ID: 1081982205

View in Genome Browser
Species Human (GRCh38)
Location 11:47274813-47274835
Sequence ATCTCTAAGGAGAAGGGGGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 376
Summary {0: 1, 1: 0, 2: 0, 3: 34, 4: 341}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081982198_1081982205 -9 Left 1081982198 11:47274799-47274821 CCTTCCAAAAGCGAATCTCTAAG 0: 1
1: 0
2: 1
3: 8
4: 95
Right 1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG 0: 1
1: 0
2: 0
3: 34
4: 341
1081982197_1081982205 -4 Left 1081982197 11:47274794-47274816 CCGCTCCTTCCAAAAGCGAATCT 0: 1
1: 0
2: 0
3: 5
4: 152
Right 1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG 0: 1
1: 0
2: 0
3: 34
4: 341

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081982205 Original CRISPR ATCTCTAAGGAGAAGGGGGA AGG Exonic
900654140 1:3746883-3746905 GTCCCACAGGAGAAGGGGGAGGG + Intergenic
900834587 1:4990643-4990665 ATCTGTAAGGAGAAGGGATGGGG - Intergenic
901679115 1:10902935-10902957 ATCTCGGAGGTGAAGGGGCACGG - Intergenic
902109436 1:14065769-14065791 ATCTCAAAGCAGAAAGGGAAAGG + Intergenic
902776218 1:18676554-18676576 TCCTCTTAGGAGAAGGGGGTGGG - Intronic
903491079 1:23729081-23729103 ATCTTGAAGGAGGAGGAGGAAGG - Intergenic
905828458 1:41045406-41045428 ATCTATGAGGGAAAGGGGGAAGG + Intronic
906550812 1:46665177-46665199 AACTTTAAGGATAAGGGTGAGGG + Intronic
909396122 1:75172780-75172802 ATTTCTAAGGAAAAGCTGGAAGG - Intergenic
910250679 1:85195483-85195505 ATCTAAAAGGAGGAGAGGGATGG + Intronic
911026274 1:93438538-93438560 ACCTCTGGGGAGAAGGGAGAAGG - Intergenic
912368812 1:109156947-109156969 TTCTCTCAGAAGAAGGGGGGTGG + Intronic
913174585 1:116262346-116262368 ATCTGTAAGGTGAAGGAGGCTGG + Intergenic
913670640 1:121094655-121094677 AGCTCTAAGGAGAAAGTTGATGG - Intronic
914022404 1:143882094-143882116 AGCTCTAAGGAGAAAGTTGATGG - Intergenic
914660888 1:149790035-149790057 AGCTCTAAGGAGAAAGTTGATGG - Exonic
914693131 1:150049126-150049148 ACCTCTAAGTAGACGGGGCATGG - Intergenic
915123685 1:153648741-153648763 ATCCATGAGGAGATGGGGGAAGG + Intergenic
915493858 1:156267245-156267267 GGCAGTAAGGAGAAGGGGGAAGG + Intronic
915826704 1:159085677-159085699 ATCATGAAGGAGAAGGGGGCAGG + Intronic
916787262 1:168095684-168095706 ATCTGTGAGGAGGAGGAGGATGG + Intronic
917559733 1:176137270-176137292 ATCTCTAATGAGAAAGGGAATGG - Intronic
917588492 1:176452702-176452724 ATCTCTAAGGTGAAGAGTGTTGG + Intergenic
920039005 1:203084030-203084052 ATCTGTAAGGGGAGGTGGGAAGG + Exonic
920530620 1:206699442-206699464 GTTTCTAAGGAGAAGTGTGAGGG + Intronic
921812930 1:219534998-219535020 TTCTCTAAGGAGAGAAGGGAAGG - Intergenic
922014831 1:221634711-221634733 ATAGCCAAGGAGAAGGGTGAAGG + Intergenic
922572183 1:226640689-226640711 AGCGTTAAGGAGAAGGCGGATGG + Intronic
923211921 1:231811257-231811279 ACCTCCAGGGAGAAGGGGGTTGG + Intronic
923739167 1:236640061-236640083 ATCTCCAAGGAGTTTGGGGAAGG + Intergenic
924613458 1:245592290-245592312 ATCTCTCAGGAGACTGGGGCGGG - Intronic
1063009265 10:2006773-2006795 ATCTCTAAGGAAAATGTTGAAGG + Intergenic
1065150880 10:22822046-22822068 ATCTTTAAAGAGAAGGTGAAAGG - Intergenic
1065280878 10:24136326-24136348 ATTTCTAAAGAGGAAGGGGAGGG + Intronic
1065910629 10:30301075-30301097 GTCTCCAGGGAGATGGGGGATGG - Intergenic
1065984066 10:30931950-30931972 ATTTATAAGGAGAAGGTAGAGGG + Intronic
1067231310 10:44412898-44412920 TTCTCTAAGCAGGATGGGGAGGG + Intergenic
1068177129 10:53475811-53475833 ATCTGAAAGGAGAAGGGTGAGGG - Intergenic
1070865317 10:79705124-79705146 AGCTCAAAGGAGAAGGGCCAGGG + Intronic
1070879110 10:79843255-79843277 AGCTCAAAGGAGAAGGGCCAGGG + Intronic
1070922437 10:80196586-80196608 AGCTCTACTGAGAAGGGGGTGGG + Intronic
1071517551 10:86308766-86308788 ATCTCATAGCAGAAGGCGGAAGG + Intronic
1071632217 10:87227345-87227367 AGCTCAAAGGAGAAGGGCCAGGG + Intronic
1071645670 10:87359564-87359586 AGCTCAAAGGAGAAGGGCCAGGG + Intronic
1072290081 10:93956633-93956655 ATCTCTTAGGAGAGTGGAGATGG + Intergenic
1072581319 10:96742311-96742333 ATCTCAAAAAAGAAAGGGGAGGG + Intergenic
1072903323 10:99429028-99429050 TTCACTAAGGAGTATGGGGAGGG - Intronic
1073761038 10:106629082-106629104 ATCTTTTAGCAGAAGGGGAATGG - Intronic
1073779220 10:106818826-106818848 TTGTCAAAGGAGAAGGGGAAAGG - Intronic
1074470075 10:113719052-113719074 ATCTCCAAGGGGCAGGGGGTGGG + Intronic
1074693794 10:116029844-116029866 AGCCCTGAGGAGCAGGGGGAAGG - Intergenic
1076292585 10:129358875-129358897 TTTTGTAAGGTGAAGGGGGAAGG + Intergenic
1076437939 10:130459388-130459410 TTCCCCAAGGTGAAGGGGGAGGG + Intergenic
1076437973 10:130459544-130459566 TTCCCTAAGGTGAAGAGGGAGGG + Intergenic
1076438034 10:130459803-130459825 TTCCCTAAGGTGAAGAGGGAGGG + Intergenic
1076523282 10:131094346-131094368 CTCTGTAAGGAGAAGTGGGAGGG - Intronic
1076754008 10:132558630-132558652 AGCTCCAGGGAGAAGGAGGAAGG - Intronic
1077414812 11:2420119-2420141 ACCGCCAGGGAGAAGGGGGAGGG - Intronic
1077439543 11:2561660-2561682 ATCGCTAAGCAGGAGGAGGATGG - Intronic
1078715351 11:13834271-13834293 GTCTCTAGGGACCAGGGGGAGGG + Intergenic
1078908072 11:15705884-15705906 ATCTCTAAGGGTAATGGAGAAGG + Intergenic
1079384035 11:19963051-19963073 GGCTCTATAGAGAAGGGGGAAGG + Intronic
1079790928 11:24738677-24738699 ATCTCTCAGGAGCAGGGCCATGG + Intronic
1080856628 11:36117197-36117219 ATCTGGAAGGAAAAGGAGGAAGG + Intronic
1081343416 11:41955000-41955022 ATGTTTAATGAGAAAGGGGAAGG + Intergenic
1081911354 11:46701632-46701654 GCCTCCAAGGAGAAGGGCGAGGG + Exonic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1082807857 11:57461509-57461531 AGCTCAAAGGAGGAGGGAGATGG + Intronic
1083101111 11:60307031-60307053 AGCTCTAGGAAGAATGGGGAGGG + Intronic
1083513871 11:63237454-63237476 ATCTCACAGCAGAAGGTGGAAGG - Intronic
1084918418 11:72449259-72449281 ATCTGTGAGGAGAAGCGGGAGGG + Intergenic
1085541346 11:77273197-77273219 ATCTGTAGGTAGAAGGGGAAGGG + Intronic
1086989853 11:93291053-93291075 TTCTCTAATGAGACGGAGGATGG - Intergenic
1087051982 11:93895654-93895676 AGCAAGAAGGAGAAGGGGGAGGG + Intergenic
1088498909 11:110462333-110462355 ATCTGTATGGAAAAGGGGGAAGG - Exonic
1089384749 11:118060248-118060270 ACCTCTCAGGTGAACGGGGATGG + Intergenic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1091140671 11:133231832-133231854 TTGTCAAAGGAGAAGGGGCAAGG + Intronic
1091693626 12:2613265-2613287 CCCTCTGTGGAGAAGGGGGAAGG + Intronic
1091787054 12:3249407-3249429 AACTTTAAGGAAAAGGGGGAGGG - Intronic
1094070187 12:26404197-26404219 AACTGTAGGCAGAAGGGGGAAGG + Intronic
1094743909 12:33320804-33320826 AACTCTAAGGATAAGGAGTATGG + Intergenic
1095977848 12:47951995-47952017 ATCACTGTGGAGAAGGGGCAGGG + Intergenic
1096606651 12:52771308-52771330 ATTTCTAAGGAAAGGGAGGAAGG - Intronic
1096792315 12:54052972-54052994 ATCTCCAAGGAGCTGGGGCAAGG - Intronic
1097860148 12:64510736-64510758 GTCTTGAAGGAGAATGGGGAGGG + Intergenic
1098029862 12:66242554-66242576 TTCTCCAGGGAGAAGGGAGAAGG + Intronic
1098236408 12:68422498-68422520 ATCATCAGGGAGAAGGGGGAAGG - Intergenic
1099954994 12:89344905-89344927 TTCTCTGCGGAGAAGGAGGATGG + Intergenic
1100411362 12:94322695-94322717 AGCTCTAAGGAGAAGTGGTCAGG - Intronic
1101122496 12:101597545-101597567 TCTTCTAAGGAGAAGGAGGAAGG + Intronic
1101228990 12:102720590-102720612 ACCTCTAAAGAGAAGGAGGGCGG - Intergenic
1101343901 12:103867251-103867273 GCCTCTCAGGAGAAGGGAGATGG + Intergenic
1101358823 12:104007294-104007316 ATCTGGAAAGAGAAGGGGGAGGG - Intronic
1102418640 12:112786531-112786553 CTCTTAAAGGAGAAGGAGGAGGG + Intronic
1102454658 12:113064030-113064052 CTCTCAAGGGAGAAGGGGGAAGG - Intronic
1102455891 12:113070552-113070574 GACTCCATGGAGAAGGGGGAGGG - Intronic
1102647199 12:114411393-114411415 TTATTTAAGGAGAAGGGGCATGG + Intergenic
1103669700 12:122603301-122603323 ATCTTTAAGGAGAAGCAGGATGG + Intronic
1103970685 12:124669160-124669182 ATCTCTGAGCAGATGGGGAAAGG - Intergenic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1105525644 13:21175725-21175747 ATCTCTAATAAAAAGGGGAATGG + Intronic
1106096106 13:26645243-26645265 ATCACTAGGCAGAAGGGGCAAGG - Intronic
1106144310 13:27037926-27037948 ATCTCCGAAGAGAAGGGAGAGGG + Intergenic
1106769853 13:32951577-32951599 CTTCCTAAGGAGAAAGGGGAGGG + Intergenic
1107063484 13:36187056-36187078 ATCTCTAAAGAGAAAGGGGGAGG + Intronic
1107180188 13:37449538-37449560 AACTCTAAAGTCAAGGGGGATGG - Intergenic
1107425742 13:40291086-40291108 ATCTCTCAGGAGAAGCAGGAGGG + Intergenic
1107986115 13:45777784-45777806 ATTTCTAAGGGAAAGGGGAAGGG - Exonic
1110742842 13:79018238-79018260 ACCCCTAAGGAGCAGGGGGGAGG - Intergenic
1110961582 13:81632867-81632889 ATATCAAAGGAGAATGGGTAGGG + Intergenic
1111733894 13:92112856-92112878 ATAGCTAAGGAGAAAGGAGAAGG + Intronic
1112218177 13:97457938-97457960 ATCTATGAGAAGAAGGGGCAGGG + Intronic
1113405247 13:110032896-110032918 CTCTTTAAGGAGAAGCGGGTGGG - Intergenic
1113596036 13:111533646-111533668 AGCTCACAGGTGAAGGGGGACGG - Intergenic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114632702 14:24169713-24169735 ATCTCTTAAGAGAGGGGGCAAGG + Intergenic
1114832632 14:26163778-26163800 CTCTCTAAAGAGGAGGGGAAAGG - Intergenic
1115069818 14:29307507-29307529 ATTTCTGAGGAGAGGTGGGAAGG + Intergenic
1115197713 14:30819562-30819584 ATCCCAAAGGAGAAGGGGAAGGG - Intergenic
1116787490 14:49303621-49303643 ATCTCTAAGCTGATGGGGGTTGG + Intergenic
1117031829 14:51679953-51679975 ATGCCAAAGAAGAAGGGGGAAGG + Intronic
1117648931 14:57882176-57882198 TTCTCCAGGGGGAAGGGGGATGG - Intronic
1118904765 14:70015766-70015788 ATCTCCAAGAAGAGGGGAGAAGG + Intronic
1119171077 14:72536875-72536897 AGTTCTAAGGAGGAGGAGGAAGG - Intronic
1119293525 14:73515163-73515185 AGCTCTATGGAGAAGGGGAAGGG + Intronic
1119361643 14:74054954-74054976 AACTCTAAGGAGGCTGGGGACGG - Intronic
1119540498 14:75435118-75435140 TCCTCTAAGGAGAACAGGGAAGG - Intronic
1119555284 14:75548059-75548081 ATCTCTGAAGAGCAGGGGGGTGG - Intergenic
1119872275 14:78028045-78028067 ATCCCCAAGGGGAAGGGAGAGGG - Intergenic
1120540421 14:85743778-85743800 ATCTCTAAGGATGAGAGAGAAGG - Intergenic
1121080403 14:91103335-91103357 GGCTAAAAGGAGAAGGGGGAAGG - Intronic
1122388865 14:101366711-101366733 GTCTCTCAGGAGCAGAGGGAGGG + Intergenic
1122534512 14:102452816-102452838 AACTCTAAGGGGCAGGGGAAGGG - Intronic
1122606358 14:102949242-102949264 AACTCTAAGAGGAAGTGGGAAGG + Intronic
1122609173 14:102969557-102969579 ATCACTGAGGCGAAGGGAGAGGG + Intronic
1123205624 14:106710377-106710399 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1123210674 14:106757652-106757674 ATCTCTGAGGAGAATGTGGAAGG - Intergenic
1124661305 15:31553000-31553022 AGCTATAAGGAGAAGGGGAATGG + Intronic
1126911342 15:53420306-53420328 ATCTCTAAAGTGCAGGGTGAGGG + Intergenic
1128371368 15:67041956-67041978 CTTTCTAAAGAGAAGGGGCAAGG + Intergenic
1129038589 15:72665611-72665633 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129211301 15:74071619-74071641 CTCCCGAAGGAGAAGGCGGACGG - Exonic
1129399102 15:75269468-75269490 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1129402709 15:75293744-75293766 CTCCCGAAGGAGAAGGCGGACGG + Exonic
1132332527 15:101022654-101022676 CTCTCTGGGGAGAAGGGAGAAGG - Intronic
1133564824 16:6983651-6983673 ATCTCTTGGGAGAAGAGGCAAGG + Intronic
1133574074 16:7070779-7070801 ATGGCTAAGGGGAAGGGGGATGG - Intronic
1135956553 16:26960940-26960962 TTATCTGAGGAAAAGGGGGAAGG - Intergenic
1136427453 16:30178588-30178610 TTCTCCATGGAGAAGGCGGAGGG + Intergenic
1138350751 16:56345117-56345139 ATCCCTGAGCAGAAGGGGGCGGG + Exonic
1140406927 16:74717398-74717420 AGCTCTCAGGAAAAGGAGGAAGG + Intronic
1140986511 16:80162962-80162984 AGTTTTAAGAAGAAGGGGGAAGG - Intergenic
1141162481 16:81638605-81638627 TTCTCCAAGGAGAAGGGAGAGGG - Intronic
1141552813 16:84817497-84817519 ATCTGTAAGGAGATGAGGGTTGG + Intergenic
1142106895 16:88309183-88309205 ACCTCTCAGGGGAAGGAGGAAGG + Intergenic
1142152007 16:88516795-88516817 TTGTAGAAGGAGAAGGGGGAGGG + Intronic
1142157678 16:88540029-88540051 ACCTCCAAGGAGGAGGGGGTTGG - Intergenic
1142251725 16:88994969-88994991 TTCTCCAAGGGGAAGGGGAAGGG - Intergenic
1143161297 17:4873177-4873199 ATATCTAGGGAGAATGTGGATGG - Intronic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1143564972 17:7715773-7715795 ATCTCCACGGAGAGGGGGGTGGG - Intergenic
1144846885 17:18224861-18224883 AGCTTTACGGAGATGGGGGAAGG - Intergenic
1146745417 17:35324332-35324354 AACTCTAAGCAGACAGGGGAGGG - Intergenic
1147393547 17:40123579-40123601 ACCTCTCAGGGGGAGGGGGAGGG + Intronic
1147888805 17:43702722-43702744 AGCTCTTAGCAGAAGGGGGAAGG - Intergenic
1149254856 17:54814429-54814451 ATATCTAAGGAGCAGAGTGAGGG + Intergenic
1150608220 17:66712598-66712620 GTCTTTAAGGAGAAGGGGACAGG - Intronic
1151167833 17:72220002-72220024 CTCTCCAGGGAGAAAGGGGATGG + Intergenic
1151859056 17:76745695-76745717 GTGTCTCAGGAGAAGAGGGAGGG - Intronic
1152136172 17:78505057-78505079 ATCCTTAGGGAGAAAGGGGAGGG - Intronic
1152308526 17:79535339-79535361 ATAGGTAAGGAGAAGAGGGAGGG + Intergenic
1153342682 18:3991625-3991647 AGCTCTGGGGAGAAGGGAGAAGG - Intronic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1156412311 18:36842498-36842520 ATCTCAAAGCAGAGGGTGGAAGG + Intronic
1156515984 18:37680915-37680937 ATCTGTAAGGAAAAAAGGGAGGG + Intergenic
1157899242 18:51498098-51498120 TTCTCCAAGGGGAAGGGAGAAGG + Intergenic
1157967467 18:52224383-52224405 ATCTCATAGCAGAAGGTGGAAGG - Intergenic
1158548020 18:58412193-58412215 AGCTATTAGAAGAAGGGGGATGG - Intergenic
1160203056 18:76810894-76810916 ATAGCTAAGGAGAAGGTGGAAGG - Intronic
1160467493 18:79093731-79093753 AATTCTAAGCAGATGGGGGAGGG - Intronic
1162786786 19:13040136-13040158 AGCTCTCAGGAAAATGGGGAAGG + Intronic
1162832008 19:13291105-13291127 ATCCCCAGGGAGAAGGGGGTAGG - Intronic
1163068231 19:14815475-14815497 ATTTCTAAGGAGGAGGGGTTGGG - Intronic
1164196285 19:22965577-22965599 AATTCTAAAGAGAAGGAGGAAGG - Intergenic
1164672913 19:30083069-30083091 ACCCCTAAAGAGAGGGGGGATGG + Intergenic
1167277795 19:48549440-48549462 ATCTCTGTGGAGAATGAGGAGGG - Intergenic
1168178946 19:54646487-54646509 AGCTCTCAGCAGAAGGGCGATGG + Intronic
1202682532 1_KI270712v1_random:20548-20570 ACCTGCAAGGAGAAGGAGGACGG - Intergenic
925228266 2:2205785-2205807 ATATGTGAAGAGAAGGGGGATGG - Intronic
926175974 2:10592480-10592502 ATGTCTCAGGAGAAGGGAGGGGG + Intronic
928929260 2:36607146-36607168 ATCTCAAGGCAGAAGGTGGAAGG + Intronic
928945076 2:36764875-36764897 ATGTCAAAGGGGAAGGTGGATGG + Intronic
929456592 2:42070601-42070623 GTCTTTAAGGAAAAGAGGGAGGG - Intergenic
930012933 2:46951463-46951485 AACTCAAAAGAGGAGGGGGAGGG + Intronic
932396968 2:71455010-71455032 ATCTCTGGGGAGAAGGGGAGTGG - Intronic
933053988 2:77638340-77638362 CACTCTTGGGAGAAGGGGGAGGG - Intergenic
933791224 2:85885464-85885486 AGTTCTAAGGAGACTGGGGAAGG - Intronic
933995714 2:87668252-87668274 ATCTCTGAGGAGTAGGGAAAGGG + Intergenic
934165804 2:89293140-89293162 ACACCAAAGGAGAAGGGGGATGG + Intergenic
934201473 2:89889316-89889338 ACACCAAAGGAGAAGGGGGATGG - Intergenic
936298143 2:111282660-111282682 ATCTCTGAGGAGTAGGGAAAGGG - Intergenic
937217396 2:120321358-120321380 AACTCGAAGAAGAAGGAGGAGGG - Intergenic
937522323 2:122726681-122726703 ATCTCTAAGGATGAAGGGGCTGG - Intergenic
937789214 2:125941362-125941384 TTCACTAAGGATAACGGGGAAGG - Intergenic
938905960 2:135836457-135836479 TGCTCTAAGGAGGATGGGGAAGG + Intronic
940037794 2:149329504-149329526 AAATCCAAGGAGAAGGTGGAGGG + Intergenic
942326738 2:174782354-174782376 ACTTCTAAGGAGATGGTGGAAGG - Intergenic
942901646 2:181127104-181127126 AGCTCTAAGGAGGAGCTGGAAGG + Intergenic
942913734 2:181277543-181277565 TTCTCGAAGGAGAAGTGGGATGG + Intergenic
944502836 2:200379528-200379550 ATAGCTAAAGAGATGGGGGAAGG + Intronic
946370801 2:219280182-219280204 AAATCTAGGGGGAAGGGGGAGGG - Intronic
946794920 2:223340177-223340199 ATCTGGAAAGAGGAGGGGGATGG + Intergenic
947378129 2:229518077-229518099 ATCTCAAAGCAGAAGCTGGATGG + Intronic
948194642 2:236086087-236086109 ATCTCTAAGCAGGAGGAGGGGGG - Intronic
948697620 2:239741006-239741028 ATCTCAAAGGAGGAGGAGGCTGG + Intergenic
1169527359 20:6444127-6444149 ATCTCTTAAGATAAGGGGGGAGG + Intergenic
1170830321 20:19833944-19833966 AGCTCTCAGGAGAAGGGGACGGG - Intergenic
1172181109 20:33004186-33004208 ATCTCCAAGGACAGGGTGGAGGG + Intronic
1172261772 20:33573301-33573323 AGCGCTAAGGAGAAAGGGAAAGG + Intronic
1172904285 20:38357355-38357377 ATCTCTAAGGATCAGGGGTCAGG - Intronic
1174072722 20:47910001-47910023 AGATGTAAGGAGTAGGGGGAGGG - Intergenic
1174524638 20:51161169-51161191 ATCACCCAGGAGAAGGGGAAGGG - Intergenic
1174573998 20:51524109-51524131 TTCTGGAAAGAGAAGGGGGAAGG + Exonic
1175231292 20:57475064-57475086 ATCTCTAACCACAAGGGGGGCGG - Intergenic
1178913734 21:36695826-36695848 GTCACTAAGGAGGTGGGGGAGGG - Intergenic
1178992073 21:37365614-37365636 ATAGCTAGGGAGAAGGGGTAGGG + Intergenic
1179460314 21:41530170-41530192 ATTTCTCAGGAGAAGGAGGTGGG - Intronic
1179980782 21:44894674-44894696 GTCTCTATGGAGAAGGGAGGTGG - Intronic
1180754670 22:18152700-18152722 AGGTCTAAGGAGGATGGGGAGGG - Intronic
1181021371 22:20105175-20105197 TTCTCTAAGAAGAGGGAGGAGGG + Intronic
1181236669 22:21451124-21451146 ACCTCGAAGGGGAGGGGGGAGGG + Exonic
1181885666 22:26020325-26020347 ATCTGAAAGGGGAAGGGGTATGG + Intronic
1182229403 22:28825809-28825831 ATATATTAGGAGAAGGGGGAAGG + Intergenic
1183292032 22:37008694-37008716 AACACTAAGGATAAGGGTGATGG + Intergenic
1183432813 22:37775783-37775805 ATCTCAAAAAAAAAGGGGGAGGG + Exonic
950459210 3:13111255-13111277 CTCTCTAATGAGAAGCAGGAAGG - Intergenic
952341689 3:32452502-32452524 ATCTCTCAGGAACAGGGGGATGG + Intronic
953344263 3:42161810-42161832 GTCTTGAAGGAGATGGGGGAGGG + Intronic
954911460 3:54114263-54114285 AACTCCAAGGAGAAGGAGGCTGG + Intergenic
959418554 3:106105809-106105831 ATATCTAAGGAGAAGGAAAAGGG - Intergenic
959895898 3:111605589-111605611 ATCTCTGAGGAGGTGGAGGACGG - Intronic
960515226 3:118595758-118595780 AGCTCTCAGCAGAAGGGAGATGG + Intergenic
961308333 3:125975473-125975495 TTCCCTCAGAAGAAGGGGGAAGG + Intronic
963842236 3:150119612-150119634 ATCTCAAAGGTGGAGAGGGAAGG - Intergenic
965530464 3:169765518-169765540 CATTCTAAGGAGAAGGGGGCAGG - Intergenic
966861604 3:184233682-184233704 ATCTCGAAGGAGAAGGTATATGG - Exonic
967570547 3:191023040-191023062 ATCTCTAAGATGAAAAGGGATGG + Intergenic
967814636 3:193788453-193788475 ATCTTTAAGAAGAATGGGGAAGG - Intergenic
967951913 3:194847777-194847799 AGTTCCATGGAGAAGGGGGAAGG + Intergenic
970451064 4:16166865-16166887 ATGGCTAAGGAGAAGGTGGGGGG + Intronic
970653238 4:18201108-18201130 ATCTCTAAGGAGACAGAGGATGG - Intergenic
972508254 4:39742093-39742115 ATCTCTTAGGAGCAGTGTGAGGG - Intronic
973214393 4:47653305-47653327 ATCCCTACGGATAAGGGGGAGGG + Intronic
973942346 4:55923801-55923823 TCCTCTAAGTAGAAGGGCGATGG + Intergenic
974088902 4:57289885-57289907 ATCTCTATGGGGGAGTGGGAGGG + Intergenic
974126242 4:57699709-57699731 ATCTCTAAGGAAGGGGGGGATGG + Intergenic
974447985 4:62011554-62011576 ATTTCAGAGGAGAAGGGTGAGGG + Intronic
975436411 4:74357601-74357623 TTCTCAAAGGAGAAGGAGGTGGG - Intergenic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976465069 4:85357949-85357971 ATCCCTGAGGGGAAAGGGGAGGG - Intergenic
977360537 4:95998890-95998912 ATGTCTAGGGGGGAGGGGGAAGG + Intergenic
979107362 4:116705362-116705384 GTTTCTGAGGAGCAGGGGGAGGG - Intergenic
980538187 4:134158131-134158153 ATTTGTAGGGAGATGGGGGAGGG - Intergenic
980890938 4:138814725-138814747 ATATCTATGGAGGAGGGGGGAGG - Intergenic
981032095 4:140135906-140135928 AGGTTGAAGGAGAAGGGGGAGGG - Intronic
981670388 4:147279697-147279719 AACTCTGAGGAGAAGGGGTTGGG - Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
986210187 5:5664760-5664782 ATGGCCAAGGAGAAGAGGGAGGG + Intergenic
986291997 5:6407589-6407611 CTCTGGAAGGAGAAGAGGGAAGG - Intergenic
986937523 5:12908045-12908067 ATCTCATAGCAGAAGGCGGAAGG - Intergenic
987747925 5:22001299-22001321 ATTAATAAGGAGGAGGGGGACGG - Intronic
988088840 5:26508424-26508446 ACCTCTCAGCAGAAAGGGGATGG - Intergenic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
990934409 5:61132398-61132420 TTCTCAAAGGAGGTGGGGGAGGG - Intronic
991601176 5:68352748-68352770 ATCTCTTAGAACAAGGGGAAAGG + Intergenic
991768104 5:70011089-70011111 ATTAATAAGGAGAAGGGGAACGG - Intergenic
991847342 5:70886171-70886193 ATTAATAAGGAGAAGGGGAACGG - Intergenic
991936973 5:71811488-71811510 ATCTTGGAGGAGAAGGGAGAAGG + Intergenic
992459101 5:76943747-76943769 ATCTCTAAGGTGAAGGATGTGGG - Intergenic
993824752 5:92669131-92669153 ATATCTAAGGCTAAGGGAGAGGG - Intergenic
994222099 5:97208254-97208276 AGCTCTCAGGAAAAGGGGGAGGG - Intergenic
994988996 5:106974658-106974680 TTCTGCAAGGAGAGGGGGGATGG + Intergenic
995104982 5:108366711-108366733 ATATCCAAGGAGAATGGTGAGGG - Intronic
995222713 5:109668902-109668924 CTATCTAAGGAACAGGGGGAAGG - Intergenic
995994121 5:118279037-118279059 ATCTTTGAGGAGATGGGAGAGGG - Intergenic
996888762 5:128391759-128391781 ATTTCTAAGGAGAATGGAAAGGG + Intronic
997303416 5:132822796-132822818 CTATGTAAGGAGAAGAGGGAAGG + Exonic
997711883 5:136011997-136012019 ATCTCTAAGGAATAGGGGAGAGG + Intergenic
998051767 5:139041852-139041874 GACTGTAAGGAGAAGAGGGAGGG + Intronic
998393210 5:141801154-141801176 ATCTCCAAGAAGAGGGGGAAGGG - Intergenic
999123431 5:149228024-149228046 ATCTCTAAGGATTTGGGGGCTGG + Intronic
1001710030 5:173771180-173771202 GTCTCACAGGAGAAGGGGGAGGG - Intergenic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1001936066 5:175706872-175706894 CTCTCTATGTGGAAGGGGGAGGG + Intergenic
1002113994 5:176943113-176943135 ATGCCTCAGGAGAAGGGGAAGGG - Intronic
1002355186 5:178622275-178622297 TTATATAAGGGGAAGGGGGAAGG - Intronic
1003707939 6:8555681-8555703 CTCTGTAAGGAGGAGGTGGAGGG - Intergenic
1005116666 6:22346248-22346270 AGCTGTAAGGAGAAAGAGGAAGG - Intergenic
1011401972 6:86973158-86973180 ATTTAAAAGGAGAAGGTGGAGGG - Intronic
1011552040 6:88538825-88538847 ATCTGTAAGGAGAGGTGGGATGG - Intergenic
1011626793 6:89289677-89289699 ATCTGGAAGGGGAAGGGGAAGGG + Intronic
1012957598 6:105587998-105588020 GCCTCTTGGGAGAAGGGGGAGGG - Intergenic
1013164656 6:107578957-107578979 ATCACTAGGCAGAAGGGGGTTGG - Intronic
1013576720 6:111490822-111490844 ATCTTTAAGGAGAAGGTAGAAGG + Intergenic
1014760866 6:125355457-125355479 AACTCTAAGGATAATGGGGAAGG + Intergenic
1016598994 6:145835105-145835127 ACCTCCAAGAGGAAGGGGGATGG + Intergenic
1017869697 6:158476535-158476557 ATCTCGAAGGCGAGGGAGGATGG - Intronic
1017953966 6:159162664-159162686 TCTTCTATGGAGAAGGGGGAAGG + Intergenic
1019489096 7:1302881-1302903 ATCTTTATGGAGGATGGGGAGGG - Intergenic
1019834447 7:3368476-3368498 ATCAGTATGGAGTAGGGGGATGG + Intronic
1020670629 7:11104755-11104777 AACTCCAGGGTGAAGGGGGAGGG - Intronic
1021268831 7:18559504-18559526 ATCCCTGAGGAGGAGGGGGTAGG + Intronic
1021914126 7:25414638-25414660 ATCTCATGGGAGAATGGGGAGGG - Intergenic
1023309384 7:38868271-38868293 ATCTCAAAGGAGAAGGTTGCTGG + Intronic
1023986363 7:45099458-45099480 GTCTCTAAGGAGAGGCTGGAAGG + Intergenic
1024532762 7:50407026-50407048 ATCTCTAAGGGGGATGTGGATGG - Intergenic
1025138920 7:56446629-56446651 ACTTCTAATGAGGAGGGGGAAGG - Intergenic
1026458109 7:70590404-70590426 ACCTCTAGGGAGATAGGGGATGG - Intronic
1026828392 7:73597364-73597386 AGCTCTATGGGGAAGGGGGTGGG + Exonic
1028240965 7:88420161-88420183 CTTTCTAGGGAGAAGGGGAAAGG + Intergenic
1028391643 7:90323313-90323335 ATCTCCAGGGAAAAGGCGGATGG + Intergenic
1029088060 7:98026716-98026738 ATCTTTAAAAGGAAGGGGGAAGG - Intergenic
1029479166 7:100802523-100802545 ATTTCTAAGGAGAGTGGGGCTGG - Intergenic
1031054989 7:116983524-116983546 ATCCCCTAGGGGAAGGGGGATGG - Intronic
1031468599 7:122143860-122143882 ATTTCTAAGTAGAAAGGCGAGGG - Intronic
1033052068 7:138014653-138014675 ATCTCTTAGAAAAATGGGGATGG - Intronic
1033558008 7:142505947-142505969 ATCCATTAGGAGAAGGTGGAGGG - Intergenic
1034368116 7:150569630-150569652 ATCTCTAGATAGAGGGGGGAAGG + Intronic
1034746018 7:153524512-153524534 CTCTCCAAGGAGGAGGTGGAGGG + Intergenic
1035430351 7:158815472-158815494 ATATCTAAGCATGAGGGGGAAGG - Intronic
1037344152 8:17880186-17880208 ATCTCTAAGGGCCAGAGGGAGGG + Intronic
1037771176 8:21800997-21801019 TTCCCTAAGGAGAACAGGGAAGG + Intronic
1039240590 8:35551928-35551950 ATCAATAAAGAGAAGGGCGAAGG + Intronic
1041643718 8:60229790-60229812 ATGTCTAGGCAGGAGGGGGAAGG - Intronic
1041860567 8:62508350-62508372 ATGTCCAAGGTGGAGGGGGAGGG - Intronic
1042020543 8:64369298-64369320 GCCTCTAGGGAGAAAGGGGAGGG + Intergenic
1042781958 8:72501063-72501085 ATCTCTAAGCTTAAAGGGGAAGG - Intergenic
1043100827 8:76043160-76043182 ATATCTGAGGAGAAGTGGTAAGG - Intergenic
1043385588 8:79744634-79744656 AAGTAAAAGGAGAAGGGGGATGG + Intergenic
1045094785 8:98785806-98785828 ACCCCTAAGGAGTAGGGGAAAGG + Intronic
1046178796 8:110614869-110614891 ATCCTTAAGAAGAATGGGGATGG + Intergenic
1046314923 8:112487244-112487266 AGCTCTGAGGAGCACGGGGAGGG + Intronic
1047728115 8:127702277-127702299 ATCCCTGGGGAGATGGGGGAGGG + Intergenic
1049065942 8:140313962-140313984 ATCCTTTAGGAGAAGGTGGATGG - Intronic
1050123221 9:2330033-2330055 ATCTGTCAGGGGCAGGGGGAGGG - Intergenic
1051019562 9:12525796-12525818 CTTTCTAAGGGAAAGGGGGAAGG + Intergenic
1051144075 9:14007803-14007825 AGCTCTCAGCAGATGGGGGAAGG - Intergenic
1052501633 9:29299121-29299143 ATCTCAAAGGAGCAGTAGGAAGG - Intergenic
1052566530 9:30160510-30160532 AGCTCTCAGTAGATGGGGGATGG + Intergenic
1053602979 9:39629727-39629749 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1053860628 9:42383475-42383497 CTCTCTATGTAGAAGAGGGAGGG - Intergenic
1054250559 9:62712709-62712731 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1054564667 9:66747221-66747243 CTCTCTATGTAGAAGAGGGAGGG + Intergenic
1055654739 9:78441006-78441028 TCCTCCAAGGAGAGGGGGGATGG - Intergenic
1056203987 9:84302869-84302891 GTCTCTAAGGAAAAGAGGTAGGG + Intronic
1056501672 9:87215726-87215748 ATCTCTAAAGAGAAGGTGTCAGG + Intergenic
1056823940 9:89863952-89863974 ATCTCCAGGGAGACGGGGGCGGG - Intergenic
1059820939 9:117971280-117971302 ATCACTAAGGAGAAAGTGTAGGG + Intergenic
1061000319 9:127899087-127899109 GGCTCCAGGGAGAAGGGGGAGGG + Intronic
1188051355 X:25490975-25490997 ATTACTAAGGAGAATGGAGATGG - Intergenic
1188402709 X:29766630-29766652 ATATATAATGAGAAAGGGGATGG - Intronic
1188524539 X:31075010-31075032 CTCTCTGAGGAGAAGGAGGCAGG + Intergenic
1188894219 X:35646240-35646262 GTCTTCAAGGAGAAGGGAGAAGG + Intergenic
1189219625 X:39360203-39360225 ATCTCTCAGATGAAGGGAGAGGG + Intergenic
1189988883 X:46576209-46576231 AGCTACAGGGAGAAGGGGGAAGG - Intronic
1190797255 X:53757385-53757407 ACCTTTAAGGAGAATGGGGGAGG + Intergenic
1190913053 X:54789523-54789545 ACCTTTAAGGAGAATGGGGGAGG + Intronic
1190917892 X:54823786-54823808 ACCTTTAAGGAGAATGGGGGAGG - Intergenic
1195827490 X:109018121-109018143 AGCTCTAGGGAGAAGGGAGAAGG - Intergenic
1196827732 X:119754096-119754118 ATGACTAAGGAGAAAGGGGTGGG - Intergenic
1199860253 X:151795014-151795036 ATCTGTTAGGAGATGGGAGAAGG - Intergenic
1199866127 X:151851839-151851861 ATCTCTAAGGAGACAGGGTTTGG - Intergenic
1200132370 X:153857784-153857806 ACCTCTAAGGAGCAGGGGTCTGG + Intergenic
1201885151 Y:18874025-18874047 ATCTCTAAAAAGAAAGGGGTGGG - Intergenic