ID: 1081981184

View in Genome Browser
Species Human (GRCh38)
Location 11:47268339-47268361
Sequence ACTCACATGGGGATGGTGGA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 322
Summary {0: 1, 1: 0, 2: 0, 3: 32, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081981184_1081981195 16 Left 1081981184 11:47268339-47268361 CCATCCACCATCCCCATGTGAGT 0: 1
1: 0
2: 0
3: 32
4: 289
Right 1081981195 11:47268378-47268400 TTTTCCTCCTTCCCACACACAGG 0: 1
1: 1
2: 3
3: 35
4: 339

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081981184 Original CRISPR ACTCACATGGGGATGGTGGA TGG (reversed) Exonic
900228853 1:1545882-1545904 ACTGACTATGGGATGGTGGAGGG + Intronic
900802441 1:4745721-4745743 GGTCACGTGGGGATGGTGGGTGG + Intronic
900806155 1:4769590-4769612 ACTGACAGGGTGGTGGTGGAAGG + Intronic
900893587 1:5467171-5467193 CCTCACATGGGGCTGGCAGATGG - Intergenic
900984850 1:6067117-6067139 ACTTACATGGGGAGTGAGGAAGG - Intronic
901392661 1:8957151-8957173 ACTGTCATGCGCATGGTGGAGGG - Exonic
903018503 1:20377440-20377462 ACTCACATGGGGGTAGCGGTGGG + Intergenic
903622433 1:24707703-24707725 ACTGATTTGTGGATGGTGGATGG - Intergenic
904187253 1:28715171-28715193 ACTCGCATGTGGATGCTGAAGGG + Intronic
904593622 1:31629080-31629102 ACTCACATGGGGACTATGAACGG + Intronic
905408985 1:37755349-37755371 ACTCACATGATGGTGGTGGTGGG - Intronic
905901971 1:41587745-41587767 AATCACACGGGAATGGTGGCAGG + Intronic
906042136 1:42795800-42795822 ACTCACATGGGAATAATGGAAGG - Intergenic
907112186 1:51936194-51936216 GCTCAGATGAGGATGGGGGAAGG - Intronic
907538596 1:55190014-55190036 AATTAGCTGGGGATGGTGGAAGG + Intronic
907976903 1:59440011-59440033 ACTGAGATGGGAATGGTTGATGG - Intronic
909155593 1:72071539-72071561 ACTCTAATGGGGATGGTGACAGG - Intronic
909228080 1:73051227-73051249 ACTCAGGAGGGGAGGGTGGATGG + Intergenic
909555218 1:76946187-76946209 ATTTACATCAGGATGGTGGAAGG - Intronic
911362743 1:96899694-96899716 AATCACCTGGGCATGGTGGCTGG + Intergenic
914927130 1:151898226-151898248 ACAGACACGGGGATGTTGGAAGG + Intronic
915759479 1:158296050-158296072 ACTCACATGCTGGTGGTGGTGGG - Intergenic
916856353 1:168754228-168754250 GGTCACATGGAGGTGGTGGAGGG - Intergenic
916928456 1:169548718-169548740 AATTACATGGGGGTGGTGGCGGG + Intronic
917597471 1:176543652-176543674 CCACACCTGGGGATGGTGGAAGG + Intronic
918834737 1:189446784-189446806 ACTGTCATGGGGTTGGGGGAGGG + Intergenic
918844483 1:189592098-189592120 ACTCACATGATTATGGAGGATGG + Intergenic
921403547 1:214753545-214753567 ACACACATGGGCTTGGAGGATGG - Intergenic
921852526 1:219946546-219946568 ACTTACATGGGGACTGGGGAGGG - Intronic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
922645685 1:227284486-227284508 CCTCTCCTGGGGATGGTGGTGGG - Intronic
923109696 1:230880631-230880653 GTTCACATGGGCATTGTGGAAGG - Intergenic
1062931623 10:1356559-1356581 GCTGACCTGGGGATGATGGAGGG + Intronic
1063914963 10:10872114-10872136 ACCCACATGGGGAAGGTTGAGGG - Intergenic
1064816439 10:19270165-19270187 ACTTAGATGGGCATGGTGGTAGG + Intronic
1065607427 10:27432640-27432662 ACTCACATGGAGAGGGAGGGAGG - Intergenic
1065746177 10:28844582-28844604 ACTAACATGGGGAAGGTTGTGGG + Intergenic
1067666172 10:48281000-48281022 ACACACCTGGGCATGTTGGAGGG - Intergenic
1067851237 10:49755995-49756017 ACCCACCTGGGGATGGAAGAGGG - Intronic
1067944236 10:50680249-50680271 CCTCACATGGGGCTGGGGGAAGG + Intergenic
1068879761 10:62035971-62035993 AATTACATGGGCATGGTGGCGGG - Intronic
1070220965 10:74444133-74444155 ACTCATTTGGGCATAGTGGATGG - Intronic
1070580739 10:77717225-77717247 CCTCCCTGGGGGATGGTGGAGGG + Intergenic
1070582043 10:77728520-77728542 CCTCATAGGGGTATGGTGGATGG - Intergenic
1071646080 10:87361558-87361580 CCTCACATGGGGCCGGGGGAAGG + Intronic
1074200229 10:111228083-111228105 ACTCACACAGGGATGGTGACGGG - Intergenic
1074744905 10:116522881-116522903 ACTCTCCTGGGGAGGCTGGAAGG + Intergenic
1076716705 10:132369497-132369519 ACACAGATGGAGATGGTGAAAGG + Intronic
1077236112 11:1482732-1482754 ATTCCCATGGGGCAGGTGGACGG + Intronic
1078145999 11:8722228-8722250 ACTCGAATGGGGGTTGTGGAGGG - Intronic
1078692778 11:13598450-13598472 ACACACATGGGGGTGGGGGAAGG + Intergenic
1079108573 11:17590287-17590309 ACTCAGATGGGGAAGGCTGAGGG - Intronic
1079401180 11:20107613-20107635 ACTCAAATGGGCATGGGTGATGG - Intronic
1079446544 11:20561894-20561916 ACTCAAAGGGTGAGGGTGGAAGG + Intergenic
1080747140 11:35118461-35118483 ACTGACAGGGTGATTGTGGAGGG - Intergenic
1081643787 11:44776287-44776309 AGTCACATCTGGCTGGTGGAGGG + Intronic
1081865444 11:46357270-46357292 AGTCACAAGGGGAGGGTGGTGGG - Intronic
1081981184 11:47268339-47268361 ACTCACATGGGGATGGTGGATGG - Exonic
1082019932 11:47523760-47523782 ACTCATGAGGGGATGGGGGAGGG + Exonic
1082023763 11:47556291-47556313 ACTCACAAGGTTCTGGTGGAAGG - Intronic
1083878422 11:65536827-65536849 ACTCCCCCGGGGATGGTGAAGGG + Intronic
1083926925 11:65813018-65813040 ACACTAATGGGGATGGGGGAGGG + Intergenic
1083961438 11:66016963-66016985 ACTCCCATGGGGATCGGGGAAGG - Intronic
1085533137 11:77203314-77203336 GCACACATGGGGAGGGTTGATGG + Intronic
1085688883 11:78649763-78649785 ACTCACATGGGTTTGGTGGTGGG - Intergenic
1089340583 11:117754695-117754717 AGTCATATGGGGAAGGAGGAGGG + Intronic
1089400555 11:118161890-118161912 ACACAGATGGGGGTGGTGGCAGG + Intergenic
1089527114 11:119104384-119104406 ACCCTCCTGGGGAGGGTGGAAGG + Intronic
1089647800 11:119891714-119891736 ACTCCCATGGGCATGGTGCAGGG + Intergenic
1089740531 11:120579006-120579028 ACTCACAGAGGGATAGTGTATGG - Intronic
1093817031 12:23561466-23561488 ACTCACAGTGCCATGGTGGAAGG + Intronic
1093832251 12:23776624-23776646 TTTAACAGGGGGATGGTGGAAGG + Intronic
1094497572 12:30998075-30998097 ACACTCATAGTGATGGTGGAGGG - Intergenic
1094499373 12:31008644-31008666 CCTCCCAGGAGGATGGTGGAGGG - Intergenic
1095237392 12:39813754-39813776 ACTCACATTGAGATTGTAGATGG - Intronic
1097590894 12:61573940-61573962 ACTCACATGGAGGAGGTGGAAGG - Intergenic
1099060734 12:77904487-77904509 CCTGTCATGGGGTTGGTGGAGGG + Intronic
1099136715 12:78913828-78913850 ACATACATGGGGATATTGGAAGG + Intronic
1099624130 12:85046995-85047017 CCTCTCATGGGGTTGGGGGAGGG + Intronic
1100359387 12:93862081-93862103 CCTCACAAAGGCATGGTGGAAGG - Intronic
1100775936 12:97974466-97974488 GCTCACATGGGAATGGCTGAGGG + Intergenic
1102988319 12:117296726-117296748 AATCACATGGGGGTGGGGGATGG - Intronic
1103150287 12:118632378-118632400 ACTCACAGAGGGATGGAGGTGGG - Intergenic
1103559119 12:121783155-121783177 ACTTAGATGAGGATGGTGTAGGG - Intronic
1106588808 13:31080451-31080473 ACTCTCATGGGGCTGGAGGGAGG + Intergenic
1108825432 13:54407655-54407677 TCTCCAATGGGGAGGGTGGAGGG - Intergenic
1110198653 13:72821303-72821325 ACTGACATGGGGAGAGTAGAGGG + Intronic
1112019653 13:95360672-95360694 ACTCACACAGGGATGGGGGGAGG - Intergenic
1112177382 13:97039995-97040017 ACTCACCTGGGCCTGTTGGAGGG - Intergenic
1112494036 13:99891756-99891778 ACTAACATGAGAAGGGTGGAGGG - Exonic
1112605922 13:100905618-100905640 ACTCAAAGGGGAGTGGTGGAGGG - Intergenic
1113667319 13:112149732-112149754 CCTCACAGGGGGAAGGTGGTGGG - Intergenic
1115046493 14:29001100-29001122 AGTCACATGAGGAAGGTAGAAGG + Intergenic
1117728273 14:58695705-58695727 ACCCACATGTGGGTGGTTGATGG + Intergenic
1118730406 14:68662017-68662039 ACAGCCATGGGGATGGGGGAGGG - Intronic
1118946270 14:70390517-70390539 AATCACCTGGGCATGGTGGCAGG + Intronic
1121216729 14:92254258-92254280 AATTACATGGGCATGGTGGCGGG - Intergenic
1121347534 14:93147154-93147176 GCTCACATGGGCATGGTGAGTGG + Intergenic
1121633737 14:95439810-95439832 ACACACACGGTGAGGGTGGAGGG + Intronic
1123447052 15:20339101-20339123 ACAAACATGGGGGTGGTGGGTGG + Intergenic
1125610738 15:40968147-40968169 AATCAGCTGGGCATGGTGGAAGG + Intergenic
1125922613 15:43534529-43534551 AATCACATGTTGCTGGTGGAAGG + Exonic
1127009103 15:54603026-54603048 AGGCACATGGGAATGGAGGAAGG - Intronic
1128944938 15:71813700-71813722 GCACACATGGGGGTAGTGGAGGG - Intronic
1129042748 15:72704134-72704156 ACTGTCTTGGTGATGGTGGAGGG + Intronic
1129858247 15:78840568-78840590 AGTCACTTGAGGATGGGGGAAGG - Intronic
1130337730 15:82971765-82971787 ACTGATATGGGGGTGGGGGAGGG + Intronic
1131151864 15:90052229-90052251 AGTCACATGGGGATGAAGAAAGG - Intronic
1131360921 15:91789642-91789664 ACTCACAGAGGGATGGTGAGGGG + Intergenic
1131404433 15:92152787-92152809 ACTTACCTGGGGATGGTTCATGG - Intronic
1132015106 15:98308350-98308372 ACTCAGCTGGGGATGGTCGTGGG + Intergenic
1134017825 16:10901638-10901660 AGTCTGATGGGGATGGTGCATGG + Intronic
1134572825 16:15306254-15306276 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1134937875 16:18262124-18262146 CCTCATATGTGGAAGGTGGAAGG - Intergenic
1135235813 16:20754825-20754847 TCCCACATGAGTATGGTGGAGGG + Intronic
1135531257 16:23256712-23256734 TCTCATAAGGTGATGGTGGAAGG - Intergenic
1135668163 16:24353122-24353144 AATCAGCTGGGCATGGTGGAGGG - Intronic
1136738712 16:32491370-32491392 CCTGTCATGGGGACGGTGGAGGG - Intergenic
1136991820 16:35157199-35157221 ACTCAGAAGGGGAGGGTGGGAGG + Intergenic
1137551839 16:49442829-49442851 AATCACATGTGGTTGATGGAGGG + Intergenic
1138226783 16:55302764-55302786 AGTCACGTGGGGAAGGTGGAGGG - Intergenic
1138354568 16:56367068-56367090 ACTCAGATGGGGATGGCCTAGGG - Intronic
1139584397 16:67892539-67892561 ACTGAAATGGGGAAGATGGATGG + Intergenic
1139595271 16:67954160-67954182 GCTCCCATGGGGCTCGTGGAGGG + Intronic
1140608116 16:76564993-76565015 ACACTCATGGGGATGCTGCAGGG + Intronic
1140690301 16:77477398-77477420 CCTCACATGGTGAAGGTGGAGGG + Intergenic
1141455355 16:84137540-84137562 ACTCAGCTGGGGATGAAGGAGGG + Intronic
1142182227 16:88676897-88676919 TCGCTGATGGGGATGGTGGAAGG - Intergenic
1203014501 16_KI270728v1_random:340421-340443 CCTGTCATGGGGACGGTGGAGGG + Intergenic
1203032836 16_KI270728v1_random:613580-613602 CCTGTCATGGGGACGGTGGAGGG + Intergenic
1142712219 17:1729811-1729833 ACTTAGCTGGGCATGGTGGAGGG + Intronic
1142998122 17:3773340-3773362 ACTCAGATGGGCGTGGTGGCAGG + Intronic
1144493367 17:15732751-15732773 ACTCCTATGGGTGTGGTGGAGGG + Intronic
1144906895 17:18643901-18643923 ACTCCTATGGGTGTGGTGGAGGG - Intronic
1146015921 17:29233494-29233516 ACTCAGGAGGGGAGGGTGGAAGG - Intergenic
1147493439 17:40893319-40893341 ACTTAGATGGGCATGGTGGCAGG - Intergenic
1149009897 17:51845400-51845422 ACTCACATGGCCATGGCAGAAGG - Intronic
1149277991 17:55066370-55066392 AATCAGATGGGTATGGTGGCAGG - Intronic
1150473110 17:65454178-65454200 CCTCATGTGGGGAAGGTGGAGGG - Intergenic
1150627575 17:66851363-66851385 ATTCCCATGGGGATGGTTGAGGG + Intronic
1151179265 17:72313979-72314001 AGGAACTTGGGGATGGTGGAGGG - Intergenic
1151338670 17:73455900-73455922 ACTCACATGCGGCTGCTGGGCGG + Exonic
1151854032 17:76709328-76709350 CCTCACGCGGTGATGGTGGAGGG - Intronic
1153323297 18:3793798-3793820 ACTCACAAGGGGATAGTGTCAGG - Intronic
1153718966 18:7881835-7881857 ACACACATGGTCATGGTGAATGG - Intronic
1156127351 18:33922015-33922037 AATCATATGGGGAAGATGGAAGG + Intronic
1162001037 19:7745236-7745258 GTTCTCATGGGGATGGGGGAGGG - Intronic
1162153788 19:8663409-8663431 ACTGAGGTGGGGAAGGTGGAGGG + Intergenic
1162153807 19:8663467-8663489 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162153825 19:8663525-8663547 ACTGAGATGGGGAAGGTGGAGGG + Intergenic
1162534154 19:11253340-11253362 ACCTAGATGGGGATGGAGGAGGG - Intronic
1165462427 19:35952010-35952032 GCTACCATGGGGAGGGTGGATGG + Intergenic
1167051030 19:47078709-47078731 ACTCAGCTGGGCATGGTGGCTGG + Intronic
1167424677 19:49423882-49423904 AGTCAGATGGAGATGGAGGAGGG + Exonic
1168598606 19:57699822-57699844 ACTCAGATGGGCGTGGTGGCGGG + Exonic
925483340 2:4301306-4301328 ACTCCCATTGGGATGGTGTTAGG + Intergenic
925635182 2:5935652-5935674 TCTCATATGGGGATGGGGCAGGG - Intergenic
925788263 2:7454214-7454236 ACTTTCGTGGGGATGGAGGAAGG - Intergenic
926234994 2:11034372-11034394 ACTCAGAGGGGGAGGGTGGTTGG - Intergenic
927064789 2:19460545-19460567 CATCACCTGGGGATGGTGGATGG - Intergenic
927750486 2:25665283-25665305 ACTGACAGGGAGATGGTGGGAGG - Intronic
930603858 2:53472367-53472389 ACTCACATTGGGAATGAGGATGG + Intergenic
931018050 2:58008975-58008997 ACTCACAGGGAGAAGGTAGAAGG + Intronic
931778475 2:65560112-65560134 ACTTAGCTGGGCATGGTGGAGGG - Intergenic
932527267 2:72484416-72484438 ATTCAGCTGGGCATGGTGGAGGG + Intronic
933238995 2:79898280-79898302 ACTTACCTGGGCATGGTGGCGGG - Intronic
933722829 2:85409299-85409321 ACTGCCATGGGGCTGGGGGAGGG + Intronic
934724455 2:96606448-96606470 AGTCACATGAGGAGGGAGGAGGG + Intronic
935065762 2:99646110-99646132 ATTGACTTGGGGTTGGTGGAAGG - Intronic
935172123 2:100618404-100618426 ACTTAGATGGGTGTGGTGGAAGG - Intergenic
936032976 2:109086985-109087007 ACTCACATGTGCTTGGTTGAAGG + Intergenic
936115808 2:109702129-109702151 ACTCACGTGGGGCTGCTGGGTGG - Intergenic
937004365 2:118497616-118497638 ACTGAGATGGTGGTGGTGGATGG - Intergenic
937131931 2:119520348-119520370 AATTAGATGGGGATGGTGGCAGG + Intronic
938291822 2:130154641-130154663 GCTGACATGGGGAGGGCGGATGG + Intronic
938464726 2:131518323-131518345 GCTGACATGGGGAGGGCGGATGG - Intergenic
939859533 2:147401545-147401567 ACTCAGTTGTGGATGGTGGATGG - Intergenic
940339062 2:152560563-152560585 ACTAACATTGGTATGATGGAAGG - Intronic
943332878 2:186581187-186581209 AGTCTGATGGTGATGGTGGAGGG - Intergenic
944256504 2:197628057-197628079 AAGCACATGGGGAGGGTGGTGGG - Intronic
944674592 2:202024572-202024594 ACTCTCAAAGGGGTGGTGGAAGG - Intergenic
948366489 2:237458192-237458214 ACACCCATGGAGAGGGTGGAGGG - Intergenic
948746050 2:240095252-240095274 ACTGACTTGGGGAGGGTGGTGGG + Intergenic
948908002 2:240988984-240989006 GCACACATGGGGAGGGTGGCTGG + Intronic
1171035355 20:21709090-21709112 CCTCGCATGGGGATAATGGATGG + Intronic
1171204641 20:23269322-23269344 ATTCACATTGGGCTGGTGGCGGG + Intergenic
1171255002 20:23684030-23684052 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171262356 20:23745957-23745979 ACACACAAGGAGATGGTTGAGGG + Intergenic
1171271453 20:23821675-23821697 ACACACAGGGAGATGGTGGAGGG + Intergenic
1171432770 20:25094640-25094662 ACTTACCTGGGCATGGTGGCAGG + Intergenic
1172080430 20:32336451-32336473 ACTTTAATGGGGATGGAGGATGG + Intergenic
1172743014 20:37184065-37184087 AATCACATGGGGAAGGGCGAGGG - Intronic
1174116489 20:48230004-48230026 ACTCAGATGGGGATGCTTGCAGG + Intergenic
1176214022 20:63939749-63939771 ACTCCCATGGGGAGGGAGGGAGG - Intergenic
1178433344 21:32535801-32535823 ATTGACATGGGGCTGGTGGCTGG - Intergenic
1178924776 21:36765793-36765815 ACTTACCTGGGAATGGTGGCGGG - Intronic
1179718402 21:43301874-43301896 AATCACAGGGAGATGGTGGCTGG + Intergenic
1179938196 21:44618585-44618607 ACCCAGCTGGGGATGGGGGATGG - Intronic
1180059051 21:45375384-45375406 ACACACTTGGGGATGCTGGATGG + Intergenic
1181475839 22:23167318-23167340 ACTCACATTGTGAGGGTGCAGGG - Intergenic
1182739512 22:32557297-32557319 ATTCACAAGGGGAGGGGGGATGG + Intronic
1182848175 22:33448656-33448678 ACTGACATGGGGAAGGCTGAGGG - Intronic
1184224472 22:43121303-43121325 ACTCAGATGGGGAGGTTGGCAGG + Intronic
1184242229 22:43217254-43217276 ATCCACATGGAGATGTTGGATGG - Intronic
1184375223 22:44107762-44107784 ACACACATGGAGGTGCTGGAGGG + Intronic
1185362979 22:50420188-50420210 ACCCACATGGGGCTGGTGGGTGG + Intronic
951348074 3:21570749-21570771 ACGCACAGGGGTATGGTGGGAGG - Intronic
953775200 3:45810842-45810864 ACCCAAATGGGGATGTTGGGAGG - Intergenic
953847672 3:46440965-46440987 GCTCACATGGGGATGAATGAAGG + Intronic
954294824 3:49668461-49668483 AGTCACAAGGTGGTGGTGGAGGG - Exonic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
954820075 3:53318428-53318450 TGACAGATGGGGATGGTGGAGGG + Intronic
956799697 3:72745987-72746009 ACTTACCTGGGGGTGGTGGCGGG - Intergenic
958460782 3:94392025-94392047 ACTTACTTGAGGATGGTGGGTGG + Intergenic
959533132 3:107456223-107456245 AATCACCTGTGGCTGGTGGAAGG - Intergenic
960163611 3:114377189-114377211 ATTCACATGGTGATAATGGAAGG - Intronic
960854787 3:122091933-122091955 CATCCCATGGGGATGGGGGAAGG + Intronic
960942855 3:122945896-122945918 ACCCACATGGGCAAGGGGGATGG + Intronic
961593531 3:127998657-127998679 ATTCACATGGGGTTGGGGGTTGG - Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
962927395 3:140007611-140007633 ACTCTGAGTGGGATGGTGGATGG - Intronic
963183845 3:142391003-142391025 TCTCAAATGGGCATGGTTGATGG + Intronic
963398893 3:144771468-144771490 ACACACATGGGCATGAAGGATGG - Intergenic
965001027 3:162953630-162953652 ATTCACAGGGGAATGGTGGAAGG + Intergenic
965514040 3:169601472-169601494 TCTTACATGGGAATGTTGGATGG + Intronic
966240279 3:177748127-177748149 ACTGATCTGGGGATGATGGAGGG + Intergenic
966702685 3:182872959-182872981 AGTCACAGAGGGATGGTGAAGGG - Intronic
968964780 4:3764365-3764387 TGTGACCTGGGGATGGTGGAGGG - Intergenic
969583757 4:8080328-8080350 GATCCCATGGGGATGGTGGAGGG + Intronic
970567080 4:17341938-17341960 TCTCACATGGAATTGGTGGAGGG + Intergenic
972498871 4:39659164-39659186 AATCAGATGGGCATGGTGGCAGG - Intergenic
974174071 4:58303888-58303910 ACTCTCATGGCAATGGTGGGTGG - Intergenic
975746515 4:77480627-77480649 GCTCACATGGTTATGGTGGCTGG - Intergenic
976774470 4:88692340-88692362 ACACACATGGGGCTGGGGGGTGG + Intronic
977354936 4:95933489-95933511 ACCAAAATGGGGATGGGGGAGGG + Intergenic
977591420 4:98831863-98831885 CCTCACATGGGGAGGGTTGTGGG - Intergenic
978641675 4:110878255-110878277 ATTCACTTGGAGATGGTGGTAGG + Intergenic
980532200 4:134070578-134070600 ACTCACATGCCGCTGGAGGAGGG + Intergenic
982832796 4:160085436-160085458 ACTCACATGTGAAGGGTGGCAGG + Intergenic
983166148 4:164479066-164479088 ACTCACAAAGGGTTGGGGGAGGG + Intergenic
983462465 4:168045533-168045555 AGGCACAAGGGGATGGTGGGTGG - Intergenic
985585844 5:733604-733626 GCTCACATGGGAATGATGGTGGG - Intronic
985599507 5:819378-819400 GCTCACATGGGAATGATGGTGGG - Intronic
985600265 5:825016-825038 GCTCACATGGGAATGATGGTGGG - Intronic
985962905 5:3316340-3316362 ACCCTCATGGGGAAAGTGGAGGG - Intergenic
989158973 5:38371935-38371957 AGTTCCATGGGGAGGGTGGATGG - Intronic
989538616 5:42592415-42592437 ACCCACTTGGGGGTGGAGGATGG - Intronic
990796077 5:59542351-59542373 ACAGACATTGGGATGGAGGAAGG + Intronic
992368143 5:76114243-76114265 ATTCCCATGGTGATGGGGGATGG - Intronic
993237757 5:85336130-85336152 AATTACCTGGGCATGGTGGAGGG + Intergenic
994839916 5:104910294-104910316 CCACACACGGGGGTGGTGGAAGG + Intergenic
995678513 5:114690816-114690838 TCTCACATGGGTATGGTTTATGG + Intergenic
995857460 5:116608279-116608301 AATTACCTGGGCATGGTGGAAGG + Intergenic
996406914 5:123114468-123114490 AGTCTCAAGGGGATGCTGGAAGG - Intronic
999315933 5:150583997-150584019 ACTCACGTGGGGACTGTGAAAGG + Intergenic
999692402 5:154159471-154159493 ACACACATAAGGATGGTGGAGGG - Intronic
1001421915 5:171594015-171594037 AATCACCTGGGGTTGGGGGAGGG - Intergenic
1002433471 5:179217775-179217797 ACTCACTAGGGGATGGCGCAAGG + Intronic
1003174416 6:3744527-3744549 AGTGAGATGGGGAAGGTGGAGGG + Intronic
1004487976 6:16085816-16085838 TTTCACATAGGGCTGGTGGAAGG - Intergenic
1005882996 6:30074650-30074672 ACTGACAAGAGGATGGAGGAAGG - Intronic
1006016180 6:31082969-31082991 AATCAGCTGGGGATGGTGGCAGG + Intergenic
1006924319 6:37646121-37646143 AACCACATGAGGATGGTGAAAGG + Intronic
1008966025 6:57313633-57313655 AGTGAAATGGGGAGGGTGGAGGG + Intergenic
1009940122 6:70281125-70281147 TCACAGATGGGGATGGTGTAAGG + Intronic
1010544688 6:77137848-77137870 ACTGACATGGGGAGAGTGGATGG - Intergenic
1011312760 6:85998799-85998821 CCTGACATGGGGTTGGGGGAGGG - Intergenic
1014580614 6:123132672-123132694 AATTACCTGGGCATGGTGGAAGG + Intergenic
1014967169 6:127769777-127769799 ACTGTCATGGGGTTGGAGGATGG - Intronic
1017490798 6:154943315-154943337 AATTAGATGGGCATGGTGGAGGG + Intronic
1019411025 7:906817-906839 GGTCAGATGGTGATGGTGGATGG + Intronic
1019645151 7:2124967-2124989 ACACACATGGGCATGGCTGAGGG + Intronic
1021092438 7:16499516-16499538 ACTCTCATGGGGAAGGAGGATGG - Intronic
1021715459 7:23458033-23458055 ATTCAGATGGGGAAGCTGGATGG - Intronic
1024866764 7:53912095-53912117 ACACACATGGAGAAGGTGGTGGG - Intergenic
1025209850 7:57014197-57014219 ACTGAGGTGGGGATGGGGGAGGG + Intergenic
1025662101 7:63562654-63562676 ACTGAGGTGGGGATGGGGGAGGG - Intergenic
1026327480 7:69323212-69323234 AGTCACAAGGGGATGGTCTATGG - Intergenic
1027250844 7:76397827-76397849 CCTCACCTGGGGATGGGGGCGGG + Exonic
1027723129 7:81769964-81769986 ACCCACATGGTGCTGCTGGACGG + Exonic
1030921658 7:115397103-115397125 ACCCAGAAGGGGAGGGTGGAAGG - Intergenic
1033705409 7:143881707-143881729 ACTCCTATGGGGATGGTAGAGGG - Intronic
1033799977 7:144889569-144889591 AATCACATGGGGGTGGGGTAGGG - Intergenic
1033896509 7:146077590-146077612 ATAAACATGGGGAAGGTGGAGGG + Intergenic
1035454471 7:158998903-158998925 ACGCACGTGGGGAGTGTGGAGGG - Intergenic
1038707186 8:29905538-29905560 ACACACATGGGGAAGGGGGTAGG - Intergenic
1038783322 8:30587721-30587743 ACTCAGCTGGGCATGGTGGCGGG + Intronic
1039031872 8:33317891-33317913 ACTGACATGAGGATGAAGGATGG - Intergenic
1039511036 8:38092197-38092219 AACCAGATGGGGCTGGTGGAAGG - Intergenic
1039701455 8:39966175-39966197 AATTACATGGGCATGGTGGCGGG - Intronic
1040012520 8:42674308-42674330 ACTCACATGGTGACTGGGGAAGG - Intergenic
1040474977 8:47768185-47768207 ACTCAGCTGGGCATGGTGGCAGG + Intergenic
1040863282 8:52022822-52022844 GCTCACAAGGGGATGGGGGTAGG - Intergenic
1041180051 8:55237887-55237909 ACTACCCTGGGGATGGAGGAGGG - Intronic
1042938757 8:74086801-74086823 TCTCACATGGGGAAGGAGCAAGG - Intergenic
1044722163 8:95160913-95160935 ACTCACCTGGGGGTGGGGGAGGG + Intergenic
1045934686 8:107665030-107665052 TCCCATATGGGGTTGGTGGAAGG - Intergenic
1046624236 8:116560102-116560124 ACACACATGGCTTTGGTGGACGG + Intergenic
1047559925 8:125975797-125975819 CCACAGATGGGGATGGGGGATGG + Intergenic
1050014828 9:1222454-1222476 CCTCACTTGGTGAAGGTGGAAGG - Intergenic
1050443619 9:5694036-5694058 AATTATATGGGGAGGGTGGAGGG - Intronic
1051288511 9:15521437-15521459 ACTCACAGGGGGAGGTGGGATGG - Intergenic
1052350327 9:27451974-27451996 ACTCTCATAGTGAAGGTGGACGG + Intronic
1053309270 9:37005592-37005614 ACTCACACGGTGATGGGGAATGG - Intronic
1056287679 9:85107865-85107887 ACTCATATGGGCAGGGTGGAGGG + Intergenic
1058091818 9:100814027-100814049 ACCCCCATGGGGATGGTGGGGGG - Intergenic
1059557113 9:115292722-115292744 AACCAGATGGGGATGGTGGGCGG - Intronic
1060785734 9:126450502-126450524 CCTCACATGGGGATGGAGCAGGG - Intronic
1061904566 9:133690073-133690095 GCCCACTTTGGGATGGTGGACGG + Intronic
1186249411 X:7650057-7650079 AATCAGCTGGGGATGGTGGCAGG + Intergenic
1186809297 X:13171777-13171799 ACTCACCTGAGGATGGAGGTGGG + Intergenic
1187579567 X:20593536-20593558 ACTCCAATGGGGATGGCAGAAGG + Intergenic
1188078645 X:25808625-25808647 ACTGCCATGGGGCTGGGGGAGGG + Intergenic
1192146331 X:68685439-68685461 CCTGACTTGGGGATGGTGGGGGG - Intronic
1192212678 X:69137605-69137627 TCTCAAATGGGGCTGGGGGAGGG + Intergenic
1192215652 X:69156450-69156472 ACTCACCTGGGGTTGATGGCAGG + Intergenic
1194295597 X:92122786-92122808 ACTTACCTGGGAATGGTGGCGGG + Intronic
1194638444 X:96373969-96373991 ACTCACATGATTATGGAGGATGG - Intergenic
1197479482 X:126964799-126964821 CTTTACATGGGGATGGGGGAGGG + Intergenic
1198276779 X:135102056-135102078 CCTTACAAGGGGATGGGGGAGGG - Intergenic
1200149079 X:153942726-153942748 CCCCACCTGGGGAAGGTGGAGGG - Intronic
1202067924 Y:20960126-20960148 ACTCACATGGCAATGTTGCAAGG - Intergenic