734043 17:35222138-35222160 AAGTATGGGGCTGGGTGTGGTGG + Intergenic
1146791283 17:35752116-35752138 AGGCAGAAGGCTGGGTGTGGTGG - Intronic
1146791693 17:35754276-35754298 AAATCTAAGGCTGGGTGTGGTGG + Intronic
1147168499 17:38605415-38605437 AGGCAGGAGACTGGGTGGGGAGG - Intronic
1147220239 17:38924501-38924523 AAGTAAAAGGCTGGGTGTGGTGG - Intergenic
1147226981 17:38986843-38986865 TGATTTAAGGCTGGGTGTGGTGG + Intergenic
1147249430 17:39144184-39144206 AGTGGCAAGACTGGGTGTGGAGG - Intronic
1147271291 17:39273538-39273560 AGTAACAAGGCTGGGTGTGGTGG + Intronic
1147271535 17:39275957-39275979 AGTTATTAGACTGGGTGGAGTGG + Intronic
1147453985 17:40523368-40523390 AGCTATAGGACTGGGTGCAGGGG + Intergenic
1147519608 17:41158117-41158139 AGATTGAAGACTGGGTGTGATGG + Intergenic
1147574180 17:41589106-41589128 GGTTCTAAGACCGGGTGTGGGGG - Intergenic
1147628338 17:41914394-41914416 AGGGGTAAATCTGGGTGTGGGGG - Intronic
1147642800 17:42014844-42014866 AGAAAAAAGACTGGGCGTGGTGG - Intronic
1147789938 17:43007532-43007554 AGGAATTAGGCTGGGTGTGTTGG + Intronic
1147846070 17:43404603-43404625 AGGAACATGGCTGGGTGTGGTGG - Intergenic
1148099565 17:45080445-45080467 AAGGAAAAGGCTGGGTGTGGTGG - Intronic
1148173782 17:45547015-45547037 AGGGAAGAGGCTGGGTGTGGTGG - Intergenic
1148275487 17:46298432-46298454 AGGGAAGAGGCTGGGTGTGGTGG + Intronic
1148297592 17:46516011-46516033 AGGGAAGAGGCTGGGTGTGGTGG + Intronic
1148362144 17:47020490-47020512 AGGGAAGAGGCTGGGTGTGGTGG + Intronic
1148473745 17:47913146-47913168 AGATATTGGGCTGGGTGTGGTGG - Intronic
1148629340 17:49094427-49094449 AGCAATTAGGCTGGGTGTGGTGG - Intergenic
1149487155 17:57051545-57051567 TGGAATTAGACCGGGTGTGGAGG - Intergenic
1149648786 17:58262678-58262700 TGGTAAAGGGCTGGGTGTGGTGG - Intronic
1149807883 17:59636638-59636660 AAATACAAGACTGGGTATGGTGG - Intronic
1149912751 17:60581302-60581324 AGGTATCAGGCTGGGCATGGTGG + Intronic
1149967104 17:61175846-61175868 AAGTTTGAGACTAGGTGTGGTGG + Intronic
1150404994 17:64893937-64893959 AGGGAAGAGGCTGGGTGTGGTGG - Intronic
1150553945 17:66236770-66236792 AGAAATAAGGCTGGGCGTGGTGG - Intronic
1150585750 17:66516343-66516365 AAGAATAAGGCTGGGCGTGGTGG + Intronic
1150629565 17:66869794-66869816 TGGTATAAGGCTGGGGGCGGTGG + Intronic
1150691617 17:67371880-67371902 AGGTGGTAAACTGGGTGTGGTGG + Intergenic
1150728299 17:67669401-67669423 AGAAATAGGGCTGGGTGTGGTGG - Intronic
1150875808 17:68968903-68968925 AGGTATAGCCCTGGGTCTGGTGG + Intergenic
1151159679 17:72154657-72154679 AGATAATAGGCTGGGTGTGGTGG + Intergenic
1151499425 17:74479514-74479536 AGATGCATGACTGGGTGTGGTGG - Intronic
1151639224 17:75377166-75377188 AAATATAATACAGGGTGTGGTGG + Intronic
1151792260 17:76314655-76314677 AAGTGTAAGGCTGGGTGCGGTGG - Intronic
1151877775 17:76877036-76877058 TGGTAGGAGGCTGGGTGTGGTGG + Intronic
1152393916 17:80020294-80020316 AAGTATAAGGCCAGGTGTGGTGG + Intronic
1152765830 17:82138076-82138098 AGGTACAAGGTGGGGTGTGGTGG + Intronic
1153220771 18:2858921-2858943 TGGTATAGGGCCGGGTGTGGTGG - Intronic
1153238347 18:3009726-3009748 AGGAAGAAGGCTGGGTGCGGTGG - Intronic
1153296437 18:3551040-3551062 AGGCATAAGTCTGGTTCTGGTGG - Intronic
1153799684 18:8658339-8658361 AAGAATGAGATTGGGTGTGGTGG + Intergenic
1153912960 18:9720249-9720271 AGATTTCAGGCTGGGTGTGGTGG - Intronic
1154111381 18:11571449-11571471 ATATTTCAGACTGGGTGTGGTGG + Intergenic
1154239713 18:12641652-12641674 ATGTATGAGGCTGGGTGTGGTGG - Intronic
1154264562 18:12868860-12868882 AGTTTTAAGGCTGGGTGCGGTGG + Intronic
1154470872 18:14699755-14699777 AAATAAAAGGCTGGGTGTGGTGG - Intergenic
1155143129 18:23061329-23061351 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1155297632 18:24399516-24399538 TGGTTCAAGGCTGGGTGTGGTGG - Intergenic
1155473153 18:26211815-26211837 ATTTATAAGGCTGGTTGTGGTGG + Intergenic
1155595212 18:27478093-27478115 AGGAATGAGGCTGGGTGTGGTGG + Intergenic
1155975591 18:32126105-32126127 AAGGATATGGCTGGGTGTGGTGG + Intronic
1156056763 18:33014966-33014988 AGGAAAGAGGCTGGGTGTGGTGG + Intronic
1156205605 18:34882653-34882675 AGCTATAAGAGTGGGTGCAGTGG - Intronic
1156332832 18:36140639-36140661 AAATAAAAGGCTGGGTGTGGTGG - Intronic
1157203379 18:45678104-45678126 AGTTACACGACTGGGAGTGGCGG - Intronic
1157505953 18:48226731-48226753 AGGTATTCGACTGGGTGCAGTGG + Intronic
1157696138 18:49725273-49725295 AAGAATAAGGCTGGGTGCGGTGG - Intergenic
1157964520 18:52192731-52192753 ATATTTAAGGCTGGGTGTGGTGG - Intergenic
1158130522 18:54147791-54147813 AGGCATATGGCTGGGTGTGGTGG + Intergenic
1158144879 18:54300990-54301012 AGATTTGAGGCTGGGTGTGGTGG + Intronic
1158268444 18:55686058-55686080 AATTATAAGGCTGGGTGTGGTGG + Intergenic
1158359319 18:56653492-56653514 ATGAATGAGACTGGATGTGGTGG - Intronic
1158464761 18:57680295-57680317 AAAAAAAAGACTGGGTGTGGTGG + Intronic
1158701890 18:59755561-59755583 AAGAAGAAGGCTGGGTGTGGTGG + Intergenic
1159427605 18:68309983-68310005 ACTTATAAGGCCGGGTGTGGTGG - Intergenic
1159585424 18:70279095-70279117 AAGTACAAGGCTGAGTGTGGTGG - Intergenic
1160213860 18:76909028-76909050 ACAAATAAGGCTGGGTGTGGTGG + Intronic
1160259997 18:77284087-77284109 AATTATAAGGCTGGGTGTGGTGG + Intergenic
1160389906 18:78522093-78522115 AGGGAAAAGACTGGATGGGGAGG - Intergenic
1160473131 18:79157071-79157093 ATGTATTGGACTGGGCGTGGTGG + Intronic
1160590814 18:79943884-79943906 AGGTTCAGGACTGGGTGAGGCGG - Intronic
1160879264 19:1312071-1312093 AGGCATAAGGCTGGGCGTGGTGG + Intergenic
1160880593 19:1318188-1318210 AGATCACAGACTGGGTGTGGTGG + Intergenic
1160954386 19:1683690-1683712 AATAATAAGGCTGGGTGTGGTGG + Intergenic
1160999201 19:1901016-1901038 AAAAATAAGACTGGGAGTGGTGG - Intergenic
1161079772 19:2304994-2305016 GGGCATGAGGCTGGGTGTGGTGG - Intronic
1161604537 19:5207370-5207392 AGAAATGAGGCTGGGTGTGGTGG - Intronic
1161874842 19:6900185-6900207 TGTTTTGAGACTGGGTGTGGTGG + Intronic
1161900022 19:7111413-7111435 AATAATAAGGCTGGGTGTGGTGG + Intergenic
1161976195 19:7609032-7609054 AATTATAGGGCTGGGTGTGGTGG + Intronic
1162264449 19:9559718-9559740 AAATAAAAGGCTGGGTGTGGTGG - Intergenic
1162275104 19:9647365-9647387 AGTTATCAGGCTGGGAGTGGTGG - Intronic
1162306073 19:9874766-9874788 AAATAAAAGACTGGGTGCGGTGG - Intronic
1162512622 19:11128738-11128760 ACTTATGAGGCTGGGTGTGGTGG + Intronic
1162542738 19:11307713-11307735 AGTTACCAGGCTGGGTGTGGTGG - Intronic
1162543113 19:11310236-11310258 AGGAAGAAGGCCGGGTGTGGTGG + Intronic
1162579739 19:11521782-11521804 AAGAATAAGACCAGGTGTGGTGG + Intronic
1162661830 19:12175480-12175502 AAGTATAAGGCCGGGTGTGGTGG - Intronic
1162941160 19:14010293-14010315 AGAAATAAGGCTGAGTGTGGTGG + Intergenic
1163080348 19:14935595-14935617 AGTTTTCAGGCTGGGTGTGGTGG + Intergenic
1163540666 19:17907822-17907844 ATGTATTAGGCTGGGTGCGGTGG - Intergenic
1163563863 19:18038015-18038037 TGCTTTAAGGCTGGGTGTGGTGG - Intergenic
1163607894 19:18285580-18285602 AGGGGTCAGGCTGGGTGTGGTGG + Intergenic
1163871907 19:19828983-19829005 AGGCCTCAGGCTGGGTGTGGTGG + Intergenic
1164065671 19:21714356-21714378 ATGTATATGGCTGGGTGCGGTGG + Intergenic
1164155120 19:22590303-22590325 AGAGATAAGACAGGGTGCGGTGG - Intergenic
1164612872 19:29644863-29644885 AGGAATAAGGCCGGGCGTGGTGG - Intergenic
1164996793 19:32726364-32726386 ATGTATTTGACTGGGTGTGGTGG - Intronic
1165240989 19:34467178-34467200 ACATTTAAGGCTGGGTGTGGTGG + Intronic
1165241414 19:34471361-34471383 ATGTAGAAGACTGGGTGTGGTGG + Intergenic
1165555650 19:36629647-36629669 AGGTATAAGCCTGGGCTTGGTGG + Intergenic
1165580579 19:36859441-36859463 ACATAAAAGTCTGGGTGTGGTGG - Intronic
1165611148 19:37154381-37154403 AGGCAGAAAAATGGGTGTGGGGG + Intronic
1165785902 19:38461765-38461787 AAGAAAAAGGCTGGGTGTGGTGG + Intronic
1165824788 19:38699465-38699487 AAGGATAGGGCTGGGTGTGGTGG + Intronic
1165873557 19:38990088-38990110 AGGTGTTAGGCTGGGCGTGGTGG - Intergenic
1165964056 19:39559666-39559688 AGGAATAAGGCTGGGTGTGGTGG + Intergenic
1165989546 19:39801590-39801612 AGAAATAAGGCTGGGTGTGGTGG - Intergenic
1166721397 19:44998676-44998698 AGAAAGAAGACCGGGTGTGGTGG + Intergenic
1166737544 19:45095007-45095029 AGGGATCAGACTGGCTGTGGTGG + Intronic
1167081253 19:47277481-47277503 AGTTATAAGGCTGGGTGCAGTGG - Intergenic
1167213411 19:48148184-48148206 AGGGAGGAGGCTGGGTGTGGTGG + Intronic
1167274913 19:48531523-48531545 GAGTTTAAGACTGGGTGTGGTGG + Intergenic
1167516481 19:49926239-49926261 TTGCTTAAGACTGGGTGTGGTGG + Intronic
1167805593 19:51781879-51781901 AGAGAGAAGGCTGGGTGTGGTGG + Intronic
1167858178 19:52259852-52259874 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1167976784 19:53233777-53233799 AGGTATTAGGCTGGGTATGGTGG + Intergenic
1168050751 19:53827840-53827862 ATATAGAAGGCTGGGTGTGGTGG + Intergenic
1168075569 19:53979288-53979310 AGCAATAAAACTGGGTGGGGTGG + Intronic
1168477121 19:56684448-56684470 AGTACTAAGGCTGGGTGTGGTGG + Intergenic
1168708806 19:58485864-58485886 AAATATCAGGCTGGGTGTGGTGG - Intronic
925500685 2:4501069-4501091 AGGCAGAAGACTGGGTTTTGTGG - Intergenic
925886220 2:8395437-8395459 AGCTATGAGGCCGGGTGTGGTGG + Intergenic
925950591 2:8906234-8906256 ATTTAAAAGGCTGGGTGTGGTGG - Intronic
926202169 2:10809387-10809409 AAGACTAAGGCTGGGTGTGGTGG + Intronic
926203980 2:10821909-10821931 TTATATAAGGCTGGGTGTGGTGG - Intronic
926632550 2:15149747-15149769 AGGATCAAGGCTGGGTGTGGTGG - Intergenic
927063412 2:19445455-19445477 AGGTATGAGAGTGGGGGTGAGGG + Intergenic
927549940 2:23989538-23989560 AGAAATAAGGCCGGGTGTGGTGG - Intronic
927752320 2:25680465-25680487 TGGAATCAGGCTGGGTGTGGTGG - Intergenic
927800429 2:26094174-26094196 AGGAAAAAGGCTGGGTGTGGTGG - Intronic
927817938 2:26236700-26236722 ACGTATCAGGCTGGGTGTGGTGG - Intronic
928047228 2:27948481-27948503 AGTGTTAAGGCTGGGTGTGGTGG + Intronic
928071333 2:28220639-28220661 AAGGATACAACTGGGTGTGGTGG + Intronic
928417253 2:31106042-31106064 GGGTAGAAAAGTGGGTGTGGAGG - Intronic
928547459 2:32341770-32341792 ATATATATGGCTGGGTGTGGTGG + Intergenic
928569374 2:32588070-32588092 ATTAATAAGGCTGGGTGTGGTGG + Intronic
928690265 2:33791913-33791935 TGCTCTAAGGCTGGGTGTGGTGG + Intergenic
928719495 2:34102874-34102896 AGGTGCAGGACTGGGGGTGGCGG + Intergenic
928789953 2:34938452-34938474 AATTATAGGGCTGGGTGTGGTGG - Intergenic
928837949 2:35569419-35569441 AGCTATCGGGCTGGGTGTGGTGG + Intergenic
929907884 2:46062147-46062169 ATGCATGAGGCTGGGTGTGGTGG - Intronic
930075030 2:47399594-47399616 AGGTTTGAGGCTGGGTGTGGTGG + Intergenic
930124775 2:47786921-47786943 TGCCATAAGGCTGGGTGTGGTGG - Intronic
930207092 2:48598761-48598783 AGATATGAGGCTGGGTGTGGTGG + Intronic
930794514 2:55374084-55374106 ACATATCAGACTGGGCGTGGTGG + Intronic
931092056 2:58896712-58896734 TGTTATAAGTGTGGGTGTGGAGG - Intergenic
931312813 2:61098389-61098411 ATATATAAGGCTGGGTGTGGTGG - Intronic
931318714 2:61155909-61155931 AGAAATAAGGCTGGGCGTGGTGG + Intronic
931368191 2:61637712-61637734 AGATAAAAGTCTGGGTGTGGTGG + Intergenic
931408908 2:62009315-62009337 AAGAATAAGACTGGGCATGGTGG + Intronic
931675656 2:64693760-64693782 AGGTATGAGGGTGTGTGTGGCGG - Intronic
932060125 2:68488614-68488636 AGGTAATAGGCAGGGTGTGGTGG - Intronic
932183051 2:69666756-69666778 AAATATCAGGCTGGGTGTGGTGG + Intronic
932198538 2:69805314-69805336 AGAAATTAGGCTGGGTGTGGTGG + Intronic
932704385 2:74011749-74011771 AGAAATAGGGCTGGGTGTGGTGG + Intronic
932938144 2:76130477-76130499 AGGCAAAAGCCTGGGTGCGGTGG - Intergenic
933697137 2:85228130-85228152 AGATAGGAGACTGGGTGTGGTGG + Intronic
933907164 2:86906279-86906301 TGGTATAAGGCCAGGTGTGGTGG + Intergenic
933908410 2:86915941-86915963 TGGTATAAGGCCAGGTGTGGTGG + Intronic
934024313 2:87987439-87987461 TGGTATAAGGCCAGGTGTGGTGG - Intergenic
934077153 2:88438179-88438201 AATTAGATGACTGGGTGTGGTGG + Intergenic
934915379 2:98297367-98297389 AGATGTAAGGCTGGGCGTGGTGG - Intronic
935329431 2:101965771-101965793 ATGTTTAAGGCTGGGTGTGGTGG + Intergenic
935638778 2:105271057-105271079 AGGTATAAGCCTGGGCTTGCAGG - Intronic
935768957 2:106398463-106398485 AAATATAAGGCTGGGCGTGGTGG - Intronic
935911142 2:107897462-107897484 AAATATAAGGCTGGGCGTGGTGG + Intergenic
936132919 2:109862505-109862527 AAATATAAGGCTGGGCGTGGTGG + Intergenic
936211778 2:110508980-110509002 AAATATAAGGCTGGGCGTGGTGG - Intergenic
936364953 2:111845134-111845156 TGGTATAAGGCCAGGTGTGGTGG - Intronic
936420917 2:112363559-112363581 AAATATAAGGCTGGGCGTGGTGG - Intergenic
936554176 2:113478566-113478588 ATATATAAGGCTGGGTGTGGTGG - Intronic
936717363 2:115203638-115203660 ATGTGTATGTCTGGGTGTGGGGG - Intronic
936766514 2:115855721-115855743 AACTATAAGGCTGGGTGCGGTGG - Intergenic
937033721 2:118763436-118763458 ATGTATAAAATTGGGGGTGGGGG + Intergenic
937137978 2:119571743-119571765 AGTTGTTAGGCTGGGTGTGGTGG - Intronic
937501537 2:122484436-122484458 TAGTGTAAGACTGGGTGTGGTGG - Intergenic
937716987 2:125043526-125043548 AGTGATAAGGCTGGGTGTGGTGG + Intergenic
937874733 2:126814521-126814543 AGGGAATAGGCTGGGTGTGGTGG - Intergenic
937964442 2:127491729-127491751 AAGTAAGAGGCTGGGTGTGGTGG - Intronic
937983553 2:127628534-127628556 AGGTGCCAGACTGGGTGGGGTGG + Exonic
938173985 2:129107498-129107520 TGGTGAAAGACTGGGTGGGGAGG + Intergenic
938275715 2:130019790-130019812 AGATAGAAGACTGGGTGTTAGGG - Intergenic
938326657 2:130410511-130410533 AGATAGAAGACTGGGTGTTAGGG - Intergenic
938363284 2:130710949-130710971 AGATAGAAGACTGGGTGTTAGGG + Intergenic
938439659 2:131317532-131317554 AGATAGAAGACTGGGTGTTAGGG + Intronic
938844370 2:135193915-135193937 AAGTTTATGGCTGGGTGTGGTGG + Intronic
938859092 2:135347969-135347991 TGGAAATAGACTGGGTGTGGTGG + Intronic
938924180 2:136024229-136024251 AGGCATAAGGCTGGGCATGGTGG - Intergenic
939119981 2:138104511-138104533 AGGTAGATGGCCGGGTGTGGTGG + Intergenic
939201477 2:139041360-139041382 TAGAATAAGGCTGGGTGTGGTGG + Intergenic
939269426 2:139918320-139918342 ATGTAATAGCCTGGGTGTGGTGG + Intergenic
939691560 2:145268195-145268217 AGGTACCAGATTGGATGTGGTGG - Intergenic
939977618 2:148737395-148737417 AGGAATAAGACTGTGTGGGGAGG - Intronic
940271310 2:151893527-151893549 AGCTATAAGACTGAGTGCGATGG - Intronic
940803433 2:158157681-158157703 AGGGAGAACACTGGGAGTGGGGG - Intergenic
941166563 2:162089350-162089372 AGAGATGAGACTGGGTATGGTGG - Intergenic
941778308 2:169416781-169416803 AACTATAAGGCTGGGTGAGGTGG + Intergenic
941807100 2:169720405-169720427 AGATTTAAGGCTGGGCGTGGTGG - Intronic
942088782 2:172467697-172467719 AGAAATCAGACTGGGCGTGGTGG + Intronic
942132753 2:172897245-172897267 TGGTCTAAAACTGGTTGTGGTGG - Intronic
942134596 2:172912052-172912074 CAGAATCAGACTGGGTGTGGTGG - Intronic
942282509 2:174380008-174380030 AGAAATCAGGCTGGGTGTGGTGG - Intronic
942667420 2:178334807-178334829 AGGTTTAAGGCCAGGTGTGGTGG - Intronic
943684146 2:190799027-190799049 AATTATAAGGCTGGGTGTGGTGG - Intergenic
943695835 2:190929755-190929777 AGTTATAAGGCCGGGTGCGGTGG - Intronic
943910124 2:193553742-193553764 AAGTATCAGGCTGGGGGTGGTGG + Intergenic
944525216 2:200611990-200612012 AGAGATAAGTCTGGGAGTGGTGG - Intronic
944652459 2:201844859-201844881 AGCAATAAGGCCGGGTGTGGTGG + Intronic
944664209 2:201946077-201946099 ATTTATAAGGCTGGGCGTGGTGG - Intergenic
944705628 2:202285626-202285648 AGGGAGAAGACTGGGCATGGTGG - Intronic
944747465 2:202672745-202672767 AGGTGACAGACTGGGTGTGGTGG + Intronic
944982203 2:205134233-205134255 AGAAATACGACTGGGTGTGGTGG + Intronic
945067932 2:205962650-205962672 ATTTATTAGGCTGGGTGTGGTGG - Intergenic
945292695 2:208141663-208141685 GAGTTTATGACTGGGTGTGGTGG + Intergenic
945313554 2:208344103-208344125 AGATTTAAGGCTGGGTGCGGTGG - Intronic
946390603 2:219414205-219414227 TGAAATAAGGCTGGGTGTGGAGG + Intergenic
946740707 2:222798503-222798525 AAAAATAAGACTGGGTGCGGTGG - Intergenic
946779785 2:223182119-223182141 AGCTATAAGATTTGGTGGGGAGG + Intronic
946845989 2:223859503-223859525 AAGAATGAGACTGGGCGTGGTGG - Intronic
947122075 2:226826805-226826827 ATCTATCAGGCTGGGTGTGGTGG - Intergenic
947231716 2:227894112-227894134 AGGTTTAAGGCTGGGCGTGGTGG + Intronic
947699217 2:232218458-232218480 AGGTTTCAGGCCGGGTGTGGTGG + Intronic
947799399 2:232918912-232918934 AGAAATAAGACTGGGTGCGGTGG - Intronic
948096725 2:235341203-235341225 AGGAAAGAGGCTGGGTGTGGTGG - Intergenic
948522946 2:238552798-238552820 AGAATTAAGGCTGGGTGTGGTGG + Intergenic
948602079 2:239112935-239112957 AGGAATCAGGCTGGGCGTGGTGG + Intronic
949029256 2:241782848-241782870 ATGTTTAAGGCTGGGTATGGTGG + Intronic
1168959900 20:1861871-1861893 ACGTATAAGACTGGGTGGGACGG + Intergenic
1169095557 20:2895369-2895391 ATGTAGTAGGCTGGGTGTGGTGG - Intronic
1169107767 20:3011632-3011654 AGGTATAAGATGGGAAGTGGTGG + Intronic
1169239252 20:3961112-3961134 AAGGATAAGGCTGGGTGTGGTGG + Intronic
1169338245 20:4775206-4775228 ATGTAGAAGGCTGGGCGTGGTGG - Intergenic
1169357846 20:4923117-4923139 AAATCTAGGACTGGGTGTGGTGG + Intronic
1169402736 20:5296898-5296920 GGGCATGAGGCTGGGTGTGGTGG + Intergenic
1169431672 20:5541870-5541892 AGATAACAGGCTGGGTGTGGTGG - Intergenic
1169879597 20:10332061-10332083 AGGTATCAGCCTGGGTATTGTGG - Intergenic
1170217485 20:13906964-13906986 AATTATAAGGCCGGGTGTGGTGG - Intronic
1170643012 20:18172552-18172574 ATGTTTAAGGCTGGGTGTGGTGG - Intronic
1171025249 20:21624237-21624259 AGACATAAGGCTGGGGGTGGTGG + Intergenic
1171287694 20:23955543-23955565 ATAAATAAGGCTGGGTGTGGTGG + Intergenic
1171528792 20:25837575-25837597 AGAGACAAGGCTGGGTGTGGTGG - Intronic
1171548034 20:26018311-26018333 AGAGACAAGGCTGGGTGTGGTGG + Intergenic
1171982268 20:31636591-31636613 ACTTATAAAACTGGGCGTGGTGG - Intergenic
1171984733 20:31651834-31651856 AAGTTGAAGGCTGGGTGTGGTGG + Intergenic
1171995654 20:31728956-31728978 AGGAACAAGGCCGGGTGTGGTGG + Intergenic
1172023509 20:31932708-31932730 AGGTTTGGTACTGGGTGTGGTGG + Intronic
1172398480 20:34628193-34628215 AGAAATCTGACTGGGTGTGGTGG + Intronic
1172412027 20:34731740-34731762 AGAGACAAGACTGTGTGTGGTGG + Intronic
1172555229 20:35834987-35835009 AGGTAGGAGGCCGGGTGTGGTGG + Intronic
1172559783 20:35876681-35876703 AGGTCTCAGGCTGGGCGTGGTGG + Intronic
1172651456 20:36505485-36505507 TGGTTTTAGGCTGGGTGTGGTGG + Intronic
1172686471 20:36759266-36759288 AAATAAAAGGCTGGGTGTGGTGG - Intronic
1172696517 20:36826663-36826685 AGGAATGAGGCTGGGTGTGGTGG - Intronic
1172735589 20:37124863-37124885 ATATACAAGGCTGGGTGTGGTGG + Intronic
1173473955 20:43345465-43345487 AGTTCTCAGGCTGGGTGTGGTGG - Intergenic
1174012636 20:47462884-47462906 AAGGAGAAGGCTGGGTGTGGTGG + Intergenic
1174158764 20:48535452-48535474 AGGTATAAGGCCGGGCATGGTGG - Intergenic
1174509244 20:51038541-51038563 AAAAATAAGACTGGGTGCGGTGG + Intergenic
1174802357 20:53575054-53575076 AAGAATAAGGCTGGGTATGGTGG + Intronic
1174914667 20:54642414-54642436 AAGAATTAGGCTGGGTGTGGTGG + Intronic
1175091956 20:56512132-56512154 GGGTCTAAGACTGGGCGCGGTGG - Intronic
1175673018 20:60922135-60922157 AGGTATGACTCTAGGTGTGGTGG - Intergenic
1175839401 20:62017266-62017288 AGGTTTGACATTGGGTGTGGAGG - Intronic
1176368975 21:6051265-6051287 AGGTATGGGGCTGGGGGTGGTGG - Intergenic
1176659958 21:9624779-9624801 AGGATTAAGCATGGGTGTGGTGG + Intergenic
1176722521 21:10403766-10403788 AGCTATCAGGCTGGGCGTGGTGG - Intergenic
1177325738 21:19586481-19586503 AGGTGTGAGGCAGGGTGTGGTGG + Intergenic
1177721179 21:24908946-24908968 AGAAATAAGGCCGGGTGTGGTGG + Intergenic
1178446824 21:32652486-32652508 ATGTATTAGGCTGGGTGCGGTGG - Intronic
1178541482 21:33454834-33454856 GGGAATAACACTGGGTGTGGTGG + Intronic
1178542228 21:33463002-33463024 AGGTAGAAGGCTGGGCATGGTGG + Intronic
1178562071 21:33647781-33647803 AGATCCATGACTGGGTGTGGTGG - Intronic
1178602860 21:34009876-34009898 AGATATATCACTGGGTGTGGTGG + Intergenic
1179304996 21:40145555-40145577 TGGTATAAGGCTGGGCGCGGTGG + Intronic
1179754544 21:43487276-43487298 AGGTATGGGGCTGGGGGTGGTGG + Intergenic
1179812081 21:43878165-43878187 AGCTTGAAGACCGGGTGTGGGGG - Intronic
1179841758 21:44080824-44080846 AAGAAAAAGACTGGGTGCGGTGG - Intronic
1180303702 22:11056527-11056549 AGCTATCAGGCTGGGTGTGGTGG - Intergenic
1180623489 22:17178304-17178326 AGCTTAAAGACTGGATGTGGTGG + Intergenic
1181564593 22:23727436-23727458 CTGTTTAAGGCTGGGTGTGGTGG - Intergenic
1181584092 22:23843511-23843533 AAGAGTAAGGCTGGGTGTGGCGG + Intergenic
1181693148 22:24577283-24577305 AAGAATAAGACTGGGGGTGGTGG + Intronic
1182057180 22:27368764-27368786 AGGTTTGAGGCTGGGTGTGGTGG - Intergenic
1182215758 22:28716158-28716180 ATGTATGAGGCTGGGTATGGTGG - Intronic
1182309850 22:29396874-29396896 AAGTTTCAGGCTGGGTGTGGTGG - Intronic
1182340313 22:29614894-29614916 AGAAATTAGGCTGGGTGTGGTGG + Intronic
1182367972 22:29791390-29791412 AAGAAGAAGGCTGGGTGTGGTGG + Intronic
1182497882 22:30723390-30723412 ATAAATAAGGCTGGGTGTGGTGG - Intronic
1182556205 22:31129828-31129850 GGCTCTAAGGCTGGGTGTGGTGG - Intronic
1182577683 22:31284189-31284211 AGGGATTAGGCTGGGTGTGGTGG - Intronic
1182733853 22:32516651-32516673 AGGTATCAGGCCAGGTGTGGTGG - Intronic
1183205498 22:36416183-36416205 AGAAAAAAGACCGGGTGTGGTGG - Intergenic
1183388911 22:37532416-37532438 AAAAATAAGGCTGGGTGTGGTGG - Intergenic
1183432706 22:37775195-37775217 AGGTAGAAGACTGCCTTTGGAGG + Exonic
1183439290 22:37814248-37814270 AAATAAAAAACTGGGTGTGGTGG - Intronic
1183730952 22:39618105-39618127 AGGTGTGTGACTGGGTGTGTGGG + Intronic
1183833636 22:40434432-40434454 AGCTGTGAGGCTGGGTGTGGTGG + Intronic
1183893078 22:40947011-40947033 AGAAATAAGGCTGGGCGTGGTGG - Intergenic
1184016578 22:41790370-41790392 AGTTTTAAGACCGGGTGCGGTGG - Intronic
1184080857 22:42219094-42219116 AAGTAATAGGCTGGGTGTGGTGG + Intronic
1184081828 22:42226993-42227015 ATTTTTAAGACTGGGCGTGGTGG + Intronic
1184139465 22:42570132-42570154 AGGCCCAAGGCTGGGTGTGGTGG + Intronic
1184199182 22:42953971-42953993 AGGCATGAGGCTGGGTGCGGTGG + Intronic
1184367517 22:44061902-44061924 AAGAATCTGACTGGGTGTGGTGG - Intronic
1185252699 22:49813507-49813529 AAATAAAAGGCTGGGTGTGGTGG - Intronic
949564085 3:5229039-5229061 AGGGGTAAGGGTGGGTGTGGGGG + Intergenic
950130106 3:10536813-10536835 AAGTAAGAGGCTGGGTGTGGTGG - Intronic
950607794 3:14098903-14098925 AAGTGTAAGTCTGGGTGTGGTGG + Intergenic
950787079 3:15445820-15445842 TGGTTTAAGGCCGGGTGTGGTGG - Intronic
951127571 3:19001838-19001860 AGCTGCAAGACTGGGTGTGGTGG - Intergenic
951216483 3:20030085-20030107 AGTTAAAAGACTGGGCGCGGTGG + Intergenic
951330224 3:21358396-21358418 AGGTATGAGACTGTGTTTGCAGG + Intergenic
951669012 3:25159711-25159733 AGGTCTCAGAATGGGAGTGGAGG + Intergenic
951771959 3:26268017-26268039 AACTATAAGACTGGGTGTGGTGG - Intergenic
951868068 3:27329537-27329559 AGGTTTAAAACTGGTTCTGGTGG + Intronic
952599018 3:35056254-35056276 AAGAATAAGGCTGGGCGTGGTGG - Intergenic
952771316 3:37003638-37003660 AAATATAAGGCTGGGTGGGGTGG - Intronic
952789252 3:37186187-37186209 ATGTACAGGGCTGGGTGTGGTGG + Intergenic
953617933 3:44508709-44508731 AGCTAAAAGGCTGGGTGCGGTGG + Intronic
953655860 3:44854095-44854117 AACTATAGGGCTGGGTGTGGTGG + Intronic
954182602 3:48893381-48893403 AGGTCCATGGCTGGGTGTGGTGG + Intronic
954884906 3:53864247-53864269 AGGTTTAAGGCAGGGTGCGGTGG + Intronic
955171017 3:56565576-56565598 AATTATATGGCTGGGTGTGGTGG - Intronic
955183890 3:56696757-56696779 CAGTTTAAGGCTGGGTGTGGGGG - Intergenic
955227289 3:57071372-57071394 AGGCATATGGCTGGGCGTGGTGG + Intronic
955246658 3:57231050-57231072 TTGTAGAAGACTGGGCGTGGTGG + Intronic
955278355 3:57569641-57569663 AAGTATTAGGCTGGGTGGGGTGG - Intergenic
955309244 3:57867971-57867993 AAACATAAGGCTGGGTGTGGTGG + Intronic
955493966 3:59511847-59511869 AGCTATAACACTCGCTGTGGAGG + Intergenic
955561103 3:60191957-60191979 AGGTAAAAGGCTGGGTGTGGTGG + Intronic
955686595 3:61555512-61555534 AGGATTAAGTTTGGGTGTGGTGG - Intergenic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
955693154 3:61609567-61609589 AGAAATAAGACTGGGTGTGGTGG + Intronic
956361683 3:68454697-68454719 AAGAATAAGTGTGGGTGTGGAGG - Intronic
956564615 3:70622029-70622051 TGGGATAAGAGTTGGTGTGGTGG + Intergenic
956676458 3:71737636-71737658 AAGAATTAGGCTGGGTGTGGTGG + Intronic
956708518 3:72020181-72020203 AGATACCAGGCTGGGTGTGGTGG - Intergenic
957008693 3:74980818-74980840 AGGTATAAGAAGAGGTGAGGAGG - Intergenic
957081248 3:75637793-75637815 AGATATTTGACTGAGTGTGGTGG + Intergenic
957286106 3:78219344-78219366 GAGTATAAGATTGGGTGTGTAGG + Intergenic
957575942 3:82008359-82008381 AATTATCAGGCTGGGTGTGGTGG - Intergenic
957591492 3:82205120-82205142 GGCTACAAGACTGGGAGTGGTGG + Intergenic
957957699 3:87209996-87210018 AGAAAAAAGGCTGGGTGTGGTGG - Intergenic
958058799 3:88450154-88450176 AAATATTAGGCTGGGTGTGGTGG - Intergenic
958999510 3:100946499-100946521 AGTTTGAAGGCTGGGTGTGGTGG + Intronic
959064725 3:101644771-101644793 AGGAATAAGGCTGGGCGCGGTGG - Intergenic
959534278 3:107467994-107468016 TGGAATGAGGCTGGGTGTGGTGG + Intergenic
959564121 3:107816817-107816839 GGGTTTTAGGCTGGGTGTGGTGG + Intergenic
959579328 3:107967989-107968011 ATATCTGAGACTGGGTGTGGCGG - Intergenic
959733565 3:109631595-109631617 AGGTGGTAGAGTGGGTGTGGGGG + Intergenic
961021672 3:123512734-123512756 AGGTATTAGACTGTGGTTGGAGG + Intronic
961053514 3:123767317-123767339 ATGCATGAGGCTGGGTGTGGTGG + Intronic
961193497 3:124982185-124982207 ATGTATATGACTGGGCGTAGTGG - Intronic
961245959 3:125453634-125453656 AGTTATCACGCTGGGTGTGGTGG - Intronic
961737499 3:129011261-129011283 ACGTATTGGACAGGGTGTGGTGG + Intronic
961859113 3:129900533-129900555 TTATATAAGGCTGGGTGTGGTGG + Intergenic
961917968 3:130397152-130397174 AGTTTTGAGGCTGGGTGTGGTGG - Intronic
962018885 3:131475370-131475392 AAGGATAAGGCTGGGTCTGGTGG + Intronic
962051331 3:131818812-131818834 AGGATTCAGGCTGGGTGTGGTGG + Intronic
962328524 3:134456556-134456578 AAGAATTAGGCTGGGTGTGGTGG + Intergenic
962559272 3:136589046-136589068 AAATACAAGGCTGGGTGTGGTGG - Intronic
963072158 3:141313150-141313172 AGGGATAAGGCTGGGAGTGGAGG - Intergenic
963159136 3:142132448-142132470 TGTTATAGGGCTGGGTGTGGTGG + Intronic
963329729 3:143900697-143900719 AGGTATCTGGCCGGGTGTGGTGG - Intergenic
963752265 3:149194524-149194546 AAGTATGTGGCTGGGTGTGGTGG - Intronic
963853059 3:150226789-150226811 AGGTATGCTACTGGGGGTGGGGG - Intergenic
964086939 3:152830482-152830504 AGGTTTAAATCTGGGTGTGTTGG - Intergenic
964121031 3:153183720-153183742 AAGGAAAGGACTGGGTGTGGTGG + Intergenic
964298105 3:155256197-155256219 AAATAGAAGGCTGGGTGTGGTGG - Intergenic
964374713 3:156037943-156037965 ATAGATAAGGCTGGGTGTGGTGG + Intronic
964629462 3:158794580-158794602 ATGAAGAAGACTGGGAGTGGGGG - Intronic
964693303 3:159478208-159478230 AGATTTAAGGCTGGGTGTGGTGG - Intronic
964788030 3:160421214-160421236 AATTATAGGGCTGGGTGTGGTGG - Intronic
965007948 3:163049929-163049951 AATTAAAAGACCGGGTGTGGTGG - Intergenic
965048792 3:163616620-163616642 ATATACAAGGCTGGGTGTGGTGG - Intergenic
965470348 3:169082305-169082327 ATGTACCAGGCTGGGTGTGGTGG - Intergenic
965545885 3:169915863-169915885 AGGGCTCAGGCTGGGTGTGGTGG - Intronic
965577672 3:170234316-170234338 AAGTATAAGGCTGGGCGTGGTGG - Intronic
965628706 3:170708409-170708431 AATAATAAGGCTGGGTGTGGTGG + Intronic
965792146 3:172401203-172401225 AAGAATAAGGCTGGGTGCGGGGG - Exonic
966196212 3:177316539-177316561 AAAAATAAGTCTGGGTGTGGTGG + Intergenic
966367603 3:179206625-179206647 AAGTAAAAGGCTGGGCGTGGTGG + Intronic
967043527 3:185715931-185715953 AGGAATCAGGCTGGGCGTGGTGG - Intronic
967240761 3:187437117-187437139 AGGTTTAGGAGTGGGTGTTGAGG + Intergenic
967410578 3:189162982-189163004 AGTTCTTAGGCTGGGTGTGGTGG + Intronic
967489003 3:190067130-190067152 AAGAATAAGGCTGGGTGTGGTGG - Intronic
967743331 3:193027185-193027207 AGGGAAGAGGCTGGGTGTGGTGG - Intergenic
968246437 3:197154013-197154035 AAAAATAAGGCTGGGTGTGGTGG + Intronic
968414753 4:421316-421338 AGTAATAGGGCTGGGTGTGGTGG - Intergenic
968560110 4:1275494-1275516 AAGAATAAGGCTGGGTGCGGTGG + Intergenic
968670741 4:1849833-1849855 AGGTTTCAGGCTGGGAGTGGTGG - Intronic
968738506 4:2313411-2313433 ATGTAAAAAAATGGGTGTGGTGG - Intronic
968863529 4:3192363-3192385 AGAGATGAGACTGGGCGTGGTGG - Intronic
969090639 4:4691656-4691678 AGAAACAAGACTGGGTGTGGTGG - Intergenic
969142016 4:5084022-5084044 AGGTAACAGACTGGGCATGGTGG - Intronic
969249244 4:5956275-5956297 AGGGATCAGCCTGGGTGAGGAGG - Intronic
970339971 4:15095436-15095458 AGTTTTAGGGCTGGGTGTGGTGG - Intergenic
970429471 4:15975504-15975526 AGCTTTGAGGCTGGGTGTGGTGG - Intronic
970464922 4:16312802-16312824 AGGTTTGAGGCTGGGTGAGGCGG - Intergenic
970473638 4:16400913-16400935 AAATATCAGGCTGGGTGTGGTGG - Intergenic
971725423 4:30305645-30305667 ATGTATTAGACTGGGTCAGGAGG + Intergenic
972028265 4:34416142-34416164 TGATTTAAGGCTGGGTGTGGTGG + Intergenic
972045558 4:34661326-34661348 AATAATAAGGCTGGGTGTGGTGG - Intergenic
972191433 4:36596477-36596499 CAATATAAGGCTGGGTGTGGTGG + Intergenic
972532148 4:39971059-39971081 TGGAACAAGGCTGGGTGTGGTGG - Intronic
973023925 4:45241990-45242012 ACTTATAGGGCTGGGTGTGGTGG - Intergenic
973898853 4:55445881-55445903 AGGAATAAAGCTGGGTGTGGTGG - Intronic
973900839 4:55469381-55469403 ATATATAAGTCTGGGTGTGGTGG - Intronic
973963675 4:56138071-56138093 AGGTAGGAGAGTGGGTGGGGGGG - Intergenic
974009046 4:56590614-56590636 AACCATAAGGCTGGGTGTGGTGG - Intronic
974070426 4:57118527-57118549 AGGCATAAGGCCGAGTGTGGTGG + Intergenic
974497867 4:62656941-62656963 ATATATAAGGCTGGGTGTGGTGG + Intergenic
975131083 4:70833804-70833826 GGGAAAAAGGCTGGGTGTGGTGG - Intronic
975347244 4:73306217-73306239 AGGTGTTTGGCTGGGTGTGGTGG + Intergenic
975560574 4:75704918-75704940 AAAATTAAGACTGGGTGTGGTGG - Intronic
975571443 4:75822070-75822092 AAGTTTAAGGCTGGGCGTGGTGG - Intergenic
975867652 4:78740775-78740797 AGGAATCTGGCTGGGTGTGGTGG - Intergenic
975927506 4:79476394-79476416 TGGAACCAGACTGGGTGTGGTGG + Intergenic
976429160 4:84943212-84943234 CAGTATATGGCTGGGTGTGGTGG + Intronic
976573566 4:86641232-86641254 ATGCATAACACTGGGAGTGGCGG + Intronic
976881040 4:89925542-89925564 TGGTTTTAGGCTGGGTGTGGTGG + Intronic
976934765 4:90616391-90616413 ATGTTTTAGACTGGGTGTAGTGG + Intronic
977172329 4:93778683-93778705 TGATATAAGACTGGGCGTGGTGG - Intergenic
977210479 4:94212460-94212482 ATGTATAGGGCTGGGCGTGGTGG - Intronic
977594449 4:98863462-98863484 TGGTACAAGGCTGGGTGTGGTGG + Intergenic
977599322 4:98919019-98919041 AGTAAAAAGCCTGGGTGTGGTGG + Intronic
977642661 4:99374711-99374733 GGTTATAAGGCTGGGTGTGGTGG - Intergenic
978127738 4:105154735-105154757 AGGAATGTGACTGGGTGCGGTGG + Intronic
978440350 4:108727769-108727791 AGATTTAAGGCTGGGCGTGGTGG + Intergenic
978658095 4:111090833-111090855 AGATACAAGGCTGGGCGTGGTGG + Intergenic
978794765 4:112698178-112698200 ATTTAAAAGGCTGGGTGTGGTGG - Intergenic
978947158 4:114513830-114513852 ACATATTAGGCTGGGTGTGGTGG - Intergenic
979232787 4:118365316-118365338 ATGTTTATGGCTGGGTGTGGTGG - Intergenic
979323338 4:119350201-119350223 AGATATGAGACAGGGTGCGGTGG + Intergenic
979352261 4:119658051-119658073 ATGATTAAGGCTGGGTGTGGTGG + Intergenic
979511412 4:121557940-121557962 AGGTATAAGCCTTGTTGTGCAGG - Intergenic
979652782 4:123155363-123155385 AGGGATAAGACTGGGTGCAGTGG - Intronic
979690034 4:123550057-123550079 AGGAAGAAGGCTGGGCGTGGTGG + Intergenic
979911030 4:126365821-126365843 ATGTATAAGGCTGGGTGCGGTGG - Intergenic
980048644 4:128016485-128016507 TGCTTTAAGACTGGGCGTGGTGG + Intronic
980067663 4:128208038-128208060 AGGAAAAAGCCTGGGTGTGGTGG + Intronic
980118369 4:128703319-128703341 AAGTACAAGGCTGGGTATGGTGG - Intergenic
980246588 4:130253130-130253152 AGAGATGAGGCTGGGTGTGGTGG + Intergenic
980908716 4:138974676-138974698 AGATTTTAGGCTGGGTGTGGTGG + Intergenic
980919621 4:139070128-139070150 AATTACAAGGCTGGGTGTGGTGG - Intronic
980927898 4:139156919-139156941 AAGATTAAGGCTGGGTGTGGTGG - Intronic
981421987 4:144561566-144561588 AAGTACAAGGCTGGGTGTGGTGG - Intergenic
981731889 4:147908129-147908151 AGAAATAAGGCTGGGTGTGGTGG - Intronic
982143780 4:152359311-152359333 AGAAATGAGGCTGGGTGTGGTGG + Intronic
982359834 4:154507516-154507538 AGGAAGAAGGCTGGGTGTTGTGG - Intergenic
983066309 4:163213252-163213274 AGAAATCAGGCTGGGTGTGGTGG - Intergenic
983668026 4:170204381-170204403 AGGAATAAGACTGGGTGCAGTGG + Intergenic
984140701 4:176001517-176001539 AGGAATGTGACTGCGTGTGGCGG - Intronic
984192044 4:176617651-176617673 AGGTTCATGGCTGGGTGTGGTGG + Intergenic
984200926 4:176720549-176720571 TGGAATAAGACTGGGTGCAGTGG + Intronic
984369736 4:178847396-178847418 AGATATCAGGCCGGGTGTGGTGG - Intergenic
984879326 4:184396719-184396741 AGGAATCTGGCTGGGTGTGGTGG - Intronic
985222576 4:187723546-187723568 ATTTATTAGGCTGGGTGTGGTGG - Intergenic
985415416 4:189731627-189731649 AGGATTAAGCATGGGTGTGGTGG - Intergenic
985449648 4:190053322-190053344 AGATATTTGACTGAGTGTGGTGG - Intergenic
986536301 5:8791370-8791392 AGGTAAAAGCTTGTGTGTGGAGG - Intergenic
986769971 5:10963657-10963679 AGGTATGGGACTGGGAGTTGTGG + Intergenic
986795728 5:11210116-11210138 AGATATAAGATTGGGCGTGGTGG + Intronic
987028305 5:13950561-13950583 AAGAATACGGCTGGGTGTGGTGG - Intergenic
987041793 5:14069593-14069615 ATGTAATAGACTGGGTGTGGTGG - Intergenic
987109747 5:14674466-14674488 AGATAGAAGGCTGGGTGTGGTGG + Intronic
987119626 5:14754786-14754808 AGAAATGAGACTGGGCGTGGTGG + Intronic
987165527 5:15194247-15194269 AGGTAGAAGTCTGGGTGGAGAGG - Intergenic
987427195 5:17786838-17786860 TGGAATGAGGCTGGGTGTGGTGG - Intergenic
987429506 5:17815139-17815161 ATGTAATAGACTGAGTGTGGTGG - Intergenic
987513511 5:18874541-18874563 TGAAATAAGGCTGGGTGTGGTGG + Intergenic
987913049 5:24174544-24174566 ATGTATATGGCTGGGTGTGGTGG - Intronic
988121786 5:26973147-26973169 AAGTTTAAGACTAGGCGTGGTGG - Intronic
988542084 5:32119420-32119442 AGGGATGGGGCTGGGTGTGGTGG - Intergenic
988822808 5:34904306-34904328 ATGTAAACGGCTGGGTGTGGTGG + Intergenic
988858527 5:35252791-35252813 AGGCAGAGGACTGTGTGTGGGGG + Intergenic
988885773 5:35556443-35556465 AGGTCCAAGACTAGGTCTGGAGG - Intergenic
988966578 5:36424607-36424629 ATGTATAAGGCTGGGCATGGTGG - Intergenic
989059612 5:37397314-37397336 ACGTATGCGGCTGGGTGTGGTGG + Intronic
989143097 5:38221574-38221596 AGGTAAAAGAGTGGGGGAGGGGG - Intergenic
989266687 5:39482927-39482949 AGGTACAAAATTGGGGGTGGGGG - Intergenic
989569334 5:42930759-42930781 TATTAAAAGACTGGGTGTGGTGG - Intergenic
989577008 5:42997889-42997911 TATTAAAAGACTGGGTGTGGTGG - Intergenic
989601449 5:43204369-43204391 AACTATCAGGCTGGGTGTGGTGG - Intronic
989717872 5:44485899-44485921 AAGTGTAAGGCTGGGTGCGGTGG + Intergenic
989742021 5:44784598-44784620 AGAGATTAGGCTGGGTGTGGTGG - Intergenic
989979579 5:50627419-50627441 AAGTATAAGGCTGGGTGCAGTGG - Intergenic
989994983 5:50818664-50818686 AAATAAAAGGCTGGGTGTGGTGG - Intronic
990431658 5:55740805-55740827 TGTTATATGGCTGGGTGTGGTGG - Intronic
990453316 5:55958548-55958570 AGCAGTAAGGCTGGGTGTGGTGG + Intronic
990589136 5:57243974-57243996 AGGAAGTAGGCTGGGTGTGGTGG - Intronic
990703323 5:58498897-58498919 AGGGGTAAGACTGGGAGTGTGGG - Intergenic
991306522 5:65182156-65182178 AAGGATAAGCCTGGGTGCGGTGG + Intronic
991345313 5:65659694-65659716 AAGTAATAGGCTGGGTGTGGTGG + Intronic
991353456 5:65744283-65744305 AGGTAGCAGGCCGGGTGTGGTGG - Intronic
991377392 5:65980126-65980148 AAATATGATACTGGGTGTGGTGG + Intronic
991381793 5:66035804-66035826 AGTAATCAGACTGGGCGTGGTGG + Intronic
991430142 5:66535950-66535972 TAGTAAAAGACTGGGCGTGGTGG + Intergenic
991712664 5:69423181-69423203 AAATCTAAGGCTGGGTGTGGTGG - Intronic
991988369 5:72312903-72312925 CAGTATATGGCTGGGTGTGGTGG - Intronic
992122561 5:73609714-73609736 AGGGACAAGGCTGGGTGTGGTGG - Intergenic
992787980 5:80187995-80188017 AGGCAGAAGGCTGGGTGCGGTGG + Intronic
992902084 5:81307372-81307394 ATGTGTATGGCTGGGTGTGGTGG + Intronic
993248263 5:85480384-85480406 AGGAAGAAGGCTGGGTGTGGTGG - Intergenic
993951970 5:94187167-94187189 AGGACTAAGACTGGGGCTGGGGG + Intronic
994179624 5:96749831-96749853 AGTTTCAAGGCTGGGTGTGGTGG - Intronic
994243417 5:97450318-97450340 ATGGCTAAGGCTGGGTGTGGTGG - Intergenic
994504842 5:100629336-100629358 AGGAAACAGGCTGGGTGTGGTGG - Intergenic
994857663 5:105145130-105145152 ATCTATTAGGCTGGGTGTGGTGG - Intergenic
995515510 5:112950995-112951017 AGAAAAAAGGCTGGGTGTGGTGG - Intergenic
995591248 5:113702246-113702268 AAATATTTGACTGGGTGTGGTGG + Intergenic
995882236 5:116855974-116855996 AGTTCAAAGGCTGGGTGTGGTGG + Intergenic
996058164 5:119002863-119002885 AGAAATATGGCTGGGTGTGGTGG - Intergenic
996379808 5:122851452-122851474 AAGTCTAAGTCTGGGTGTGGTGG - Intronic
996399445 5:123045883-123045905 ATGTTTTAGGCTGGGTGTGGTGG - Intergenic
996439490 5:123473754-123473776 AGATTTAAGCCTGGGTGTGGTGG + Intergenic
996873016 5:128212937-128212959 AGGTTTAAGACTTGGTGGTGAGG + Intergenic
997417467 5:133740169-133740191 ATGTTTCGGACTGGGTGTGGTGG - Intergenic
997489567 5:134262290-134262312 AGATAAGAGGCTGGGTGTGGTGG + Intergenic
997496149 5:134327926-134327948 AGGTTTAATACTGTGTGTGTGGG + Intronic
997555421 5:134793690-134793712 AGTTTTCAGGCTGGGTGTGGTGG - Intronic
997730388 5:136168126-136168148 AGGAATATGGCTGGGTGCGGTGG - Intronic
998061730 5:139124035-139124057 AGGATTGAGGCTGGGTGTGGTGG - Intronic
998098761 5:139414428-139414450 AGGTACTAGACCAGGTGTGGAGG + Intronic
998219957 5:140269298-140269320 AGTTATAAGGCTGGGTGCTGTGG - Intronic
998272924 5:140723753-140723775 AAGAATGAGACTGGGTGCGGTGG - Intergenic
998344651 5:141451113-141451135 AATCATAAGGCTGGGTGTGGTGG - Intronic
998402462 5:141854957-141854979 AAGGATAAGGCTGGGTGCGGTGG - Intronic
998478625 5:142442728-142442750 TGGGATCAGGCTGGGTGTGGTGG - Intergenic
998738948 5:145176768-145176790 AGTTATCAGAATGGGTGAGGGGG + Intergenic
998810680 5:145963182-145963204 TGGAATAAGGCTGGGTGTGGTGG - Intronic
999081962 5:148853050-148853072 AAGGATCAGGCTGGGTGTGGTGG - Intergenic
999283434 5:150379782-150379804 GGGTATAGGGCTGGGCGTGGTGG + Intronic
999316780 5:150589349-150589371 ATCTGTAAGGCTGGGTGTGGTGG - Intergenic
999421236 5:151446242-151446264 AAGCATAGGACTGGGTATGGTGG + Intronic
999690265 5:154140419-154140441 AGGTATAAGACTGAGGCTGTAGG - Intronic
999812381 5:155140008-155140030 ATTTATCAGGCTGGGTGTGGTGG + Intergenic
999981977 5:156966544-156966566 AGGAATAAGCCTTGGGGTGGTGG + Intergenic
999998608 5:157116306-157116328 ATGGATAAGGCTGGGTGCGGTGG - Intronic
1000418253 5:161006717-161006739 AAATATTAGGCTGGGTGTGGTGG - Intergenic
1000723489 5:164738267-164738289 CTGTATATGGCTGGGTGTGGTGG + Intergenic
1000788703 5:165578056-165578078 GAATATGAGACTGGGTGTGGTGG - Intergenic
1000863670 5:166486706-166486728 AAGAATAAAACTGGGTGTGGTGG - Intergenic
1001065773 5:168534059-168534081 AAGTTTAAGACCGGGCGTGGTGG + Intergenic
1001200179 5:169708850-169708872 AGGAAGAAGGCTGGGTGTGGTGG - Intronic
1001207191 5:169775195-169775217 AGGCATATGGCTGGGTGTGGTGG - Intronic
1001387222 5:171349713-171349735 AGGTATAGGCCAGGGTGTGGTGG - Intergenic
1001743586 5:174072694-174072716 ATGAATAAGGCTGGGTGTGGTGG + Intronic
1001820142 5:174703922-174703944 AGGTGAGAGGCTGGGTGTGGTGG + Intergenic
1001841162 5:174877879-174877901 TTATATAAAACTGGGTGTGGTGG - Intergenic
1002035703 5:176467875-176467897 AACTAGAAGGCTGGGTGTGGTGG + Intronic
1002331542 5:178444505-178444527 CAGGACAAGACTGGGTGTGGTGG + Intronic
1002345989 5:178547742-178547764 GGGTATAGGTGTGGGTGTGGGGG - Intronic
1002364520 5:178699696-178699718 AGGTATCAGGCTGGTTGTGGTGG - Intergenic
1002371533 5:178758891-178758913 AAGTAATAGGCTGGGTGTGGTGG + Intergenic
1002545802 5:179944254-179944276 AGAAATAAGGCTGGGTGCGGTGG - Intronic
1003148435 6:3528337-3528359 AGTTTTAAGGCCGGGTGTGGTGG - Intergenic
1003625558 6:7738294-7738316 AGGTTCAGGAGTGGGTGTGGGGG - Intronic
1003702047 6:8477549-8477571 TGTTATAAGTTTGGGTGTGGTGG + Intergenic
1003860567 6:10318804-10318826 AGGTAAATAACTTGGTGTGGTGG + Intergenic
1004002828 6:11611160-11611182 AAATAAAAGGCTGGGTGTGGTGG + Intergenic
1004196145 6:13507040-13507062 AGAAATAAGACTGGGCGTGGTGG + Intergenic
1004262638 6:14121484-14121506 TTGTAATAGACTGGGTGTGGTGG + Intronic
1004420591 6:15466089-15466111 AGCAATAAGGCTGGGCGTGGTGG - Intronic
1004458586 6:15814534-15814556 TGGAATCAGGCTGGGTGTGGTGG - Intergenic
1004687576 6:17962037-17962059 TGGTAATAGGCTGGGTGTGGTGG + Intronic
1004992920 6:21159384-21159406 AGGAACAAGAATGGGTATGGAGG - Intronic
1005009782 6:21324426-21324448 ATATGTAAGGCTGGGTGTGGTGG - Intergenic
1005052218 6:21695334-21695356 AGGAATACAGCTGGGTGTGGTGG + Intergenic
1005053663 6:21709744-21709766 AGGCATGAGGCCGGGTGTGGTGG + Intergenic
1005326471 6:24706622-24706644 AAATTTAAGGCTGGGTGTGGTGG + Intronic
1005356549 6:24989580-24989602 AAGTACAAGGCTGGGTATGGTGG - Intronic
1005447392 6:25938812-25938834 AGGTCTAAGGTTGGGTGTGGCGG - Intergenic
1005718489 6:28576895-28576917 AAGTCTGAGACCGGGTGTGGTGG - Intronic
1005727567 6:28664692-28664714 AAAAATTAGACTGGGTGTGGTGG - Intergenic
1005926148 6:30447421-30447443 AGGCATATGAGTGAGTGTGGAGG + Intergenic
1006093402 6:31641460-31641482 AATCATAAGACTGGGAGTGGAGG + Intronic
1006137892 6:31907310-31907332 GGGTACAAGGCTGGGTGTGGTGG + Intronic
1006696265 6:35933019-35933041 GGGTAATAGGCTGGGTGTGGTGG + Intergenic
1006739330 6:36296021-36296043 ATGAACAGGACTGGGTGTGGTGG + Intronic
1006768515 6:36530652-36530674 AGGAAAAAGGCCGGGTGTGGTGG - Intronic
1006782387 6:36640801-36640823 AGGAGTAAGGCTGGGTGTGGTGG + Intergenic
1007040427 6:38716246-38716268 AGGTATATGGCCGGGCGTGGTGG - Intronic
1007066181 6:38992253-38992275 AAGTATGAGGCTGGGTGCGGTGG - Intronic
1007204612 6:40138613-40138635 AGGTATGTGACTAGGTGTGGGGG - Intergenic
1007429033 6:41765842-41765864 ATGTTCAAGGCTGGGTGTGGTGG + Intergenic
1007452277 6:41949192-41949214 AAGAAAAAGGCTGGGTGTGGTGG + Intronic
1007543223 6:42669209-42669231 AGTTACAAGCCTGGGTGCGGTGG - Intronic
1007689713 6:43692301-43692323 GGGTATCAGGCTGGGCGTGGTGG - Intergenic
1007966899 6:46011648-46011670 AGGGGTGAGACTGGGAGTGGAGG + Intronic
1008587937 6:52965927-52965949 AGCTTTCAGACTGGGAGTGGAGG - Intergenic
1008601600 6:53101500-53101522 AGAAATAGGGCTGGGTGTGGTGG + Intergenic
1008637894 6:53430366-53430388 AGGTCTAGGACTGAGTGTGGAGG + Intergenic
1008712066 6:54239481-54239503 AGTTTTGAGGCTGGGTGTGGTGG + Intronic
1008795111 6:55293656-55293678 AAGTATAAGGCCGGGTGTGGTGG + Intergenic
1009816292 6:68740269-68740291 AGTGATAAGTCTGGGCGTGGTGG + Intronic
1009952857 6:70416636-70416658 AGGAATAAGGTGGGGTGTGGTGG + Intronic
1010213903 6:73385021-73385043 AGGTTTGAGGCTGGGTGTGGTGG - Intronic
1010228352 6:73512764-73512786 ATATATAGGGCTGGGTGTGGTGG + Intergenic
1010232539 6:73547753-73547775 AGTTATCAGGCTGGGTGTGGTGG - Intergenic
1010255971 6:73758668-73758690 AGGTATGAGGCTGGGAGTAGTGG - Intronic
1010423701 6:75703166-75703188 AGGTTAATGACTGGGTGTGGTGG + Intronic
1010426680 6:75735369-75735391 AGGATTGAGGCTGGGTGTGGTGG - Intergenic
1010600437 6:77819016-77819038 AAATATCAGGCTGGGTGTGGTGG - Intronic
1010741375 6:79509165-79509187 AGGTTTATGGCTGGGCGTGGTGG + Intronic
1010792699 6:80083190-80083212 AGATATAGGGCTGGGTGTGGTGG - Intergenic
1011249932 6:85360391-85360413 AATTATAAGGCCGGGTGTGGTGG + Intergenic
1011310744 6:85976908-85976930 AGGCATAGGACTGGGTGCAGTGG - Intergenic
1011461782 6:87612893-87612915 AGGAGTCAGGCTGGGTGTGGCGG - Intronic
1011577923 6:88825028-88825050 AGACAGAAGGCTGGGTGTGGTGG - Intronic
1011697252 6:89923588-89923610 AAGTTTGAGGCTGGGTGTGGTGG + Intergenic
1011778206 6:90756001-90756023 AGGCATCAGGCTGTGTGTGGTGG - Intergenic
1011868070 6:91856585-91856607 AGGACTAAGAATGGGTATGGAGG - Intergenic
1012272086 6:97225856-97225878 AGAAATAAGGCTGGGCGTGGTGG - Intronic
1012780762 6:103554159-103554181 GGGTGTTAGACTGGGGGTGGTGG - Intergenic
1012932247 6:105329439-105329461 AATTATAAGGCTGGGCGTGGTGG - Intronic
1012937722 6:105385832-105385854 AATTGTCAGACTGGGTGTGGTGG + Intronic
1012993661 6:105951272-105951294 AGGAATAAGGCCAGGTGTGGTGG + Intergenic
1013026955 6:106284640-106284662 ATGTACAAGGCTGGGTGTGGTGG - Intronic
1013129881 6:107222816-107222838 AGGTTGTAGACTGGGTGTGGTGG + Intronic
1013156902 6:107500810-107500832 AAATTTAAGGCTGGGTGTGGTGG - Intronic
1013500981 6:110751119-110751141 AAGTATTGGGCTGGGTGTGGTGG - Intronic
1013525856 6:110973181-110973203 ATGTATCAGGCCGGGTGTGGTGG - Intergenic
1013743226 6:113313948-113313970 AAGTAGTAGACTGGGTGTGGTGG - Intergenic
1014251007 6:119115673-119115695 GGGTATATGGCAGGGTGTGGTGG + Intronic
1014477173 6:121888324-121888346 AAGGATAGGGCTGGGTGTGGTGG + Intergenic
1014822198 6:126002905-126002927 AGGTATCATACTGTGTGTGTTGG + Intronic
1014923563 6:127242658-127242680 AAATACAAGGCTGGGTGTGGTGG + Intergenic
1015091330 6:129362748-129362770 GGGTATAGGGCTGGGGGTGGTGG + Intronic
1015528922 6:134201345-134201367 AGAAATAAGGCTGGGTGTGGTGG - Intronic
1015533274 6:134242196-134242218 AGGAATAAGGCTGGGCGCGGTGG + Intronic
1015596939 6:134875011-134875033 AGTTAGAAGGCCGGGTGTGGTGG - Intergenic
1015944849 6:138489477-138489499 AGGAAGATGGCTGGGTGTGGAGG + Intronic
1016476880 6:144437239-144437261 AAATAAAAGGCTGGGTGTGGTGG - Intronic
1017019033 6:150125462-150125484 AGAAATGAGGCTGGGTGTGGTGG - Intergenic
1017144345 6:151220559-151220581 ATAAATAAGGCTGGGTGTGGTGG + Intergenic
1017212387 6:151871130-151871152 AAGTTGAAGGCTGGGTGTGGAGG - Intronic
1017683885 6:156892175-156892197 AAGTATGAGGCCGGGTGTGGTGG - Intronic
1017796679 6:157850966-157850988 AGTGATAAGGCTGGGCGTGGTGG + Intronic
1017923875 6:158894206-158894228 AGGAACCAGGCTGGGTGTGGTGG - Intronic
1017943902 6:159078052-159078074 AGTTATTAGGCTGAGTGTGGTGG - Intergenic
1017983458 6:159422483-159422505 AGAGATAAGACTGCGTGTGGGGG - Intergenic
1018394547 6:163367782-163367804 AGGAAGAACACTGGGGGTGGGGG - Intergenic
1018479440 6:164174985-164175007 AGGGAAAAGGCTGGGTGCGGTGG + Intergenic
1019988426 7:4675324-4675346 AGGTAAGAGCCTGGGTATGGTGG + Intergenic
1020190831 7:5996264-5996286 AGATCTTAGGCTGGGTGTGGTGG + Intronic
1020227707 7:6293212-6293234 ATATATATGGCTGGGTGTGGTGG - Intergenic
1020595576 7:10203404-10203426 AGCTATATGGCTGGGCGTGGTGG - Intergenic
1020904289 7:14045572-14045594 TTGTTTAAGACTGAGTGTGGTGG - Intergenic
1021153724 7:17183307-17183329 AGGTATGTGGCTGGGTGCGGTGG + Intergenic
1021256824 7:18402488-18402510 AAGTAAAAGACTGAGTGAGGTGG + Intronic
1021646747 7:22796410-22796432 AGGTTTAAGGCTGGGCATGGTGG - Intergenic
1021888264 7:25161981-25162003 AATTATAAGGCTGGGAGTGGTGG + Intronic
1022371138 7:29772745-29772767 AGAGTTAAGACTGGGTGCGGTGG + Intergenic
1022429538 7:30302991-30303013 AAGTCTAAGGCTGGTTGTGGTGG + Intronic
1022614240 7:31912396-31912418 AGATAAAAGGCCGGGTGTGGTGG + Intronic
1022663754 7:32389502-32389524 AGCTATCAGGCTGGGCGTGGTGG - Intergenic
1023002253 7:35822347-35822369 AAGTATTAGGCTGAGTGTGGTGG - Intronic
1023415901 7:39932168-39932190 AATAATGAGACTGGGTGTGGTGG + Intergenic
1023435744 7:40138984-40139006 AGGAATCAGGCTGGGCGTGGTGG + Intronic
1023448598 7:40257586-40257608 AAATTTAAGACTGGGTGTGGTGG + Intronic
1023846691 7:44124803-44124825 AAATATAAGGCTGGGCGTGGTGG - Intergenic
1023883193 7:44333258-44333280 AAAAAAAAGACTGGGTGTGGTGG + Intronic
1024275010 7:47670413-47670435 AAAAACAAGACTGGGTGTGGTGG + Intergenic
1024734706 7:52292258-52292280 AGATATAGGGCCGGGTGTGGTGG - Intergenic
1025079938 7:55972813-55972835 TGGAATATGGCTGGGTGTGGTGG + Intronic
1025173162 7:56779919-56779941 TGGTAAAAGGCTGGGTGTGGTGG + Intergenic
1025215534 7:57052939-57052961 AGGTACAAGGCTGGGTGTGGTGG - Intergenic
1025615151 7:63111942-63111964 ACGTATATGGCTGGGCGTGGTGG - Intergenic
1025626285 7:63225364-63225386 AGGTACAAGGCTGGGTGTGGTGG - Intergenic
1025655842 7:63517762-63517784 AGGTACAAGGCTGGGTGTGATGG + Intergenic
1025698945 7:63798259-63798281 TGGTAAAAGGCTGGGTGTGGTGG - Intergenic
1025751914 7:64301270-64301292 GAGTCAAAGACTGGGTGTGGTGG + Intergenic
1025830648 7:65046232-65046254 TGGTAAAAGGCTGGGCGTGGTGG - Intergenic
1025913590 7:65847665-65847687 TGGTTTCAGGCTGGGTGTGGCGG + Intergenic
1025917813 7:65880139-65880161 TGGTAAAAGGCTGGGCGTGGTGG - Intronic
1025955273 7:66177921-66177943 GGGTCTGGGACTGGGTGTGGTGG + Intergenic
1026061453 7:67030340-67030362 ATATATATGGCTGGGTGTGGTGG + Intronic
1026095375 7:67342319-67342341 AGGAAACAGGCTGGGTGTGGTGG + Intergenic
1026144173 7:67731423-67731445 AGGAAAATGGCTGGGTGTGGTGG - Intergenic
1026188771 7:68105438-68105460 AGTTAAAGGGCTGGGTGTGGTGG - Intergenic
1026190099 7:68117888-68117910 AGGTACAAGACTGGGTATGGTGG - Intergenic
1026348158 7:69492869-69492891 AGTTTTCAGACTGGGTGAGGTGG - Intergenic
1026572538 7:71544078-71544100 AGTTAAAAGGCTGGGTGAGGTGG - Intronic
1026621914 7:71956983-71957005 AAGTATAGGGCTGGGTGTGGTGG - Intronic
1026655777 7:72255373-72255395 AGAAAAAAGGCTGGGTGTGGTGG - Intronic
1026716897 7:72797092-72797114 ATATATATGGCTGGGTGTGGTGG - Intronic
1026822898 7:73561498-73561520 TGGTGTCAGGCTGGGTGTGGTGG - Intergenic
1026887608 7:73962480-73962502 AAGTAGGAGGCTGGGTGTGGTGG - Intergenic
1026958337 7:74392534-74392556 AAGTAAAAGGCTGAGTGTGGTGG + Intronic
1027057087 7:75057258-75057280 AGCTGGAAGGCTGGGTGTGGTGG - Intronic
1027130550 7:75587367-75587389 AGGTAGATGGCTGGGTGCGGTGG - Intronic
1027226871 7:76249096-76249118 GGGTGTAAGACTGGGCATGGTGG + Intronic
1027227069 7:76250519-76250541 ATGACTAAGACTGGGTGTGGTGG - Intronic
1027399006 7:77788273-77788295 GGGAATAAGACTGGGCATGGTGG + Intergenic
1027690406 7:81337738-81337760 AAGAATTAGGCTGGGTGTGGTGG - Intergenic
1028540569 7:91938663-91938685 AAATAAAATACTGGGTGTGGTGG - Intergenic
1028697194 7:93728258-93728280 AAGTTGAAGGCTGGGTGTGGGGG - Intronic
1029134710 7:98361067-98361089 AGATAAGAGGCTGGGTGTGGTGG + Intronic
1029157286 7:98526235-98526257 AGGCATATCACTGGGTGTGCAGG - Intergenic
1029241260 7:99164808-99164830 AAGTCTCAGACCGGGTGTGGTGG + Intergenic
1029329967 7:99844781-99844803 TGGTTTAAGGCTGGGTGCGGTGG + Intronic
1029463378 7:100709578-100709600 AAAAATAAGGCTGGGTGTGGTGG + Intergenic
1029624690 7:101713316-101713338 ATATATGAGGCTGGGTGTGGTGG - Intergenic
1029689694 7:102173070-102173092 AAATATGAGACTGGGTGTGGTGG + Intronic
1029806323 7:103001095-103001117 ATATATAGAACTGGGTGTGGTGG - Intronic
1030533189 7:110735505-110735527 ATGAATGAGGCTGGGTGTGGTGG + Intronic
1030599658 7:111579241-111579263 ATGAATAAGGCTGGGTGTAGTGG + Intergenic
1030681929 7:112443297-112443319 TGGTTGTAGACTGGGTGTGGTGG + Intronic
1031295830 7:120002472-120002494 AGGTATAGGGCTGGGCATGGTGG - Intergenic
1031458717 7:122017857-122017879 ATGTATCAGGCTGGGCGTGGTGG - Intronic
1031602001 7:123721636-123721658 AGACTTAAGGCTGGGTGTGGTGG + Intronic
1031765144 7:125768813-125768835 ATGAATATGTCTGGGTGTGGTGG - Intergenic
1032437924 7:131916861-131916883 ACAAATAAGGCTGGGTGTGGTGG + Intergenic
1032702515 7:134395088-134395110 ACGTATCAGGCTGGGCGTGGTGG + Intergenic
1033225261 7:139557252-139557274 AGTAATGAGGCTGGGTGTGGTGG + Intergenic
1033314965 7:140289604-140289626 AGAAACAAGGCTGGGTGTGGTGG + Intergenic
1033395750 7:140972216-140972238 GGGGGGAAGACTGGGTGTGGTGG - Intergenic
1033586852 7:142780560-142780582 AGGCATGAGACTGGGAGTGGGGG - Intergenic
1033798071 7:144871095-144871117 AGAAAGAAGGCTGGGTGTGGTGG - Intergenic
1034298106 7:149991950-149991972 AGGTTTGAGGCTGGGAGTGGTGG - Intergenic
1034298119 7:149992090-149992112 AGGTTTGAGGCTGGGAGTGGTGG - Intergenic
1034486220 7:151365109-151365131 ATTTAGAAGGCTGGGTGTGGTGG - Intronic
1034626799 7:152499675-152499697 AGCTACATGGCTGGGTGTGGTGG + Intergenic
1034713175 7:153215007-153215029 AAAAATAAGACTGGGTGCGGTGG - Intergenic
1034807916 7:154104903-154104925 AGGTTTGAGGCTGGGAGTGGTGG + Intronic
1034807923 7:154104973-154104995 AGGTTTGAGGCTGGGAGTGGTGG + Intronic
1035020742 7:155798623-155798645 AGGCATGAGAGTGGGTATGGAGG - Intergenic
1035142048 7:156772558-156772580 AAATAAAAGGCTGGGTGTGGTGG + Intronic
1035154883 7:156904330-156904352 ATGCCTAAGGCTGGGTGTGGTGG - Intergenic
1035173943 7:157037301-157037323 ACAAAGAAGACTGGGTGTGGTGG - Intergenic
1035182437 7:157099097-157099119 AGAAAAAAGGCTGGGTGTGGTGG - Intergenic
1035717949 8:1768229-1768251 AAGTTTCAGGCTGGGTGTGGTGG - Intronic
1035879394 8:3228053-3228075 ATGTTTTAGTCTGGGTGTGGTGG - Intronic
1036486934 8:9188033-9188055 AGGTCTCGGACTGGGAGTGGTGG - Intergenic
1036948355 8:13117182-13117204 GGAAATTAGACTGGGTGTGGTGG + Intronic
1037176602 8:15953694-15953716 AGATTCAAGGCTGGGTGTGGTGG - Intergenic
1037524063 8:19707711-19707733 AGCTATAAGGCCGGGTGTGGTGG + Intronic
1037608182 8:20455073-20455095 AGAAAAAAGGCTGGGTGTGGTGG - Intergenic
1037708526 8:21336072-21336094 AGGTTTTACTCTGGGTGTGGTGG - Intergenic
1037867354 8:22456533-22456555 TGGTATACTACTGTGTGTGGTGG - Intronic
1037932103 8:22887476-22887498 CCAAATAAGACTGGGTGTGGTGG + Intronic
1038026164 8:23592625-23592647 AGGTTTTAGACTGGGAGTGGTGG + Intergenic
1038052066 8:23823428-23823450 AGGTGCCAGGCTGGGTGTGGTGG + Intergenic
1038173091 8:25156543-25156565 TTATATAAGGCTGGGTGTGGTGG + Intergenic
1038177001 8:25189646-25189668 AAGAATAAGGCTGGGTGTGGTGG - Intronic
1038499663 8:28032870-28032892 AGCTCTGAGGCTGGGTGTGGTGG + Intronic
1038931990 8:32203647-32203669 ATGAATGAGGCTGGGTGTGGTGG - Intronic
1039056181 8:33538647-33538669 AGCTATATGGGTGGGTGTGGTGG - Intergenic
1039237250 8:35515395-35515417 AGATTTAGGGCTGGGTGTGGTGG + Intronic
1039381528 8:37090237-37090259 ATGTTTTAGGCTGGGTGTGGTGG + Intergenic
1039479931 8:37865054-37865076 AAATGTAAGGCTGGGTGTGGTGG - Intronic
1039585676 8:38705175-38705197 AGGTAAAAGGCGGGGGGTGGGGG - Intergenic
1039609917 8:38911685-38911707 AAATTTAAGGCTGGGTGTGGTGG + Intronic
1039645942 8:39283109-39283131 ATGGAAAAGACTGGGTGTGGTGG + Intronic
1040874795 8:52140240-52140262 ATGAATTAGACTGGGCGTGGTGG + Intronic
1040999782 8:53439156-53439178 AGGTATGCCACTGGTTGTGGGGG + Intergenic
1041071533 8:54130438-54130460 TGATAAAAGGCTGGGTGTGGTGG + Intergenic
1041297176 8:56369510-56369532 AGCTTTGAGGCTGGGTGTGGTGG + Intergenic
1042100031 8:65265702-65265724 AGATAGCAGGCTGGGTGTGGTGG - Intergenic
1042118524 8:65458777-65458799 AAATAGAAGATTGGGTGTGGAGG + Intergenic
1042289601 8:67155506-67155528 TGATATTAGGCTGGGTGTGGTGG + Intronic
1042553081 8:70011616-70011638 AAGAATAAGGCTGGGTGTGGTGG - Intergenic
1042613380 8:70622192-70622214 ACATATAAGTCTGAGTGTGGTGG - Intronic
1043467581 8:80527462-80527484 TGATACAAGTCTGGGTGTGGTGG - Intergenic
1043495540 8:80796706-80796728 AGGAAGAAGACTGGGTGTGGTGG + Intronic
1043537212 8:81218873-81218895 AGGTATTTGGCTGGGAGTGGTGG - Intergenic
1043645001 8:82506808-82506830 AGGTATCTGGCTGGGTGTGGTGG + Intergenic
1043712874 8:83444893-83444915 AGGTAACAGCCCGGGTGTGGTGG + Intergenic
1043736840 8:83758857-83758879 AGAAATGAGACTGGGTGCGGTGG + Intergenic
1043887434 8:85618012-85618034 AGATATTCGGCTGGGTGTGGTGG - Intergenic
1044813302 8:96085853-96085875 AGGTATTAGGCTGGGCGCGGTGG + Intergenic
1044996851 8:97845625-97845647 AGGTCTAACACTGGGTGTGGGGG - Intronic
1045006385 8:97920037-97920059 AGGTATAGGGCAGGGAGTGGTGG + Intronic
1045129033 8:99127436-99127458 AGGTAAAATAGTGGGGGTGGGGG - Intronic
1045255272 8:100514925-100514947 GGGAATAAGGCTGGGTGTGGTGG - Intronic
1045784119 8:105901482-105901504 ACATATAAGACTGGGTGTGCTGG - Intergenic
1045828025 8:106424223-106424245 AAGAATCAGACTGGGTGTGGTGG - Intronic
1045989403 8:108287898-108287920 AGGTTTTAGGCTGGGTGCGGTGG + Intronic
1046049651 8:109008165-109008187 AAGCAAAAGACTGGGTGAGGTGG + Intergenic
1047287877 8:123503924-123503946 AGAAATTAGCCTGGGTGTGGTGG + Intronic
1047334698 8:123924255-123924277 AAGTATATGGCTGGGTGCGGTGG + Intronic
1047383403 8:124385611-124385633 AAATATGAGGCTGGGTGTGGTGG + Intergenic
1047410735 8:124622505-124622527 AGGTAAATGACTGGGTGCAGTGG + Intronic
1047508912 8:125501479-125501501 AGATAGAAGCCTGAGTGTGGAGG + Intergenic
1047742233 8:127815836-127815858 AGATGTAAGGCTGGGTGTGGTGG + Intergenic
1047747824 8:127858101-127858123 TGGTCTTAGGCTGGGTGTGGTGG + Intergenic
1047955748 8:129973992-129974014 AGGCATAGTACCGGGTGTGGGGG - Intronic
1048655183 8:136528236-136528258 AAGTCTGAGACTGAGTGTGGTGG - Intergenic
1048988324 8:139747413-139747435 AGGTGTCAGAGTGGGTGTGGAGG + Intronic
1048988362 8:139747559-139747581 AGGGGTCAGAGTGGGTGTGGGGG + Intronic
1048988395 8:139747678-139747700 AGGGGTCAGAGTGGGTGTGGGGG + Intronic
1048988427 8:139747796-139747818 AGGGGTCAGAGTGGGTGTGGGGG + Intronic
1048988488 8:139748033-139748055 AGGGGTCAGAGTGGGTGTGGGGG + Intronic
1048988521 8:139748152-139748174 AGGGGTCAGAGTGGGTGTGGGGG + Intronic
1049061653 8:140280719-140280741 GGGTATCAGGCTGGGCGTGGTGG - Intronic
1049542746 8:143215855-143215877 AGGGTGAGGACTGGGTGTGGGGG - Intergenic
1049648083 8:143745705-143745727 ATGAATGAGGCTGGGTGTGGTGG - Intergenic
1049898827 9:138609-138631 ATATATAAGGCTGGGTGTGGTGG + Intronic
1050346038 9:4688283-4688305 ATGTATGAGGCCGGGTGTGGTGG - Intronic
1050518993 9:6477235-6477257 AAAAAAAAGACTGGGTGTGGTGG + Intronic
1050856552 9:10364286-10364308 AGGTAATAGACTGGGAGTGGTGG - Intronic
1051181552 9:14417176-14417198 AGATTTAAGGCCGGGTGTGGTGG - Intergenic
1051546740 9:18283941-18283963 AAGAAGAAGGCTGGGTGTGGTGG + Intergenic
1051623569 9:19077129-19077151 AGTTATAGGGCTGGGCGTGGTGG - Intronic
1052758036 9:32561614-32561636 ATATTTTAGACTGGGTGTGGTGG - Intronic
1052932878 9:34070092-34070114 AGTTAAAAGGCCGGGTGTGGTGG + Intergenic
1052950311 9:34204037-34204059 AGTTAAGAGACTGGGCGTGGTGG + Intronic
1053038967 9:34852898-34852920 AGGTACAGAGCTGGGTGTGGTGG - Intergenic
1053223976 9:36335563-36335585 AAATAAAAGGCTGGGTGTGGTGG - Intergenic
1053531277 9:38884008-38884030 AGTTAAAAGGCCGGGTGTGGTGG + Intergenic
1053578993 9:39383600-39383622 AGGTATGAGGCTGGGCATGGTGG + Intergenic
1053741880 9:41148920-41148942 ATTTATAAGGCTGGGTGTGGTGG + Intronic
1053796777 9:41733810-41733832 AGAGACAAGGCTGGGTGTGGTGG - Intergenic
1053843505 9:42211673-42211695 AGGTATGAGGCTGGGCATGGTGG + Intergenic
1054100576 9:60942404-60942426 AGGTATGAGGCTGGGCATGGTGG + Intergenic
1054121972 9:61218029-61218051 AGGTATGAGGCTGGGCATGGTGG + Intergenic
1054148413 9:61581059-61581081 AGAGACAAGGCTGGGTGTGGTGG + Intergenic
1054185190 9:61945885-61945907 AGAGACAAGGCTGGGTGTGGTGG - Intergenic
1054203501 9:62108440-62108462 AGTTAAAAGGCCGGGTGTGGTGG + Intergenic
1054347142 9:63978721-63978743 ATATATAAGACTGGGTGTGGTGG + Intergenic
1054444875 9:65305063-65305085 ATATATAAGGCTGGGTGTGGTGG + Intergenic
1054468159 9:65512153-65512175 AGAGACAAGGCTGGGTGTGGTGG + Intergenic
1054485396 9:65716443-65716465 ATATATAAGGCTGGGTGTGGTGG - Intronic
1054585771 9:66964482-66964504 AGGTATGAGGCTGGGCATGGTGG - Intergenic
1054634861 9:67479924-67479946 AGTTAAAAGGCCGGGTGTGGTGG - Intergenic
1054653319 9:67642611-67642633 AGAGACAAGGCTGGGTGTGGTGG + Intergenic
1054686463 9:68282380-68282402 ATTTATAAGGCTGGGTGTGGTGG - Intronic
1054928681 9:70614205-70614227 GGGATTAGGACTGGGTGTGGTGG + Intronic
1054976356 9:71150422-71150444 AGGTATAAGAGAGTGTGAGGAGG - Intronic
1055753524 9:79532610-79532632 ATGTTTTAGGCTGGGTGTGGTGG + Intergenic
1055756013 9:79557784-79557806 AGGCATGAGGCTGGGAGTGGTGG - Intergenic
1056151422 9:83793877-83793899 GGTCAGAAGACTGGGTGTGGTGG + Intronic
1056426506 9:86482735-86482757 AAGCAGAAGCCTGGGTGTGGTGG + Intergenic
1056447618 9:86681240-86681262 ATGTGTCAGGCTGGGTGTGGTGG + Intergenic
1056531253 9:87489770-87489792 AGGGAAAAGACTGGGCGTGGTGG - Intergenic
1056640717 9:88368222-88368244 AGATATAAGGCTGGGCATGGTGG + Intergenic
1056708417 9:88970795-88970817 TGGTATAAGGCCGGGCGTGGTGG - Intergenic
1057110074 9:92460964-92460986 AGGTACCAGGCTGGGTGTGGTGG - Intronic
1057426442 9:94954033-94954055 AGGCATAAAGCTGGGCGTGGTGG + Intronic
1057769791 9:97957642-97957664 CTGTATAAGGCCGGGTGTGGTGG + Intergenic
1057917112 9:99065406-99065428 AGGAAGAAGACGGGGGGTGGGGG + Intronic
1057959346 9:99439623-99439645 AAGTATCAGGCTAGGTGTGGTGG + Intergenic
1058154718 9:101502460-101502482 AGGTATTTGGCTGGGTGAGGGGG - Intronic
1058464990 9:105218107-105218129 AAATACAAGGCTGGGTGTGGTGG + Intergenic
1058694757 9:107549780-107549802 AGAATTAAGCCTGGGTGTGGTGG - Intergenic
1058725761 9:107802506-107802528 AGGAACAAGGCTGGGCGTGGTGG - Intergenic
1058883284 9:109303791-109303813 AAATAAAAGGCTGGGTGTGGTGG - Intronic
1059177317 9:112179213-112179235 ATTTTTAAGGCTGGGTGTGGTGG - Intergenic
1059288750 9:113202184-113202206 ATGTTTTAGGCTGGGTGTGGTGG - Intronic
1060178642 9:121516282-121516304 AGATATCAGGCTGGGTGTGGTGG - Intergenic
1060566894 9:124600929-124600951 AGTAATATGACTGGCTGTGGGGG + Intronic
1060606580 9:124920110-124920132 AAAAATAAGGCTGGGTGTGGTGG - Intronic
1060639267 9:125225095-125225117 AATAATAAGACTGGGTGTGGTGG + Intronic
1060710398 9:125858074-125858096 AGCATTAAGGCTGGGTGTGGTGG + Intronic
1061025677 9:128047783-128047805 AGGAATTAGGCTGGGTGAGGTGG + Intergenic
1061029842 9:128074419-128074441 AAGAATAGGGCTGGGTGTGGTGG + Intronic
1061187281 9:129062170-129062192 AGTTCTCAGGCTGGGTGTGGTGG - Intronic
1061369870 9:130192137-130192159 AGGTATGGGATTGGGAGTGGGGG + Intronic
1061437134 9:130571109-130571131 AGCAATTAGGCTGGGTGTGGTGG + Intergenic
1061464908 9:130770217-130770239 ATTTATAAGACTGGGTATGGTGG + Intronic
1061502100 9:131009727-131009749 AGGAATTAGGCTGGGTGCGGTGG + Intronic
1061504523 9:131024431-131024453 AGCTAAAAGGCTGGGTGCGGTGG - Intronic
1061514381 9:131080261-131080283 AGGAATGAGGCTGGGTGTGGTGG - Intronic
1061770297 9:132914569-132914591 ATGCTTAAGGCTGGGTGTGGTGG + Intronic
1061938064 9:133869273-133869295 AGAGATGGGACTGGGTGTGGTGG - Intronic
1062617401 9:137404017-137404039 AGCTCTGAGACTGGGTGGGGAGG + Intronic
1062706371 9:137946105-137946127 AGGGATATGACTGGGTGCAGTGG - Intronic
1203637521 Un_KI270750v1:126623-126645 AGGATTAAGCATGGGTGTGGTGG + Intergenic
1185808442 X:3081622-3081644 AAGAATCAGACTAGGTGTGGTGG - Intronic
1185864981 X:3615583-3615605 TGGTATATGACTGGGTGTGGTGG + Intronic
1185892950 X:3836373-3836395 AGCTACAAGACTCGGTGGGGAGG - Intronic
1185898059 X:3874793-3874815 AGCTACAAGACTCGGTGGGGAGG - Intergenic
1185903178 X:3913224-3913246 AGCTACAAGACTCGGTGGGGAGG - Intergenic
1185992572 X:4908350-4908372 AGTTATGTGGCTGGGTGTGGTGG + Intergenic
1186030730 X:5366386-5366408 ATGTCTAGGGCTGGGTGTGGTGG + Intergenic
1186299340 X:8182743-8182765 AAAGATAAGGCTGGGTGTGGTGG + Intergenic
1186574117 X:10747166-10747188 AGGTTGAAGACTGGATGTGATGG + Intronic
1186830177 X:13382287-13382309 AACTGTAGGACTGGGTGTGGTGG - Intergenic
1187326731 X:18297698-18297720 AAATAAAACACTGGGTGTGGTGG + Intronic
1187694847 X:21909114-21909136 AGATATTTGGCTGGGTGTGGTGG + Intergenic
1188031905 X:25273705-25273727 CTGTAGAAGGCTGGGTGTGGTGG + Intergenic
1188073016 X:25740508-25740530 AAATAAAAGACTGGGTGTGGCGG - Intergenic
1188080088 X:25828345-25828367 AAATATAAGGCTGGGTGTGGTGG - Intergenic
1188226227 X:27601410-27601432 AGTTATTAGGCTGGGCGTGGTGG + Intronic
1188316282 X:28677873-28677895 AGTAATCAGGCTGGGTGTGGTGG - Intronic
1188320398 X:28729708-28729730 AGGGATGAGGCCGGGTGTGGTGG + Intronic
1188381331 X:29496448-29496470 AGGAATAAGAAAGAGTGTGGAGG - Intronic
1188584237 X:31752801-31752823 ATGTTTATGAGTGGGTGTGGAGG - Intronic
1188758832 X:33999758-33999780 AGGGAACAGGCTGGGTGTGGTGG - Intergenic
1188901429 X:35737420-35737442 AACTATGAGGCTGGGTGTGGTGG + Intergenic
1189203187 X:39215434-39215456 AGGTAGAAGACTGGGTCTATTGG - Intergenic
1189554907 X:42132287-42132309 AAGTATAAGATTGGGAGTAGCGG + Intergenic
1189786679 X:44565194-44565216 AGGTAGTTGGCTGGGTGTGGTGG - Intergenic
1190005236 X:46730369-46730391 ATGGATGAGGCTGGGTGTGGTGG + Intronic
1190042504 X:47082598-47082620 AAGTTTAAGGCTGGGCGTGGTGG - Intronic
1190095814 X:47479807-47479829 AAGAATAAGGCTGGGTGCGGTGG + Intronic
1190597209 X:52061784-52061806 AGGTATAGCAATGGGTGTGCAGG + Intergenic
1190611615 X:52192289-52192311 AGGTATAGCAATGGGTGTGCAGG - Intergenic
1190716814 X:53111307-53111329 ATGTTTTAGGCTGGGTGTGGTGG - Intergenic
1190826560 X:54023262-54023284 GGTTATAAGGCTGGGCGTGGTGG - Intronic
1190832716 X:54073717-54073739 AGGTATCCGGCTGGGTGTGGTGG - Intronic
1190863886 X:54368579-54368601 ATGGAAAAGGCTGGGTGTGGTGG - Intergenic
1191692078 X:63950719-63950741 AAGTATATGGCTGGGCGTGGTGG - Intergenic
1191776653 X:64821879-64821901 AGGTATTAGACTGGGCGCGGTGG + Intergenic
1191832155 X:65427614-65427636 AGGGATGGGGCTGGGTGTGGTGG - Intronic
1192158979 X:68768848-68768870 AAGCAAAAGATTGGGTGTGGAGG - Intergenic
1192474298 X:71426426-71426448 AGGAAACAGGCTGGGTGTGGTGG + Intronic
1192485455 X:71521226-71521248 AGGTATAAGACTGGATGCAGTGG + Intronic
1192485530 X:71522059-71522081 AGGTATAAGACTGGATGCAGTGG + Intronic
1192485605 X:71522892-71522914 AGGTATAAGACTGGATGCAGTGG + Intronic
1193134913 X:77960091-77960113 AGGATTAAGGCTGGGCGTGGTGG + Intronic
1193947982 X:87762790-87762812 AACTATCATACTGGGTGTGGTGG + Intergenic
1194296043 X:92127806-92127828 AAGGGTAAGGCTGGGTGTGGTGG - Intronic
1194652674 X:96534082-96534104 AAGTTTCAGGCTGGGTGTGGTGG + Intergenic
1194766941 X:97852440-97852462 AGGTATGTGACCGTGTGTGGTGG + Intergenic
1195065835 X:101237381-101237403 AGGTAGAACCATGGGTGTGGAGG - Intronic
1195074109 X:101309959-101309981 AGGCATAAGGCTAGGTGTAGTGG - Intergenic
1195367692 X:104141873-104141895 AGTCCTAGGACTGGGTGTGGTGG - Intronic
1195595097 X:106679866-106679888 ATGTTTGAGGCTGGGTGTGGTGG + Intergenic
1195660543 X:107373691-107373713 AGAAAGAAGGCTGGGTGTGGTGG + Intergenic
1195928472 X:110049804-110049826 AGGTACATGACTGGGTGGAGAGG + Intronic
1196763542 X:119222427-119222449 AGTTATACGGCTGGGTGCGGTGG - Intergenic
1196828945 X:119761276-119761298 AAGTTTAAGGCTGGGTGTGGTGG + Intergenic
1198081565 X:133245069-133245091 ATGTCTAAGGCTGGGTGTGGTGG + Intergenic
1198406813 X:136321320-136321342 ATGTATATGAGTGTGTGTGGGGG + Intronic
1198470349 X:136940393-136940415 AGACATAAGGCCGGGTGTGGTGG - Intergenic
1199012337 X:142772013-142772035 GAGTATGAGGCTGGGTGTGGTGG - Intergenic
1199046511 X:143180910-143180932 ATGTGTAAGGCTGGGTGTGGTGG + Intergenic
1199774114 X:150996003-150996025 ATAAATAAGGCTGGGTGTGGTGG - Intergenic
1200277064 X:154743926-154743948 AGGTGAGAGGCTGGGTGTGGTGG + Intronic
1200613546 Y:5352407-5352429 AAGGGTAAGGCTGGGTGTGGTGG - Intronic
1200798918 Y:7367922-7367944 TGATATATGACTGGGTGTGGTGG - Intergenic
1201448177 Y:14081042-14081064 AAGATTAAGGCTGGGTGTGGTGG - Intergenic
1201576827 Y:15469952-15469974 AGTGATAAAGCTGGGTGTGGTGG + Intergenic
1202189151 Y:22223298-22223320 AAATAAAAGGCTGGGTGTGGTGG + Intergenic
1202266616 Y:23026129-23026151 AGAAATAAGGCTGGGTGTGGTGG - Intergenic
1202419609 Y:24659872-24659894 AGAAATAAGGCTGGGTGTGGTGG - Intergenic
1202451177 Y:25010212-25010234 AGAAATAAGGCTGGGTGTGGTGG + Intergenic