ID: 1081988904

View in Genome Browser
Species Human (GRCh38)
Location 11:47327162-47327184
Sequence GCTGCTAGAGAGATTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 493
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 471}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081988904_1081988909 13 Left 1081988904 11:47327162-47327184 CCTGCTGCAATCTCTCTAGCAGC 0: 1
1: 0
2: 0
3: 21
4: 471
Right 1081988909 11:47327198-47327220 CAGCCTCCCTGGCGCCGCTCTGG 0: 1
1: 0
2: 0
3: 21
4: 214
1081988904_1081988907 2 Left 1081988904 11:47327162-47327184 CCTGCTGCAATCTCTCTAGCAGC 0: 1
1: 0
2: 0
3: 21
4: 471
Right 1081988907 11:47327187-47327209 AGTGCGCTAGCCAGCCTCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 83
1081988904_1081988913 24 Left 1081988904 11:47327162-47327184 CCTGCTGCAATCTCTCTAGCAGC 0: 1
1: 0
2: 0
3: 21
4: 471
Right 1081988913 11:47327209-47327231 GCGCCGCTCTGGTCTCCACCTGG 0: 1
1: 0
2: 0
3: 6
4: 73

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081988904 Original CRISPR GCTGCTAGAGAGATTGCAGC AGG (reversed) Intronic
900267649 1:1767024-1767046 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
900693842 1:3997904-3997926 GCTACTAGAGAGGTTGAAGTAGG - Intergenic
901042290 1:6372114-6372136 GCTGCTGGAGAAGCTGCAGCAGG - Intronic
902587704 1:17450992-17451014 GCTACTAAAGAGATTGAGGCAGG + Intergenic
903939179 1:26917144-26917166 GCTACTAGAGAGGCTGAAGCGGG + Intronic
905053926 1:35076818-35076840 GCTACTTGAGAGGCTGCAGCAGG + Intronic
905738913 1:40352332-40352354 GCTGCTAGAGAGGTTACATGTGG - Intronic
906307730 1:44730845-44730867 GCTACTTGAGAGACTGAAGCAGG + Intergenic
906857426 1:49323391-49323413 GCTACTAGAGAGGCTGAAGCAGG - Intronic
907386389 1:54128266-54128288 GCTGCTCCAGAGGTTGAAGCAGG - Intergenic
908066797 1:60414932-60414954 GCTACTTGAGAGACTGAAGCAGG - Intergenic
908690676 1:66775921-66775943 TCTGGTAGATAGATTGGAGCGGG + Intronic
909963238 1:81874815-81874837 GCTACTAGAGAGGCTGAAGCAGG - Intronic
911020156 1:93378070-93378092 GCTGCTTGGGAGACTGAAGCAGG + Intergenic
912317413 1:108678824-108678846 GCTACTAGGGAGGTTGAAGCGGG - Intergenic
912813030 1:112808230-112808252 GCTGCTAGGAACATAGCAGCTGG - Intergenic
913696306 1:121329097-121329119 GCTACTCAAGAGATTGAAGCAGG + Intronic
914141256 1:144950958-144950980 GCTACTCAAGAGATTGAAGCAGG - Intronic
914862416 1:151397731-151397753 GCTACTCGAGAGGTTGCAGCTGG + Intergenic
915220314 1:154369269-154369291 GCTACTTGAGAGGTTGAAGCAGG + Intergenic
915224325 1:154401514-154401536 GCTGCTTGGGAGATTGAGGCAGG - Intergenic
915241614 1:154526565-154526587 GCTGCTCGAGAGACTGAGGCAGG - Intronic
916340348 1:163726691-163726713 GCTGCTTGGGAGATTGAGGCAGG + Intergenic
916593996 1:166224987-166225009 GCAGCTAGAGAGATAGAGGCAGG - Intergenic
916658799 1:166901888-166901910 GGTGCCAGAGAGATTTTAGCTGG + Intergenic
917624802 1:176834857-176834879 GCTGCTCGGGAGGTTGAAGCAGG + Intronic
917863716 1:179173472-179173494 GCTGCTAGAGAGGCTGAGGCAGG - Intronic
917913914 1:179681187-179681209 GCTGCTTGAGAGACTGAAGCAGG - Intronic
919906720 1:202083639-202083661 GCTACTGGGGAGATTGAAGCAGG - Intergenic
920108581 1:203571574-203571596 GCTGCTAGAGAGGCTGAGGCAGG - Intergenic
920483629 1:206347463-206347485 GCTACTCAAGAGATTGAAGCAGG + Intronic
920537522 1:206748484-206748506 TCTACTGGAGAGATTGAAGCAGG - Intergenic
920785746 1:209039504-209039526 GCTCCTGGTGAGATTGCACCCGG - Intergenic
921230198 1:213062666-213062688 GCTGCTCGAGAGACTGAGGCAGG - Intronic
921325668 1:213984642-213984664 GCCTCTAGAAAGCTTGCAGCAGG + Intronic
922104269 1:222499300-222499322 GCTACTTGAGAGGCTGCAGCAGG + Intergenic
923549293 1:234949564-234949586 GCTGCTTGAGAGGCTGAAGCGGG + Intergenic
924346441 1:243076818-243076840 GCTACTTGAGAGGCTGCAGCAGG + Intergenic
1063632791 10:7749746-7749768 GCTGCTAGGGAGGTTGAAGTGGG - Intergenic
1064500946 10:15972793-15972815 GCTGCTTGAGAGGCTGAAGCAGG - Intergenic
1064621477 10:17222044-17222066 GCTACTAGGGAGGTTGGAGCAGG - Intergenic
1065002984 10:21353919-21353941 GCTACTTGGGAGACTGCAGCAGG + Intergenic
1065293482 10:24253801-24253823 GCTGCTCGGGAGGTTGAAGCGGG + Intronic
1065940205 10:30557394-30557416 GCTACTTGAGAGACTGAAGCAGG + Intergenic
1066091145 10:32021858-32021880 GCTACTAGGGAGGCTGCAGCAGG + Intronic
1067324530 10:45254692-45254714 GCTGCTAGAGAGGCTGAGGCAGG - Intergenic
1067428905 10:46229106-46229128 GGTGGAAGAGAGGTTGCAGCTGG - Intergenic
1067549909 10:47227006-47227028 CCTGCTGCAGAGAATGCAGCGGG - Intergenic
1068606831 10:59014667-59014689 GCTGCTTGGGAGGCTGCAGCAGG + Intergenic
1069706436 10:70461553-70461575 TCTGCTGGACAGATGGCAGCAGG - Intergenic
1070197500 10:74172575-74172597 GCTGCTAGGGAGGTTGAGGCAGG + Intronic
1070552669 10:77503003-77503025 GCTGCTTGAGAGGCTGAAGCTGG + Intronic
1070906229 10:80075781-80075803 GCTACTAGAGAGAGTGTGGCAGG + Intergenic
1071970473 10:90901084-90901106 GCTGCTTGAGAGGCTGAAGCGGG - Intronic
1072889246 10:99307115-99307137 CCTGCTGGAGAGTTTGCAGTTGG + Intergenic
1073162811 10:101415285-101415307 GCTACTCGGGAGACTGCAGCAGG - Intronic
1073344509 10:102772370-102772392 GCTACTTGAGAGACTGAAGCAGG - Intronic
1073548654 10:104376391-104376413 GCTGCTCGAGAGGTTGAGGCAGG + Intronic
1073691050 10:105809791-105809813 GCTACTAGAGAGACTGAGGCAGG + Intergenic
1073692640 10:105827593-105827615 CCTACTAGAGAGGTTGAAGCAGG - Intergenic
1073697990 10:105892488-105892510 GCTGCTTGAGAGACTGGGGCAGG - Intergenic
1074964666 10:118479683-118479705 GTTTCTGGAGAGATTGGAGCTGG - Intergenic
1075143226 10:119860127-119860149 GGTGCTAGAGAGCCTGCAGGAGG - Intronic
1076523724 10:131097086-131097108 GCTACTTGAGAGGTTGAAGCAGG + Intronic
1076657023 10:132031538-132031560 GCTACTAGGGAGGGTGCAGCAGG - Intergenic
1077657016 11:4029074-4029096 GCTGCTCGGGAGATTGAGGCAGG + Intronic
1078190091 11:9086739-9086761 GCTACTAGGGAGGTTGAAGCAGG + Intronic
1079125593 11:17716588-17716610 GCTGCTGGGGAGTTTGAAGCAGG + Intergenic
1079285872 11:19131743-19131765 GCTGCTCGAGAGACTGAGGCAGG - Intronic
1080154080 11:29087929-29087951 GCTGCTAGGGAGGCTGAAGCAGG - Intergenic
1081090299 11:38856736-38856758 GCTCCTAAAGAGACTGAAGCAGG - Intergenic
1081873842 11:46395862-46395884 GCTGCTTGAAAGCTTCCAGCTGG - Intergenic
1081988904 11:47327162-47327184 GCTGCTAGAGAGATTGCAGCAGG - Intronic
1082049759 11:47761478-47761500 GCTACTAGGGAGGCTGCAGCAGG + Intronic
1082230065 11:49752951-49752973 TCTGTTAGAGATAATGCAGCTGG + Intergenic
1084134243 11:67163742-67163764 GCTACTCGGGAGGTTGCAGCAGG + Intronic
1084268317 11:68016257-68016279 GATGCTGGGGAGATGGCAGCGGG + Intronic
1084668514 11:70591238-70591260 GCTACTAGGGAGATTGAGGCAGG + Intronic
1084957046 11:72697118-72697140 GCTGCTGGAGAGCCTGCGGCAGG - Exonic
1086187455 11:84035654-84035676 GCTAGTAGATAGTTTGCAGCTGG + Intronic
1086324568 11:85685416-85685438 GCTGCTTGAGGGTCTGCAGCTGG + Exonic
1086482042 11:87251973-87251995 GCTGCTAGAGAAATTTCTGTAGG + Intronic
1087206039 11:95394721-95394743 GCAGTTACAGAGTTTGCAGCTGG - Intergenic
1088321282 11:108556830-108556852 GCTGCTGGAGGGATTTAAGCAGG - Intronic
1088472945 11:110206143-110206165 GCTGCTTGGGAGGCTGCAGCAGG + Intronic
1089056639 11:115591019-115591041 GCTGCTATAGTGACTGCTGCTGG + Intergenic
1089335201 11:117718185-117718207 GCTTCTAGAGAGGCTGGAGCCGG - Intronic
1090194616 11:124803947-124803969 GCTACTTGGGAGGTTGCAGCAGG - Intergenic
1090804213 11:130192498-130192520 GCTGCTCGAGAGGATGAAGCAGG - Intronic
1091941812 12:4491966-4491988 GCTACTTGAGAGGTTGAAGCAGG + Intronic
1095054423 12:37582545-37582567 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
1095130029 12:38530106-38530128 GCTGCTTGAGAGGTTGGGGCAGG + Intergenic
1095948564 12:47767917-47767939 GCTACTGGAGTGATTGAAGCAGG + Intronic
1096176259 12:49521589-49521611 GCTGCTAGAAATATTTCTGCAGG + Intronic
1097431027 12:59507059-59507081 GCTACTTGAGAGGCTGCAGCAGG - Intergenic
1097524346 12:60711655-60711677 GCTACTTGAGAGACTGAAGCAGG - Intergenic
1098335603 12:69401516-69401538 GCTGCTAGGTAGACTGCTGCAGG + Intergenic
1098568681 12:71964392-71964414 GCTACTAGAGAGACTGAGGCAGG - Intronic
1098703828 12:73662741-73662763 GCTGAGAGAGAGAATGCAGGGGG - Intergenic
1099363950 12:81744532-81744554 GCTACTTGAGAGACTGAAGCAGG - Intronic
1100499955 12:95164540-95164562 GCTGCTCGGGAGACTGAAGCAGG - Intronic
1100634849 12:96425947-96425969 GCTACTTGAGAGGCTGCAGCAGG - Intergenic
1100902316 12:99256136-99256158 GCTACTCGAGAGGTTGAAGCAGG + Intronic
1102631226 12:114282439-114282461 GCTGCTAGGGAGACTGAGGCAGG + Intergenic
1102928553 12:116845130-116845152 GCTACTTGGGAGATTGAAGCAGG + Intronic
1103087036 12:118069535-118069557 GCTGCTTGGGAGGTTGAAGCAGG - Intronic
1103515162 12:121503087-121503109 GCTACTAGAGAGACTGAGGCAGG - Intronic
1103644732 12:122382247-122382269 GCTACTCGAGAGGCTGCAGCAGG + Intronic
1104767657 12:131340861-131340883 GCTGTAGGAGAGAGTGCAGCAGG - Intergenic
1104812053 12:131625221-131625243 GCTTCAGGAGAGAGTGCAGCAGG + Intergenic
1105230735 13:18493072-18493094 GCTGCTCGGGAGACTGAAGCAGG - Intergenic
1105406359 13:20135838-20135860 GCTACTTGAGAGACTGAAGCAGG - Intergenic
1105866846 13:24468514-24468536 GCTACTGGAGAGGCTGCAGCAGG - Intronic
1106420805 13:29584223-29584245 GCTACTAGGGAGATTGAGGCAGG - Intronic
1107594782 13:41951569-41951591 GCTGTTAGAGAGAGCACAGCGGG - Intronic
1107928048 13:45282614-45282636 GCTACTAGAGAGACTGAGGCAGG - Intronic
1108315290 13:49230920-49230942 GCTGCTAGAGAGGCTGAGGCAGG + Intergenic
1108321730 13:49296827-49296849 GCTGCTAGAGAGGCTGAAGCGGG + Intergenic
1108833471 13:54508771-54508793 GCTGCTAGGGAGACTGATGCAGG - Intergenic
1109447799 13:62466886-62466908 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1109597078 13:64570425-64570447 TCTGCTACAGAGGTGGCAGCAGG - Intergenic
1109655491 13:65385538-65385560 TTTGCTATAGAGATTTCAGCAGG + Intergenic
1110009253 13:70310975-70310997 GCCACTAGAGTGATTGCTGCAGG + Intergenic
1110047838 13:70854014-70854036 GCTGCTTGAGAGGTTGAGGCAGG - Intergenic
1110815288 13:79854256-79854278 GCTACTTGAGAGATTGAGGCAGG + Intergenic
1111665147 13:91257688-91257710 GCTATTAGAGAGGCTGCAGCAGG + Intergenic
1114225732 14:20736820-20736842 GCTACTAGAGAGGCTGAAGCAGG - Intronic
1116851541 14:49914079-49914101 GCTGCTAGGGAGGTTGAGGCAGG - Intergenic
1118707354 14:68492523-68492545 GCTCGTAGAGAGATAGCAGGAGG - Intronic
1118761613 14:68883664-68883686 GCTACTAGGGAGGCTGCAGCAGG + Intronic
1119439181 14:74616812-74616834 GTTGATAAAGAGATTCCAGCAGG + Intergenic
1119491872 14:75041435-75041457 GCTGCTCGAGAGACTGAGGCAGG + Intronic
1120315823 14:82891274-82891296 GCTACTTGAGAGGTTGCGGCAGG - Intergenic
1120952690 14:90057058-90057080 CCTGCTAGAGCGCTTCCAGCCGG - Intergenic
1121051958 14:90825128-90825150 GCTACTTGGGAGATTGAAGCAGG - Intergenic
1121270520 14:92634744-92634766 GCTGCTTGGGAGGTTGAAGCAGG + Intronic
1121391950 14:93583207-93583229 GCTACTAGGGAGATTGAGGCAGG + Intronic
1122413716 14:101538695-101538717 GCTGCTAGAAAGACAGCGGCTGG - Intergenic
1123188485 14:106543844-106543866 GCTGCTAGGGAGACTGAGGCAGG - Intergenic
1124690087 15:31814633-31814655 GCTACTTGAGAGACTGAAGCAGG - Intronic
1125450644 15:39803389-39803411 GCTGCTCGAGAGACTGAGGCAGG - Intronic
1125598969 15:40905339-40905361 GCTGCTAGGGAGGCTGCGGCAGG - Intergenic
1126658373 15:51005471-51005493 CCTGCTAGAGAAACTGCAGATGG + Exonic
1126768525 15:52032794-52032816 GCTGCTAGGGAGGTTGAGGCAGG - Intronic
1126777492 15:52112387-52112409 GCTGCTGGAGAGAGGGCCGCTGG - Exonic
1127165098 15:56236809-56236831 GCTGGTTGAGAGATTGTAGTAGG - Intronic
1129054845 15:72811869-72811891 GCTGGTAGAGAGATCACAGCTGG - Intergenic
1130883638 15:88075684-88075706 GAAGCAAGAGAAATTGCAGCTGG - Intronic
1131203628 15:90422805-90422827 GCTACTTGAGAGGCTGCAGCAGG - Intronic
1132152399 15:99471899-99471921 GATGATAGAGAGATAGCAGGTGG - Intergenic
1133248389 16:4464194-4464216 GCTGCTACAGAGAGTGTGGCTGG + Intronic
1134180291 16:12042477-12042499 GCTGCTAGAGAGAGTAGAGAGGG - Intronic
1135142677 16:19935099-19935121 GCTGTTTTAGAGACTGCAGCAGG + Intergenic
1135197063 16:20403399-20403421 GCTGCTAGGGAGGTTGAAGCAGG - Intronic
1135307036 16:21376228-21376250 GCTGCTAGAGAGAGTAGAGAGGG - Intergenic
1135741171 16:24976415-24976437 GCTGCTTGGGAGACTGAAGCAGG + Intronic
1135973789 16:27091877-27091899 GCTACTAGAGAGGTTGAGGCAGG - Intergenic
1136303782 16:29355368-29355390 GCTGCTAGAGAGAGTAGAGAGGG - Intergenic
1136387361 16:29937546-29937568 GCTACTTGAGAGACTGAAGCAGG + Intergenic
1136622311 16:31437413-31437435 GCTACTTGAGAGACTGAAGCGGG - Intronic
1137093471 16:36223448-36223470 ATTGCTTGAGAGATTGCAGTGGG + Intergenic
1137521667 16:49200433-49200455 GCAGCTAGAGAGACTCCAGCTGG + Intergenic
1138360974 16:56426591-56426613 GCTACTGGAGAGACTGAAGCAGG - Intergenic
1138869798 16:60868347-60868369 GCTACTAGAGAGGCTGAAGCAGG - Intergenic
1138988466 16:62361339-62361361 GCTACTCGGGAGATTGCGGCAGG + Intergenic
1139284114 16:65795648-65795670 GATGCAAGAGAGATAGCAGTTGG + Intergenic
1139819349 16:69708292-69708314 GCTACTAGAGAGGTTGAAGCAGG - Intronic
1140668247 16:77247894-77247916 GCTGCAAGAAAGATTGGAGGTGG + Intronic
1140781613 16:78302070-78302092 GCTGCTAGAGAGGCTGAGGCAGG - Intronic
1141377806 16:83548072-83548094 GCTGCCAGATAGATTGGAGCAGG + Intronic
1141459433 16:84169183-84169205 GCTACTAGAGAGACTGAGGCAGG - Intronic
1141632184 16:85294135-85294157 GCAGCTGGAGAGATGCCAGCTGG - Intergenic
1142302042 16:89264570-89264592 GCTGCTTGGGAGGCTGCAGCAGG - Intergenic
1203071671 16_KI270728v1_random:1082762-1082784 GTTGCTTGAGAGATCGCAGTGGG - Intergenic
1142884620 17:2904991-2905013 GCTACTAGAGAGACTGAGGCAGG - Intronic
1143295455 17:5868289-5868311 GCTACTAGAGAGGTTGAGGCAGG - Intronic
1143655662 17:8292068-8292090 GCTACTCAAGAGGTTGCAGCAGG + Intronic
1144420097 17:15088695-15088717 GCTACTAGAGAGACTGAAGCAGG - Intergenic
1144483909 17:15649396-15649418 GCTGCTAGGGAGGCTGCAGTAGG - Intronic
1145178768 17:20726319-20726341 GCTACTAGAGAGACTGAGGCAGG - Intergenic
1146568164 17:33931028-33931050 GCTGCTAGAGAGGCTGAGGCAGG - Intronic
1147033261 17:37659053-37659075 GCTACTAGAGAGGTTGAGGCAGG - Intergenic
1147366466 17:39962777-39962799 GCTGATAGAGAGGTGGCAGCTGG - Intergenic
1147982318 17:44282117-44282139 GCTACTTGAGAGATTGAGGCAGG + Intergenic
1148725982 17:49790306-49790328 GCTACTAGAGAGACTGAGGCAGG - Intronic
1149297172 17:55271639-55271661 GCTACTAGAGAGGCTGAAGCAGG - Intronic
1149820816 17:59775433-59775455 GCTACTTGAGAGATTGAGGCTGG - Intronic
1149830164 17:59864966-59864988 GCTACTAGGGAGACTGAAGCAGG - Intronic
1150253629 17:63725461-63725483 GCTGCTAGGGAGACTGAAGCAGG - Intronic
1150349978 17:64436825-64436847 GCTGCTCGAGAGACTGAGGCAGG - Intergenic
1150422468 17:65050618-65050640 GCTACTTGAGAGACTGAAGCTGG + Intronic
1150559684 17:66283791-66283813 GCTGCTTGGGAGACTGAAGCAGG - Intergenic
1150974255 17:70066210-70066232 GCTGCTTGAGAGGTTGAAGTGGG - Intronic
1151776917 17:76210914-76210936 GCTGCTCCAGAGACTGAAGCAGG - Intronic
1152802560 17:82338181-82338203 GCTACTAGGGAGATTGAGGCAGG - Intergenic
1153300108 18:3584861-3584883 GCTGCTCAAGAGATTGAAGTGGG - Intronic
1154522671 18:15246789-15246811 GCTGCTCGGGAGACTGAAGCAGG + Intergenic
1155101125 18:22611181-22611203 GATGCTAGAGAGAGTGAAGAAGG + Intergenic
1155993897 18:32309502-32309524 GCTGCTGGGGAGACTGAAGCAGG + Intronic
1156059069 18:33051022-33051044 GCTACTAGAGAGGTTGAGGCAGG - Intronic
1156276205 18:35585065-35585087 GATGCTGGAGAGATTGTAGGTGG + Intronic
1156339931 18:36201548-36201570 GCTGCTCAAGAGATTGAGGCAGG + Intronic
1158592683 18:58790804-58790826 GCTACTAGAGAGACTGAGGCAGG + Intergenic
1159142409 18:64413602-64413624 GCTGCTGGAGAGACTGGGGCAGG + Intergenic
1159824395 18:73188834-73188856 GCTACTCGAGAGGCTGCAGCAGG - Intronic
1160050129 18:75425786-75425808 GCTGCTGAAGAGATTTCAGCAGG - Intronic
1160547059 18:79665370-79665392 GCTACTAGGGAGATTGAGGCAGG - Intergenic
1160979711 19:1811408-1811430 ACTGCTAGAGAGCTGGCAGGTGG - Intronic
1161132843 19:2601793-2601815 GCTACTAGGGAGGTTGAAGCGGG + Intronic
1161253039 19:3291452-3291474 GCTACTTAGGAGATTGCAGCAGG + Intronic
1161466461 19:4433335-4433357 GGTGCTACAGAGCTTCCAGCAGG + Exonic
1161680841 19:5679018-5679040 GCTGCTTGAGAGGCTGAAGCAGG - Intronic
1161968088 19:7560026-7560048 GCTACTTGAGAGGCTGCAGCAGG + Intronic
1162868392 19:13566599-13566621 GCTACTAGAGAGACTGAGGCAGG + Intronic
1163307902 19:16493659-16493681 GCTACTTGAGAGATTGAGGCAGG - Intronic
1164655727 19:29920031-29920053 GCTGCTCGGGAGATTGAGGCAGG + Intergenic
1164929473 19:32164419-32164441 GCTACTAGAGAGGCTGAAGCAGG + Intergenic
1165683400 19:37796895-37796917 GCTGCTCGAGAGACTGAGGCAGG - Intronic
1166535086 19:43568383-43568405 GCTACTAGGGAGATTGAGGCAGG + Intronic
1167229712 19:48274616-48274638 GCTACTAGAGAGGTTGAGGCAGG - Intronic
1167359100 19:49020429-49020451 GCTGCTGGTGAGATGGCAGTTGG + Intergenic
1167481591 19:49735329-49735351 GCTACTAGAGAGGCTGCGGCAGG - Intergenic
1167897725 19:52594623-52594645 GCTGCTAGGCAGGTTGAAGCAGG - Intronic
1168022772 19:53621671-53621693 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1168420583 19:56200068-56200090 GCTGCTAGGGAGGCTGAAGCAGG - Intergenic
1168424780 19:56230546-56230568 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
924993917 2:340148-340170 GCAGCAAGAGAGAGTGCAGTGGG + Intergenic
925225044 2:2176608-2176630 GCTACTAGGGAGGTTGAAGCAGG - Intronic
926342425 2:11914782-11914804 GCTGGCTGAGTGATTGCAGCAGG + Intergenic
926546021 2:14241079-14241101 ACTGGTGGAGAGATTGCAGCGGG - Intergenic
926767369 2:16334161-16334183 GCTGCTAGGGAGACTGAGGCAGG - Intergenic
927597774 2:24412377-24412399 GCTACTTGAGAGATTGAGGCAGG - Intergenic
927605893 2:24486274-24486296 GCTACTAGGGAGACTGAAGCAGG + Intergenic
927665648 2:25030610-25030632 GCTGCTAGAGAGGCTGAGGCAGG + Intergenic
927686174 2:25172544-25172566 GCTACTAGAGAGACTGAAGTGGG - Intergenic
928203117 2:29264002-29264024 GCTGTTTGAGAGACAGCAGCAGG - Intronic
931039186 2:58278027-58278049 GCTACTAGAGAGGCTGAAGCAGG + Intergenic
932611947 2:73206448-73206470 GCTGCTTGGGAGACTGAAGCAGG - Intronic
934088734 2:88532305-88532327 GCTACTAGAGAGAGTGAGGCAGG - Intergenic
934727552 2:96633751-96633773 GCTACTTGGGAGACTGCAGCAGG + Intronic
934893493 2:98090865-98090887 GCTACTCGAGAGGCTGCAGCAGG - Intronic
935224140 2:101038511-101038533 GCTGCTTGCGAGGTTGAAGCAGG - Exonic
935821114 2:106893873-106893895 GCTACTAGGGAGGTTGAAGCGGG - Intergenic
935981664 2:108634238-108634260 GCTGCATGAGAGCTGGCAGCTGG - Intronic
936355326 2:111745348-111745370 GCTGCTAGGGAGGGTGAAGCAGG - Intergenic
938521957 2:132079642-132079664 GCTGCTCGGGAGACTGAAGCAGG + Intergenic
939779137 2:146422958-146422980 GCTGCTAGGGAGACTGAGGCAGG + Intergenic
942138358 2:172952120-172952142 GCTACTTGAGAGACTGAAGCAGG - Intronic
942266691 2:174234573-174234595 GCTGCTTGAGAGGCTGAAGCGGG - Intronic
942512249 2:176715014-176715036 GGAGCAAGAGAGAGTGCAGCGGG - Intergenic
943445573 2:187982851-187982873 GATGCTAAAGAGATTGCAAAAGG - Intergenic
944065213 2:195612435-195612457 GCTACTAGAGAGACTGAGGCAGG + Intronic
944066996 2:195629837-195629859 GCTACTTGAGAGGTTGAAGCAGG - Intronic
944518016 2:200531784-200531806 GCCTCCAGAGAGAGTGCAGCTGG - Intronic
944650475 2:201825200-201825222 GCTGCTCGAGAGAGTGAGGCAGG + Intronic
945429196 2:209745026-209745048 GCTGCTTGAGAGACTGAAGCAGG - Intergenic
945830159 2:214774824-214774846 GCTGATGGAGAAACTGCAGCAGG - Intronic
947213591 2:227729615-227729637 GCTGCTTGGGAGATTGAGGCAGG + Intergenic
947854731 2:233315402-233315424 GCTACTCGAGAGATTGAGGCAGG - Intronic
948438781 2:237972035-237972057 CCTACTAGTGAGCTTGCAGCAGG + Intronic
1172217330 20:33245344-33245366 GCTACTTGAGAGGTTGCGGCAGG + Intergenic
1172360077 20:34306285-34306307 GCTGCTAGAGAGGTTGCATAAGG - Intronic
1172958629 20:38780963-38780985 GCTGCTAGGGAGACTGAGGCAGG + Intergenic
1173108256 20:40159080-40159102 GCTACTCGAGAGACTGAAGCAGG - Intergenic
1173636453 20:44562936-44562958 GCTGCTTGGGAGACTGAAGCAGG + Intronic
1173822489 20:46028638-46028660 ACTGCTCAAGAGATTGGAGCTGG - Intronic
1174014403 20:47476080-47476102 GCTACTCGGGAGATTGCGGCAGG + Intergenic
1174225835 20:48999124-48999146 GCTACTAGGGAGATTGAGGCAGG + Intronic
1174615343 20:51831226-51831248 GGTGCCAGAAAGATTGCAGAGGG - Intergenic
1174840237 20:53894484-53894506 GCTACTAGGGAGATTGAGGCAGG - Intergenic
1175295523 20:57906340-57906362 GCTCCTGGAGAGCTTGCAGAAGG - Intergenic
1176774725 21:13121425-13121447 GCTGCTCGGGAGACTGAAGCAGG - Intergenic
1176782958 21:13221406-13221428 ACTGCTAGGGAGGCTGCAGCAGG - Intergenic
1178888469 21:36500541-36500563 GCTACTAGGGAGGTTGAAGCAGG - Intronic
1178982984 21:37280949-37280971 GCTGCTTGGGAGACTGAAGCAGG - Intergenic
1179380511 21:40894852-40894874 GCTGTTAGAGAGACTGCCACAGG + Intergenic
1179478287 21:41661828-41661850 GCTACTAGAGAGGTTGAGGCAGG - Intergenic
1179609373 21:42540018-42540040 GCTGTTAGGGTGACTGCAGCTGG - Intronic
1181019315 22:20090489-20090511 GCTGCTGGGGAGATGGCTGCTGG + Intronic
1182015975 22:27039896-27039918 GCTGCTAGAGAGGCTGAGGCAGG + Intergenic
1182666331 22:31962951-31962973 GCAGCTGGAGAGATTCCAGTTGG - Intergenic
1183280587 22:36929915-36929937 GCTACTGGAAAGATGGCAGCAGG - Intronic
1184559401 22:45253224-45253246 GCTGCTGGAAAGATGGCGGCTGG - Intergenic
949549945 3:5104398-5104420 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
950073022 3:10167524-10167546 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
950512110 3:13436477-13436499 GCTACTAGAGAGGCTGAAGCAGG + Intergenic
950844939 3:16006101-16006123 GCTGCTAGGGAGACTGAGGCAGG + Intergenic
951120982 3:18928444-18928466 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
951557183 3:23932574-23932596 GCTGCTAGAGAGGCTGAGGCAGG + Intronic
951914973 3:27790892-27790914 GCTGCTAGGGAGGCTGAAGCAGG + Intergenic
952179071 3:30898657-30898679 GCTACTCGGGAGATTGAAGCAGG + Intergenic
952312497 3:32202780-32202802 GCTGCTGGAGGGAGAGCAGCTGG - Intergenic
952870941 3:37900907-37900929 GCTACTAGAGAGACTGAGGCAGG - Intronic
953245441 3:41186904-41186926 GCTGCTTGGGAGATTGAGGCAGG + Intergenic
953445763 3:42964476-42964498 GCTGACAGAGAAACTGCAGCAGG + Intronic
953953653 3:47213315-47213337 GCTACTAGAGAGGCTGCAGTGGG + Intergenic
954364027 3:50136939-50136961 GCTGCCAGTGAGATTTGAGCTGG - Intergenic
955240701 3:57175531-57175553 GCTGCTTGGGAGGTTGAAGCAGG - Intergenic
956437072 3:69244519-69244541 GCTGCTTGGGAGGTTGAAGCAGG + Intronic
957554403 3:81748006-81748028 GCTACTAGGGAGGTTGAAGCAGG + Intronic
957695155 3:83626478-83626500 GCTGCTAGAGAGGCTGAGGCTGG + Intergenic
958966281 3:100562473-100562495 GCTGCTAAAGAGATTGGCGACGG + Intronic
958981883 3:100730772-100730794 GCTGCTGGAGATACTGCAACAGG - Intronic
962147681 3:132857514-132857536 ACTCCTAGAGAGATCTCAGCTGG + Intergenic
962396083 3:135016437-135016459 GCTGTTGGAGAGATTGGAGGAGG + Intronic
963029489 3:140953856-140953878 GCTGCTAGGGAGGCTGAAGCAGG + Intronic
963142063 3:141954523-141954545 GCTACTAGAGAGACTGAGGCAGG + Intronic
964272703 3:154975455-154975477 GCTTGTAGAGAGATTGGAGTAGG - Intergenic
965283711 3:166788495-166788517 GCTACTTGAGAGATTGAGGCAGG - Intergenic
966079936 3:175988921-175988943 TGTGCTGGAGAGATGGCAGCTGG + Intergenic
966768057 3:183479956-183479978 GCTCTTAGAGTGACTGCAGCTGG - Intergenic
967922504 3:194623528-194623550 GCTGCTAGCGAGCCTGCTGCAGG - Exonic
968422081 4:494291-494313 GCTACTCGGGAGGTTGCAGCAGG - Intronic
969272325 4:6111224-6111246 GCTGCTTGGGGAATTGCAGCAGG - Intronic
969364662 4:6687209-6687231 ACATCTGGAGAGATTGCAGCAGG - Intergenic
969863459 4:10055837-10055859 GCTGCAAGAGAGAATGAAGAAGG - Intergenic
970666624 4:18343722-18343744 GCTACTTGAGAGATTGAGGCAGG - Intergenic
971812158 4:31440222-31440244 GCTGCTTGAGAGACTGAGGCAGG - Intergenic
972444993 4:39135476-39135498 GGTGCTGGAGACATTGCAGAAGG - Intergenic
972454228 4:39237452-39237474 GCTGCTAGAGAGGTTGAGGTGGG + Intronic
972470532 4:39399585-39399607 GCTGCTCGGGAGGCTGCAGCAGG + Intergenic
972526471 4:39917684-39917706 GCTACTCGAGAGATTGAGGCAGG - Intronic
973896594 4:55419982-55420004 GCTGCTAGAGAGGCTGAGGCAGG + Intronic
977419040 4:96774162-96774184 GCTTCTAGAGGGATTGCCTCAGG + Intergenic
979256278 4:118610869-118610891 GCTACTTGAGAGGCTGCAGCAGG - Intergenic
979323501 4:119351783-119351805 GCTACTAGGGAGACTGAAGCAGG - Intergenic
979332072 4:119429667-119429689 GCTACTTGAGAGGCTGCAGCAGG + Intergenic
979933364 4:126660902-126660924 GCTGCTAAAGAAATTGCACATGG - Intergenic
980566949 4:134554738-134554760 GCTGTAAGTGAGATTTCAGCTGG - Intergenic
981868402 4:149455861-149455883 GCTACTAGGGAGATTGAGGCAGG + Intergenic
982064490 4:151641211-151641233 GCTGCTTGAGGGATTCCACCAGG + Intronic
982371571 4:154639095-154639117 GCTGCTAGAGAGGCTGAGGCGGG + Intronic
982394923 4:154905905-154905927 GCTACTAGGGAGACTGAAGCAGG + Intergenic
983241334 4:165236461-165236483 GCTACTAGGGAGACTGAAGCAGG - Intronic
983427285 4:167601760-167601782 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
984828719 4:183951560-183951582 GCTGCTTGAGAGACTGAGGCGGG - Intronic
984949512 4:184996441-184996463 GCTACTCGAGAGGTTGTAGCAGG + Intergenic
985663777 5:1171094-1171116 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
986440244 5:7775116-7775138 GCTACTAGAGAGGCTGAAGCAGG - Intronic
986462101 5:7983136-7983158 CCTGCTAGAGAGAGAGCACCGGG - Intergenic
987074725 5:14370235-14370257 GCTACTAGAGAGGCTGAAGCGGG - Intronic
988614617 5:32763432-32763454 GCTACTAGGGAGAATGAAGCAGG - Intronic
988626410 5:32879980-32880002 GCTTCTCGAGAGACTGAAGCAGG - Intergenic
989568922 5:42927094-42927116 GCTACTAGGGAGGTTGAAGCAGG - Intergenic
991099808 5:62780202-62780224 GCTGCTTGGGAGGTTGAAGCAGG + Intergenic
992276063 5:75120281-75120303 GCTACTTGAGAGGTTGAAGCTGG + Intronic
992399003 5:76394460-76394482 GCTACTAGAGAGGTTGAGGCAGG + Intergenic
993386807 5:87270457-87270479 GCTACTAGAGAGGCTGAAGCAGG - Intronic
994362856 5:98874598-98874620 GCTGCTCGAGAGGCTGAAGCAGG + Intronic
994684481 5:102932374-102932396 GCTACTAGAGAGACTGAGGCAGG + Intronic
994881209 5:105498666-105498688 GCTGCAAGAGACATTGAAGAGGG - Intergenic
995205252 5:109472526-109472548 GCTACTGGAGAGATTGAGGCAGG + Intergenic
996073302 5:119159733-119159755 GCTACTTGAGAGATTGAGGCAGG - Intronic
996247313 5:121280554-121280576 GCTGCTAGGGAGGCTGAAGCGGG + Intergenic
996401007 5:123062339-123062361 GCTACTAGAGAGGTTGAAGCAGG + Intergenic
996722452 5:126643261-126643283 GCTGCTAGGGAGGCTGCGGCAGG - Intergenic
996764083 5:127018257-127018279 GCTGCTAGAGAGGCTGAGGCAGG + Intronic
997271013 5:132538013-132538035 GCTGCTAGGGAGGCTGAAGCAGG + Intergenic
997285366 5:132674263-132674285 GCTGCTAGAGAAGTTGGAACTGG + Intronic
998198560 5:140098537-140098559 GCTACTAGAGAGACTGAGGCAGG + Intergenic
998244719 5:140489076-140489098 GCTGCTAGGGAGACTGTAGTGGG + Intronic
998834309 5:146189336-146189358 GCTACTAGGGAGGTTGCGGCAGG - Intergenic
1000067805 5:157711404-157711426 GTTGGTAGAGAGATTGATGCAGG - Intergenic
1001949119 5:175803809-175803831 CCTGCTCTAGAGATGGCAGCAGG - Intronic
1002290569 5:178197866-178197888 GCTGCTAGGGAGGTTGAAGCGGG + Intergenic
1002308127 5:178296357-178296379 GCACCTAGTGAGGTTGCAGCAGG - Intronic
1002516321 5:179761581-179761603 GCTGCTCGAGAGACTGAGGCAGG + Intronic
1002831019 6:820995-821017 GATCCTAGGGAGATGGCAGCTGG - Intergenic
1003368989 6:5506450-5506472 GCAGCTAGAGAGAGTGGGGCTGG + Intronic
1004937294 6:20519948-20519970 GCTACTAGGGAGATTGGGGCAGG + Intergenic
1005744255 6:28821652-28821674 GCTGCTTGGGAGGCTGCAGCAGG + Intergenic
1006382073 6:33704786-33704808 ACTGCTAGAGAAGTTGGAGCAGG - Intronic
1006545822 6:34780365-34780387 GCTACTCGAGAGGCTGCAGCAGG + Intergenic
1007814316 6:44509697-44509719 GCTGCTTGGGAGACTGAAGCAGG + Intergenic
1008297934 6:49801276-49801298 GCTACTAGAGAGGCTGAAGCAGG + Intergenic
1009951137 6:70397573-70397595 TGTGCGAGAAAGATTGCAGCTGG - Intergenic
1012367552 6:98460744-98460766 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
1013111283 6:107067413-107067435 GCTCCTGGAGAGCATGCAGCTGG + Exonic
1015032212 6:128608582-128608604 GCTGCTAGCAAGACTGGAGCAGG - Intergenic
1016052011 6:139539469-139539491 GCTGCTTGAGAGACTGAGGCAGG + Intergenic
1016381248 6:143483624-143483646 GCTGCTGGAGAGTTTTGAGCAGG + Intronic
1016412138 6:143794680-143794702 GCTGCTTGGGAGACTGAAGCAGG + Intronic
1016641475 6:146354154-146354176 GCTGCTAGTTAGATGGGAGCAGG + Intronic
1017466209 6:154696197-154696219 GCTACTAGAGAGATTGAGGTGGG + Intergenic
1018117245 6:160599229-160599251 GCTGCTAGAGAGGCTGAAGCAGG + Intronic
1020018800 7:4849024-4849046 GCTACTCGAGAGACTGAAGCAGG + Intronic
1020652264 7:10889914-10889936 GCTACTAGGGAGGCTGCAGCAGG - Intergenic
1021252854 7:18353289-18353311 GCTGTTTGAGAGCTTTCAGCAGG + Intronic
1021500670 7:21329388-21329410 GCTCCTTGAGAGGCTGCAGCTGG + Intergenic
1022328044 7:29350994-29351016 GCTGCTCGAGAGACTGAGGCAGG + Intronic
1022360966 7:29656953-29656975 GCTGCTAGGGAGGTTGAGGCAGG - Intergenic
1022518231 7:30988951-30988973 GCTGCTGGAGAGATTGTTGCGGG + Intronic
1022518334 7:30989497-30989519 GCTGCCAGAGAGATCACTGCGGG - Intronic
1022737164 7:33086973-33086995 GCTACTAAAGAGAATGAAGCAGG + Intergenic
1023719450 7:43077885-43077907 CCTGCTAGAGAGCTTCCGGCCGG + Intergenic
1024052510 7:45636650-45636672 GCTACTAGAGAGGTTGAGGCAGG - Intronic
1024500922 7:50104832-50104854 GAAGCTAGTGAGAATGCAGCTGG - Intronic
1025151739 7:56560225-56560247 GCTACTCGAGAGGTTGAAGCAGG - Intergenic
1025487981 7:61075661-61075683 ATTGCTTGAGAGATTGCAGTGGG - Intergenic
1025566002 7:62434811-62434833 ATTGCTTGAGAGATTGCAGTGGG + Intergenic
1025929888 7:65985079-65985101 GCTACTAGAGAAGTTGAAGCAGG + Intergenic
1026215139 7:68341899-68341921 GCTGCTAGAGAGGCTGAGGCAGG + Intergenic
1026324192 7:69294798-69294820 GCTACTAGGGAGATTGAGGCAGG - Intergenic
1026797264 7:73374325-73374347 GCTGCTGGAGAGGCTGAAGCGGG + Intergenic
1027380848 7:77607863-77607885 GCTGCTAGGGAGGCTGAAGCAGG - Intronic
1027656518 7:80936895-80936917 GCTGCTCGAGAGGCTGCGGCAGG - Intergenic
1028232041 7:88317176-88317198 GCTGCTAGAGAGGCTGAGGCAGG + Intergenic
1028895858 7:96040831-96040853 GCTGCTAGGGAGGTTGAGGCAGG - Intronic
1030695478 7:112580616-112580638 GTTGCTGGAGAGTTTGAAGCAGG + Intergenic
1031049688 7:116932470-116932492 GCTGCTCGAGAGACTGAGGCAGG - Intergenic
1031069411 7:117145093-117145115 GCTGCTTGAGAGGCTGAAGCAGG + Intronic
1032392902 7:131567959-131567981 GCTACTAGGGAGACTGAAGCAGG - Intergenic
1033119356 7:138653226-138653248 GCTGCTGGAGAAGCTGCAGCAGG + Intronic
1034340114 7:150347368-150347390 GCTTCTAGAGAGGCTGAAGCAGG - Intergenic
1034651576 7:152695271-152695293 GCTACTCGAGAGACTGAAGCAGG + Intergenic
1034982752 7:155489234-155489256 GCTGCTTGAGAAGTTGCAGAGGG - Intronic
1035010087 7:155707766-155707788 GCTACTAAAGAGATTGAGGCAGG - Intronic
1035514479 8:220761-220783 GCTACTAGGGAGACTGAAGCAGG + Intergenic
1035871313 8:3138721-3138743 GCTGCTGGAGATATTTCAGAGGG + Intronic
1036614648 8:10378959-10378981 GCTGGAAGAGAGATGACAGCAGG - Intronic
1036629703 8:10502415-10502437 GCTACTTGAGAGACTGAAGCAGG + Intergenic
1037026718 8:14047449-14047471 TCTTCTAGAGAGACTGCATCAGG - Intergenic
1037420624 8:18698208-18698230 GCTACTTGAAAGATTGAAGCAGG - Intronic
1038250605 8:25900345-25900367 GCTACTTGGGAGATTGAAGCAGG + Intronic
1038290446 8:26244551-26244573 GCTACTTGAGAGGTTGAAGCAGG + Intergenic
1038317080 8:26494792-26494814 GCTACTTGAGAGGTTGAAGCAGG - Intronic
1040996207 8:53405539-53405561 GCTACTAGGGAGGCTGCAGCAGG + Intergenic
1041170532 8:55137673-55137695 GCTACTTGAGAGGTTGAAGCAGG - Intronic
1041502045 8:58549677-58549699 GCTGCTAGAGAGGCTGAGGCAGG - Intergenic
1042540576 8:69903796-69903818 GCTGCTTGAGAGGTTGAAGTGGG - Intergenic
1042592788 8:70413887-70413909 ACTACCAGAGAGATTGCAGTTGG + Intergenic
1042865622 8:73354507-73354529 GCTGCTAGAGAGGCTGAGGCAGG - Intergenic
1043347604 8:79317981-79318003 GCTGCTAGATTTATTCCAGCAGG - Intergenic
1043760228 8:84059090-84059112 GCTGCTAGGGAGGTTGAGGCAGG + Intergenic
1044590436 8:93909159-93909181 GCTACTAGAGAGGTTGAGGCAGG - Intronic
1045685379 8:104706017-104706039 GCTGCCAGAGTGATTGAAGTTGG + Intronic
1045796236 8:106048309-106048331 GGTGCAAGAGAGAGTGCAACAGG - Intergenic
1046981840 8:120345028-120345050 ATTGCTAGAGAAATGGCAGCTGG + Intronic
1047830805 8:128627673-128627695 GCTGCTCGGGAGACTGAAGCAGG + Intergenic
1047872313 8:129097629-129097651 GCTACTAGGGAGGTTGAAGCAGG + Intergenic
1048228177 8:132611004-132611026 GCTCCTCGGGAGATTGAAGCAGG - Intronic
1048873062 8:138814603-138814625 GCTCCTAGTGAGATTGGAGGTGG + Intronic
1048881186 8:138874049-138874071 GCAGCTAGTGAGATTGAATCAGG - Intronic
1049040831 8:140110830-140110852 GCTGCTACAGGGGTTGCAGGGGG - Intronic
1049225367 8:141448194-141448216 GGTCCTGGAGAGCTTGCAGCAGG - Intergenic
1050511914 9:6405363-6405385 GCTACTTGGGAGATTGAAGCAGG - Intergenic
1050601556 9:7258133-7258155 GCTACTAGAGAGGCTGAAGCAGG - Intergenic
1051978457 9:22983312-22983334 GCTACTAGGGAGATTGAGGCAGG + Intergenic
1052304273 9:26988062-26988084 GCTACTAGAGAGACTGAGGCAGG - Intronic
1052902715 9:33807958-33807980 GCTACTAGGGAGACTGAAGCAGG - Intergenic
1053487868 9:38473932-38473954 GCTACTAGGGAGACTGAAGCAGG + Intergenic
1053589691 9:39499467-39499489 GCTGACATAGAGATTTCAGCAGG - Intergenic
1054996487 9:71396852-71396874 GCTGCTAGAGAGGCTGAGGCAGG + Intronic
1055528753 9:77161704-77161726 GCTACTTGGGAGACTGCAGCAGG + Intergenic
1056475471 9:86947501-86947523 GCTGCTAACGAGTCTGCAGCCGG - Intergenic
1056911753 9:90707365-90707387 GCTACTCGAGAGGCTGCAGCAGG + Intergenic
1057529550 9:95831960-95831982 GCAGCTTGAGAGAGTGCAGAGGG - Intergenic
1057710320 9:97435522-97435544 GCTGCTTGAGAGATTGAGGTGGG + Intronic
1058069863 9:100591038-100591060 GCAGCTAGAGAGATTGTATGAGG + Intergenic
1058160511 9:101565099-101565121 GCTACTTGGGAGACTGCAGCGGG + Intergenic
1059038791 9:110789665-110789687 GCTGCTTGAGAGGCTGAAGCAGG + Intronic
1060128487 9:121073623-121073645 GCTGCTTGAGAGGCTGCAGGAGG - Intergenic
1060226999 9:121798604-121798626 CCTGTTAGTGAGATTGCAGAGGG + Intergenic
1061002861 9:127912229-127912251 GCTGCCAGAGAGACCCCAGCAGG + Intronic
1061251738 9:129430415-129430437 GCTGCTCGGGAGATTGAGGCAGG - Intergenic
1061522385 9:131126657-131126679 GCTACTAGGGAGGTTGAAGCAGG - Intronic
1061561439 9:131406468-131406490 GCTGCAAGGGAGACTGCAGCTGG + Intronic
1061612987 9:131760832-131760854 GCTACTCGGGAGACTGCAGCAGG - Intergenic
1061770475 9:132916298-132916320 GCTGCCAGAGTGGTTGCAGTGGG - Intronic
1061887718 9:133601038-133601060 GCTCCCAGAGAGCTTGCAGGCGG - Intergenic
1062428060 9:136515143-136515165 TCTGCAGCAGAGATTGCAGCGGG - Intronic
1185931386 X:4207203-4207225 GCTGCTAGAGAGGCTGAGGCAGG + Intergenic
1185951993 X:4447785-4447807 GCTGCTAGTGAGATTGGAAGGGG + Intergenic
1186121618 X:6369121-6369143 GCTGCTCGGGAGATTGAGGCAGG + Intergenic
1189769842 X:44414819-44414841 GCTACTAGAGAGACTGAGGCAGG - Intergenic
1189786300 X:44561528-44561550 GCTGCTGGAGAGGTTGAGGCAGG + Intergenic
1190716330 X:53106869-53106891 GCTACTAGAGAGGCTGAAGCAGG + Intergenic
1192341597 X:70267899-70267921 GCTGATATAGAGATTGGAGTGGG + Intergenic
1192403700 X:70862801-70862823 GCTACTAGAGAGACTGAGGCAGG + Intronic
1192778456 X:74269267-74269289 GCTGCTTGAGAGGCTGAAGCAGG + Intergenic
1193414808 X:81209117-81209139 GCTACTTGAGAGGTTGAAGCAGG - Intronic
1194336149 X:92648780-92648802 GCTACTCAAGAGATTGAAGCAGG + Intergenic
1194962107 X:100247586-100247608 GCTGCTAGAGAGGCTGAGGCAGG + Intergenic
1195496064 X:105535308-105535330 AGTGCTAGTGAGAATGCAGCAGG + Intronic
1195804432 X:108747628-108747650 GCCACTGGAGAGATTGTAGCAGG + Intergenic
1196302026 X:114058720-114058742 GCTACTTGAGAGATTGAGGCAGG - Intergenic
1197108958 X:122749607-122749629 GCTACTCGGGAGATTGAAGCAGG - Intergenic
1199323426 X:146468375-146468397 GCTGCTAGGGAGATTAAGGCGGG + Intergenic
1199353552 X:146833693-146833715 GCTGCTAGAGATATGGAAGCAGG + Intergenic
1200644583 Y:5765527-5765549 GCTACTCAAGAGATTGAAGCAGG + Intergenic
1200724764 Y:6655755-6655777 GCTACTCGAGAGGCTGCAGCAGG - Intergenic
1201587175 Y:15573802-15573824 GCTACTCGAGAGGTTGAAGCAGG + Intergenic
1201972422 Y:19812147-19812169 GCAGCTAAAGAGAATGCAGAAGG - Intergenic