ID: 1081981301

View in Genome Browser
Species Human (GRCh38)
Location 11:47268991-47269013
Sequence TGGGGCCCTGTGGGAAAAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 4, 3: 24, 4: 259}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081981301_1081981308 10 Left 1081981301 11:47268991-47269013 CCTGTTTTTCCCACAGGGCCCCA 0: 1
1: 0
2: 4
3: 24
4: 259
Right 1081981308 11:47269024-47269046 TCCACTGTCACTCTGTGGTATGG 0: 1
1: 0
2: 1
3: 8
4: 130
1081981301_1081981307 5 Left 1081981301 11:47268991-47269013 CCTGTTTTTCCCACAGGGCCCCA 0: 1
1: 0
2: 4
3: 24
4: 259
Right 1081981307 11:47269019-47269041 AATTCTCCACTGTCACTCTGTGG 0: 1
1: 0
2: 0
3: 12
4: 177

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081981301 Original CRISPR TGGGGCCCTGTGGGAAAAAC AGG (reversed) Intronic
900687522 1:3958298-3958320 TGGGGCACTGGGGGAAAAGGCGG - Intergenic
901001439 1:6150840-6150862 CAGGGCCGTGTGGGAAACACAGG + Intronic
901922158 1:12545081-12545103 TGGGGAACTGTGGGAAAGACAGG + Intergenic
901935305 1:12622438-12622460 TGAGGCCTGGTGGGTAAAACTGG + Intergenic
902393012 1:16117000-16117022 TGGGGATCTAAGGGAAAAACAGG + Intergenic
902606520 1:17572290-17572312 TGGGGCCTTGTGGGAATATCAGG + Intronic
902669668 1:17964390-17964412 TGGGGACCTGAAGGCAAAACTGG - Intergenic
902678235 1:18023943-18023965 TGGGGGTCTGAGGCAAAAACAGG + Intergenic
905033402 1:34902450-34902472 TGGTACCCAGTGGGAGAAACAGG + Intronic
905772943 1:40650005-40650027 TGAGGCCCTGGGGGAACATCAGG - Intronic
906126156 1:43428148-43428170 TGGGGCCCTGCGGGAGATACAGG + Intronic
906400348 1:45499810-45499832 TGGGGAACTGGGGGAAAAGCGGG + Exonic
907909511 1:58814398-58814420 TGGGGCCCTGCCGGGAAAAGAGG + Intergenic
907990723 1:59579723-59579745 CAGGGCCCAGTGGTAAAAACAGG - Intronic
912861155 1:113215089-113215111 TGGGGCCCTTTGAGCAAAGCTGG + Intergenic
914755379 1:150559116-150559138 TGGGGCCCTGTGAGAGAACTTGG + Exonic
915598366 1:156907899-156907921 TGGTGCCCTGTGGGGATAAGAGG - Exonic
915744929 1:158148552-158148574 TGGGACCCTGAGGAAAAATCAGG - Intergenic
916604408 1:166326661-166326683 AGAGGCCCTGTGGGAAAGACAGG + Intergenic
920417069 1:205806001-205806023 TGGGCTCCTGTGGGAGAAGCTGG + Intronic
920726460 1:208439854-208439876 TGGGGACTTGGGGGAAAAAGTGG - Intergenic
920758094 1:208754702-208754724 TGAGACCCTGTGCTAAAAACTGG + Intergenic
921409479 1:214819755-214819777 TGGGGACTTGAGGGAAAGACTGG - Intergenic
922759621 1:228119241-228119263 TGGAGCTCCTTGGGAAAAACAGG - Intergenic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
924884929 1:248204394-248204416 TGGGGACATGAGGGAAATACGGG - Intergenic
1065745023 10:28832496-28832518 TGAGGCTGTGTGGTAAAAACTGG - Intergenic
1069961193 10:72080504-72080526 TGGGGCCCAGTGGGGACACCTGG + Intronic
1070480238 10:76875185-76875207 TTGGGCCCTTTGGCAAAAGCTGG - Intronic
1072801605 10:98396018-98396040 AGGAGCTCTGTGTGAAAAACAGG - Intronic
1075953970 10:126506479-126506501 TGGGGGCCTGAGGGCATAACTGG + Intronic
1076394777 10:130130530-130130552 TAGGGCCCACAGGGAAAAACTGG - Intergenic
1076860395 10:133137045-133137067 TGGGTCCCTGTGGGGGCAACTGG + Intergenic
1077206725 11:1348373-1348395 TGGGGCCCTGTGGGTAGATGGGG - Intergenic
1077501635 11:2912152-2912174 TTGGGCACTGTGGCAAAAGCTGG + Intronic
1078082555 11:8214816-8214838 TGGGGCCCAGGGAGCAAAACGGG - Intergenic
1079030936 11:16986222-16986244 TGGGCCCCTGTAGGGAGAACAGG + Intronic
1080058414 11:27931643-27931665 TGGGACACCCTGGGAAAAACAGG - Intergenic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1081596729 11:44464358-44464380 AGGGGCCCAGTGGGAAAAAACGG + Intergenic
1081981301 11:47268991-47269013 TGGGGCCCTGTGGGAAAAACAGG - Intronic
1082880706 11:58034663-58034685 TGGGTCCCAGTGGGAAAGAAGGG + Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084039124 11:66531350-66531372 CTGGGCCCTGGGGGAAAACCAGG - Intronic
1084580345 11:70019460-70019482 AGGGGCACTGGGGGAAAACCTGG - Intergenic
1084801878 11:71549362-71549384 TGGGGGCATGTGGGAAAGAGGGG - Exonic
1088836363 11:113580869-113580891 TGGGGGAATGTGGGATAAACAGG - Intergenic
1089321228 11:117627963-117627985 ATGGGCTCTGTGGGAAATACAGG - Intronic
1089692944 11:120197997-120198019 TGGGGGCGGGTGGGGAAAACGGG - Intergenic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1096601769 12:52734696-52734718 CAGGGCCCTATGGGAACAACCGG + Intergenic
1096994237 12:55829071-55829093 TGCGGCCCTGGAGGAAAATCTGG + Intronic
1097505178 12:60458433-60458455 TTGGGCCCTCGGGGAAACACAGG - Intergenic
1100095308 12:91026800-91026822 TGGGGCCCAGTGGGAGATATTGG - Intergenic
1102587101 12:113931257-113931279 TGGGGCCTTGTGGGAGAGAGGGG - Intronic
1103012073 12:117465434-117465456 GAGGGCCCTTTGGGAAACACAGG + Exonic
1103946659 12:124531089-124531111 TGGGGCCCTGTGGGGATGGCTGG + Intronic
1104897980 12:132173559-132173581 AGGGGCACTGTGGGAAGAACAGG + Intergenic
1104962683 12:132495682-132495704 TGGGACTCTGTGGGAGGAACAGG - Intronic
1106495971 13:30275402-30275424 TGGGGCCTGGTGGGAGATACAGG - Intronic
1106669653 13:31890829-31890851 TGGGGCCCTGTGTAGAAAGCAGG + Intergenic
1106865437 13:33959371-33959393 AGGGGCCTTGAGGGAAGAACTGG - Intronic
1108602804 13:52009297-52009319 AAGGGCCCTCTGAGAAAAACTGG - Intronic
1108678602 13:52760138-52760160 TGGGGTCCTGTGGTGCAAACAGG + Intergenic
1110434450 13:75463795-75463817 TGGGGGAATGTGGGAGAAACAGG - Intronic
1110748930 13:79090275-79090297 AGGGGTCCTGTGGAGAAAACTGG - Intergenic
1111793979 13:92894421-92894443 TGGGGGCCTGTGAGAAACAGAGG - Intergenic
1112324164 13:98432407-98432429 CGTGGCCCCGTGGGAAAAGCAGG - Intronic
1113729168 13:112627282-112627304 TCGGGCGCTGTGGGCAGAACCGG - Intergenic
1117015467 14:51513095-51513117 TGGGGCACTCTGGGAAAGTCTGG - Intronic
1118723349 14:68609402-68609424 AGGGGCCCTGTGGGAAGGCCTGG - Intronic
1119305512 14:73604990-73605012 TGGGACTCATTGGGAAAAACAGG - Intergenic
1119387604 14:74267610-74267632 GGGGGCCCTGGGGGACCAACTGG - Intergenic
1121437743 14:93930063-93930085 TTGGTCCCTGTGGACAAAACAGG + Intergenic
1126299739 15:47182756-47182778 TGGAGCCCTGTGTGAGACACAGG + Intergenic
1127849859 15:62902926-62902948 TGGGCCCTTGTGGGAAAAACGGG + Intergenic
1128345471 15:66850093-66850115 TTGGGGCCTGTGGGAATAGCGGG + Intergenic
1128937338 15:71757978-71758000 TGGAGGGCTGTGGGAACAACCGG + Exonic
1129652883 15:77504178-77504200 GGGAGCCCTGTGGGAACAAGAGG + Intergenic
1131804545 15:96107698-96107720 TGGAGAACTTTGGGAAAAACTGG - Intergenic
1132904520 16:2275622-2275644 TGGGGCTGTGTGGGAAGCACAGG - Intergenic
1134028061 16:10969740-10969762 TGTTGCCCTGTGGGAAAAACAGG + Intronic
1136156916 16:28389145-28389167 TAGGGCCCTGTGGTAAGAAGTGG - Intronic
1136206170 16:28726136-28726158 TAGGGCCCTGTGGTAAGAAGTGG + Intronic
1138015504 16:53424816-53424838 TGGGACACCTTGGGAAAAACAGG - Intergenic
1138076736 16:54050061-54050083 TGGGGGCCTGTGGGGCAGACAGG + Intronic
1138291703 16:55853669-55853691 TGGGGCCCAGGGGAAACAACAGG - Intronic
1139531368 16:67544283-67544305 TGGAGGCCTGAGGGAAAAATGGG - Exonic
1140120834 16:72081866-72081888 TTGGGTCCTGAGGGAAAAAAGGG - Intronic
1142172388 16:88629735-88629757 TGGGGCCCAGATGGAAAGACAGG + Intronic
1143121204 17:4608113-4608135 TGGGGCCTCCTGGGAAGAACAGG - Exonic
1144869523 17:18360508-18360530 TGGAGTGCTGTGGGAAAATCTGG - Intronic
1146585323 17:34077151-34077173 TGTGGCTCTGTGGGTAATACCGG - Intronic
1148861403 17:50606181-50606203 TGGGGCACTGTGGGATGGACTGG - Intronic
1149091744 17:52791172-52791194 TATGGCTCTGTGGGAAACACTGG + Intergenic
1151691187 17:75686610-75686632 TGGGGCCCTCTGGGACACGCTGG - Intronic
1152724059 17:81936702-81936724 TGAGGCCCAGTGGGAGAGACTGG - Intronic
1152843305 17:82584165-82584187 TGGGGCGCTCTGGGCAAACCGGG - Exonic
1153797782 18:8640570-8640592 TAGGGCCCTGGGGGCAAAAAGGG - Intergenic
1154365352 18:13703017-13703039 TGGGACCCCTTGGGAAAAACAGG + Intronic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1155203843 18:23540142-23540164 TGGGGCCCTGGGGGGAAGACTGG - Intronic
1157228208 18:45887901-45887923 TAAGGCCCTGTGGGAAAATGTGG + Exonic
1158016374 18:52789234-52789256 TGGGGTTTTGTGAGAAAAACAGG + Intronic
1158331179 18:56364502-56364524 TGGGGACCTGTGGGGAAGAGTGG - Intergenic
1159455266 18:68653190-68653212 TGGTGACCTGTGGGAAAGGCAGG + Intergenic
1160705669 19:529042-529064 CGGGGCCCTGTGGGACCAGCTGG + Intergenic
1161456127 19:4370521-4370543 TGGGGCCCTGTGGGAGAGTGGGG - Intronic
1161699963 19:5789207-5789229 TGCGGCCCTGTGAGAAGAAGCGG - Exonic
1163190547 19:15673673-15673695 TTGGGGGCTGTGGGAAACACTGG - Exonic
1163741716 19:19018142-19018164 TGGAGCCCTGTGGACAGAACTGG + Intronic
1163756859 19:19111426-19111448 CGTGGCCATGTGGGAAATACTGG - Exonic
1164356624 19:27441251-27441273 TGGAGGGCTGTGGGAAAAAAAGG + Intergenic
1164454747 19:28397760-28397782 TGGGGCCCTGAAGGAAAAGGAGG + Intergenic
1165783580 19:38447892-38447914 TGGAGTCCTGTGGGAAAAGGAGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1166754251 19:45180609-45180631 TGGGTTCTTGTGGGAAGAACGGG - Exonic
1166824174 19:45599083-45599105 TGGGGGCCTGTGGGACAGACAGG - Intronic
1166986031 19:46660580-46660602 TGGGGCCTCGTGAGAAACACAGG - Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
925047610 2:785966-785988 TGGATCCCTGTGGGAAAAAGCGG + Intergenic
925290868 2:2748013-2748035 AGGGGCCCTCTGGGAAGACCAGG - Intergenic
927030798 2:19118690-19118712 TGGGGGCCTGAGGGAGAAGCAGG + Intergenic
927146036 2:20167364-20167386 TGGGTCCCTGTGGGGACATCTGG - Intergenic
927697164 2:25246495-25246517 AGGGGCCCAGTGGGAACAGCCGG - Intronic
928292757 2:30054068-30054090 TGCAGACCTGTGTGAAAAACAGG - Intergenic
928309853 2:30200483-30200505 TGGGACCCTGGAGGACAAACTGG + Intergenic
928575822 2:32653999-32654021 TGGGACCCTTGGGGAAGAACTGG - Intronic
929472798 2:42212741-42212763 TGGTGCCCTGGGAGAAACACTGG - Intronic
929863221 2:45696934-45696956 TGGGGCCCTGGGAGGAAAGCAGG - Intronic
930899333 2:56484558-56484580 TGGGGTCCCCCGGGAAAAACTGG - Intergenic
932544155 2:72689621-72689643 TCGGGCCCTGTGGCAAACTCCGG + Intronic
932804842 2:74774552-74774574 TGGGGGCCAGTGGCAAACACTGG - Intergenic
932907920 2:75774048-75774070 AAGGGACCTATGGGAAAAACAGG - Intergenic
933009618 2:77043180-77043202 TGTGGTTCTGTGGGGAAAACAGG + Intronic
933121175 2:78540335-78540357 TGTAGTCCTGTGGGAGAAACAGG + Intergenic
933874764 2:86608633-86608655 TGGTGGCCTGTGGAAAAAACGGG - Intronic
934758423 2:96840191-96840213 TGGGGGCCTGTCGGGAACACGGG - Intronic
935785511 2:106545035-106545057 TCGCCCCCTGTGGGAAACACAGG + Intergenic
935850244 2:107211324-107211346 TGGGGATCTGTGAGGAAAACAGG + Intergenic
936119024 2:109725534-109725556 TGGGGCTCTGTGGGAAGTAGTGG + Intergenic
938288484 2:130137241-130137263 TGGTGGCCTCTGGGAAAAGCAGG - Intergenic
939868927 2:147506121-147506143 TGCGGCTCTGTGGGAATATCAGG - Intergenic
941003330 2:160223054-160223076 TGGGGGCCTGTGGGGGAAGCTGG + Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
941895201 2:170621898-170621920 AGGGGACAGGTGGGAAAAACAGG - Intronic
943251176 2:185523291-185523313 AGAGGCCCAGTAGGAAAAACTGG + Intergenic
944377620 2:199065536-199065558 TGTGTCCCTTTGGGAAAAAAAGG - Intergenic
944664629 2:201949672-201949694 TGGAGTCCTGTGGGACAAATTGG - Intergenic
945639386 2:212404368-212404390 AGGGACACTGTGGGAACAACGGG - Intronic
946384556 2:219374707-219374729 TGGGGCCATGTAGGAAAACAAGG - Intronic
1168892331 20:1303067-1303089 TGGGTTCCTGTGGGAGTAACAGG - Intronic
1169051972 20:2586718-2586740 TGGGGCCTGGTGGGACATACTGG - Intronic
1171124017 20:22586386-22586408 TGGGACCCCGTGGGAAATGCTGG - Intergenic
1171173404 20:23034737-23034759 TGGTGAGCTGTGGGGAAAACTGG + Intergenic
1172461737 20:35124028-35124050 TGAGGCTCTGTGGGAGAAAGTGG + Exonic
1173247725 20:41347909-41347931 TGGGCCCCTGTGGGATGAAAAGG + Intronic
1173866100 20:46313526-46313548 TGGGGCCAGGTGGGAAAAACAGG + Intergenic
1173867440 20:46321597-46321619 TGGGGCACTGTGAGCAAAGCAGG - Intergenic
1174857772 20:54063434-54063456 CGGGCACCTGTGGGAGAAACTGG - Intronic
1175339257 20:58217628-58217650 TGGGACCCTGTAGGAACACCAGG + Intergenic
1175804520 20:61820136-61820158 CTGGGCCCTCTGGGCAAAACCGG - Intronic
1176009933 20:62887790-62887812 GGGGGCCCTGTTGGTAAAGCTGG + Intronic
1176311644 21:5153963-5153985 AGGGCCACTGTGGGAAACACAGG + Intronic
1177233775 21:18359139-18359161 TGGGGCCCGGTGGAATAAAGGGG + Intronic
1177731382 21:25031089-25031111 AAGGGTCCTTTGGGAAAAACTGG + Intergenic
1178462181 21:32812342-32812364 TAGGCCCCAGTGGGAAGAACAGG - Intronic
1179375275 21:40845137-40845159 TGGTGCCCTCTGGGAAAGATGGG + Intronic
1179802996 21:43820270-43820292 TGGGCCCGTGTGGGAAACACAGG - Intergenic
1179845406 21:44108072-44108094 AGGGCCACTGTGGGAAACACAGG - Intronic
1179902890 21:44402972-44402994 TGGGGCCCTGGGGGAGGCACCGG + Intronic
1183191704 22:36325728-36325750 TGGTGCGCTGTGGGGAAATCTGG + Intronic
1183343726 22:37295708-37295730 AGGGGCCCTGTGCAAGAAACCGG - Intronic
1183374874 22:37457375-37457397 AGGGGCCCTATGGGATAAAAGGG - Intergenic
1184458650 22:44625186-44625208 TGGGGCCCTGTGGGATTTAGGGG + Intergenic
1184838529 22:47038492-47038514 TGAGGCCCTGTGGGAGCAGCTGG - Intronic
949603745 3:5631753-5631775 TGGGTACCTGTGGGTCAAACTGG - Intergenic
950184395 3:10936393-10936415 TGTGGCCCTGGGGCAGAAACAGG - Intronic
952879622 3:37975368-37975390 GGAGGCCCCGTGGGAAAGACAGG + Intronic
953118585 3:40016620-40016642 TGGGGAGCAGTGAGAAAAACAGG - Intronic
953617885 3:44508332-44508354 TGGGGCCCTATGGGAAGAACTGG - Intronic
954618237 3:51981215-51981237 TGGTGTGCTGTGGGAAAGACGGG + Intronic
955077149 3:55624522-55624544 AGGTGCCCTGTGGGAAGAACAGG + Intronic
955136996 3:56228984-56229006 TTGGGGCTTGTGGGAAAAATAGG - Intronic
956502964 3:69907311-69907333 TGGGGCTCTGTGTGTCAAACTGG + Intronic
957580608 3:82067692-82067714 TGTGGGCCTGTGGGGAAAACTGG - Intergenic
960266695 3:115628235-115628257 TGGGGCTCTGGGGAAAACACGGG - Intronic
960875840 3:122294581-122294603 TGACGTCCTGTGAGAAAAACAGG + Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
961832859 3:129633153-129633175 CTGGGCCCTGTGGGAAACAGTGG + Intergenic
964302716 3:155307054-155307076 TGGGGACTTGGGGGAAAAAGTGG - Intergenic
968282686 3:197489270-197489292 TGGGGGCCGGTGGGAGAAGCAGG - Intergenic
968663603 4:1809238-1809260 TGGGGCCCTGGGGGCTACACAGG + Intergenic
970827861 4:20298507-20298529 TGTGGACCTGTGGGAACAGCAGG + Intronic
971781623 4:31042577-31042599 TGGGGTCCTGTGGGAAGCATTGG + Intronic
979509755 4:121538902-121538924 TGGGTTTCTGTTGGAAAAACAGG - Intergenic
979988370 4:127343547-127343569 TGGGGACCTGGGGGAAAGAGTGG + Intergenic
982186459 4:152806443-152806465 TGGGGGCCTGCAGGAAAAATAGG + Intronic
983423985 4:167558670-167558692 TGGGGACTTGGGGGAAAGACTGG - Intergenic
984421311 4:179525683-179525705 TGGGGCCCAGTGGAAATAATTGG - Intergenic
986668938 5:10126653-10126675 TGGGGCCCTGAGGAGAAAGCAGG - Intergenic
986866550 5:11995941-11995963 TGGGGGCCTGTGGGAAGATGGGG + Intergenic
986871294 5:12049825-12049847 TGGAGGCCTGTGGCAAAAGCTGG - Intergenic
987355214 5:17057768-17057790 TGGGGCAGTATGGGACAAACGGG + Intergenic
988568472 5:32340847-32340869 TGAGACCCTTTGGGAAAAACAGG - Intergenic
996263577 5:121505905-121505927 TGGGGCCTTGGGGGAAAAGGTGG + Intergenic
996626308 5:125574040-125574062 TGGGGTCCAGTTAGAAAAACTGG - Intergenic
998252822 5:140564164-140564186 AGGGGCCCGGTGGGAAGACCAGG - Intronic
999361781 5:150991869-150991891 TAGGGCACTGAGGGATAAACAGG + Intergenic
999541998 5:152584416-152584438 AGGTGCCCTGTGGGAAAAAAAGG - Intergenic
1000191772 5:158917944-158917966 TGGGTCCCTTTGGGAAGAAAGGG + Intronic
1001932003 5:175679830-175679852 TGAGACCCTGTTGGAAAGACAGG + Intronic
1002715331 5:181223569-181223591 TGGGGCCCCGCGGGGAAAAAGGG + Exonic
1004108764 6:12693586-12693608 TGAGGCCCTGTGTTAGAAACTGG + Intergenic
1005996025 6:30931989-30932011 TGGGTCCCTGTGGCAAGAAGAGG - Intronic
1006162760 6:32047798-32047820 TGGAGCCCAGTAGGAAATACAGG - Intronic
1006174275 6:32112572-32112594 TGGGTCCCTCTGGTAAATACAGG - Intronic
1007308140 6:40923257-40923279 TGGGGCTTTGTGGGAGACACTGG - Intergenic
1007400304 6:41599251-41599273 AGGGGCCCTGTGGGGAGAGCTGG - Exonic
1012252163 6:96991614-96991636 TGGGGACCTGTGTGGAAAACTGG + Intronic
1013177855 6:107692694-107692716 TGGGGCTCTGTGGGGAAGAGAGG - Intergenic
1014530971 6:122558904-122558926 TGGGGACTTGTGGGAAAAAGTGG - Intronic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1016099534 6:140081001-140081023 TTGGTCCCTGTGGGAAGAGCGGG + Intergenic
1019447890 7:1080969-1080991 GGGGGCCAGGTGGGAAGAACAGG + Intronic
1019497312 7:1346569-1346591 CGGGGCCCTGTGGGAGAACCCGG + Intergenic
1022235262 7:28454683-28454705 TGGGGCCCTGGGACAAACACTGG - Intronic
1023837086 7:44074524-44074546 TGGAGCCCTGGGGGCAACACCGG + Exonic
1023999567 7:45181689-45181711 TGAGGCCCTGTGGGAGAAGCAGG + Intronic
1024307498 7:47940692-47940714 TGGGGAGCTGTTGGACAAACAGG + Intronic
1024586809 7:50849370-50849392 TGGGGCCCTGCAGGAAAGAATGG + Intergenic
1028101830 7:86830278-86830300 TGGGGCCTTGTGGGAGACAGTGG - Intronic
1028651612 7:93156372-93156394 TGGGACCATGTTGGAAATACGGG + Intergenic
1029152939 7:98493750-98493772 TGGGGACCTGTGGGGAAGAGTGG - Intergenic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1032117697 7:129130477-129130499 TGGGGCAGTCTGGGATAAACTGG - Intergenic
1034224141 7:149469919-149469941 CAGGGGTCTGTGGGAAAAACAGG + Intergenic
1036142239 8:6219073-6219095 TGGGTCCCTTTGGGGAAGACTGG - Intergenic
1036706473 8:11050756-11050778 TGGGGACATGAGGGAAGAACAGG - Intronic
1037014184 8:13881963-13881985 TGGGTCACTGTGGTAGAAACAGG + Intergenic
1037386104 8:18343843-18343865 TGGGGCCTAGTGGGAAGCACTGG + Intergenic
1037440970 8:18915734-18915756 TGGAGCCATGTGGGAAGAAGGGG + Intronic
1037665394 8:20964675-20964697 TGTGGTCAGGTGGGAAAAACTGG + Intergenic
1039542403 8:38382568-38382590 TGGGGCCCGGGAGGTAAAACTGG + Intergenic
1039574586 8:38613034-38613056 TGAGGTCCAGTGGGAAAAAAGGG - Intergenic
1041298699 8:56388815-56388837 ATGGGGCCTGTGGGAGAAACAGG - Intergenic
1041365709 8:57101748-57101770 TGGGGACCTGGGGGAAAGAGCGG - Intergenic
1041885161 8:62800036-62800058 TGGGGACTTGGGGGAAAGACTGG + Intronic
1044167788 8:89009143-89009165 TGGGGCCTTGCGGGGAAGACTGG + Intergenic
1044603901 8:94032576-94032598 AGGCGTTCTGTGGGAAAAACAGG - Intergenic
1048200542 8:132370537-132370559 TGAGGCCCTGAGGAAAATACGGG - Intronic
1048430899 8:134369639-134369661 TGGGGTCCTTGGGGTAAAACAGG - Intergenic
1048445087 8:134487380-134487402 TGGGGCCCTGTGAGGAAGGCAGG + Intronic
1048995864 8:139793395-139793417 TGGAGCCCTGTGGGCTGAACAGG - Intronic
1050779547 9:9314581-9314603 TGGAGACATGAGGGAAAAACAGG - Intronic
1053101511 9:35375639-35375661 TGAGACCCTGTGGGACAATCAGG - Intronic
1055258004 9:74395621-74395643 TGGTGCCCTGTTGGAAGGACCGG - Intergenic
1056698541 9:88881338-88881360 TGGGGCCTTGTGGGGAAGAGTGG - Intergenic
1056726926 9:89127441-89127463 TGGGGCTCCTTGAGAAAAACAGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1058483306 9:105418604-105418626 TGGGGTCCTCTTGGAACAACAGG - Intronic
1059003565 9:110376562-110376584 TCCTGCCCTGTAGGAAAAACTGG + Intronic
1059508246 9:114819378-114819400 TGGGGCCCTGTGTCAATAAAGGG + Intergenic
1060859756 9:126944773-126944795 AGGGACACTGTGGGGAAAACTGG - Intronic
1061029600 9:128072312-128072334 TGGGGCCCTTTGGGTCAAAATGG + Intronic
1061202517 9:129145985-129146007 TGGGGTCCTGTGGGCAGAATGGG + Intronic
1061280351 9:129594554-129594576 TGGGGCAATGTGGGATTAACAGG + Intergenic
1061420282 9:130469871-130469893 TGGATCCCTGTGGGAACCACAGG - Intronic
1061591136 9:131598304-131598326 TGGGGCCCTGCGGGGAGAAGTGG + Exonic
1062342543 9:136100218-136100240 AGGGGCCCTGTGGGAGCAGCCGG - Intergenic
1185865979 X:3624357-3624379 AGGGGCACTGTGGGGAACACTGG + Intronic
1188557401 X:31428171-31428193 TGGGGCCCGGTGGGGGAGACTGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1193997576 X:88385003-88385025 TGGGGCTCTGTAGGAAGAGCCGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1195129038 X:101837015-101837037 TGGGGCCCTGTGAAAACCACAGG + Intronic
1199679627 X:150215832-150215854 TGGGAGCCTGTGGGAAAGACAGG - Intergenic
1199695604 X:150341217-150341239 TGGGAGCCTGTGGGAAAGACAGG + Intergenic
1199849728 X:151716811-151716833 TGGGGACCTGAAGGAAAAAAAGG - Intronic
1200704074 Y:6426515-6426537 AGGGGCCCTCTGGGAAAAGCAGG + Intergenic
1200914802 Y:8562184-8562206 AGGGGCTCTCTGGGAAAGACAGG - Intergenic
1200915359 Y:8566678-8566700 AGGGGCTCTCTGGGAAAGACAGG - Intergenic
1200930433 Y:8691981-8692003 AGGGGCTTTCTGGGAAAAACAGG + Intergenic
1201030037 Y:9738193-9738215 AGGGGCCCTCTGGGAAAAGCAGG - Intergenic
1202056338 Y:20835352-20835374 TGGGGGCTTGTGGGAAAAGTTGG + Intergenic
1202182778 Y:22153674-22153696 AGGGGCTCTGTGGGAAAGGCAGG + Intergenic
1202208581 Y:22432727-22432749 AGGGGCTCTGTGGGAAAGGCAGG - Intergenic