ID: 1081990670

View in Genome Browser
Species Human (GRCh38)
Location 11:47335865-47335887
Sequence GGGGACACTCACAGCCCTCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 202}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081990664_1081990670 1 Left 1081990664 11:47335841-47335863 CCTTTGGGGAGGGGGGTTGGGGG 0: 1
1: 1
2: 3
3: 315
4: 6296
Right 1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG 0: 1
1: 0
2: 2
3: 17
4: 202

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081990670 Original CRISPR GGGGACACTCACAGCCCTCT GGG Exonic
900136356 1:1118810-1118832 GGGGACACAAACAGCCCGGTTGG - Intergenic
902101367 1:13992665-13992687 GGAGGCACTCTCAGCTCTCTGGG + Intergenic
902733794 1:18386801-18386823 AGGGAGGCTCCCAGCCCTCTGGG + Intergenic
903285025 1:22271412-22271434 GTGGACACCCAAAGCCCTTTAGG + Intergenic
905264703 1:36743646-36743668 GGGGACATTGACAGAGCTCTTGG + Intergenic
905447940 1:38039328-38039350 GGGGGCACTCCCAGCTCTCTGGG + Intergenic
907321161 1:53603251-53603273 TGGGACCCTCACAGCGCTCTGGG + Intronic
908324897 1:63014263-63014285 GGGGACACTGAGGGCCTTCTGGG - Intergenic
915074555 1:153297756-153297778 CTGGGCATTCACAGCCCTCTTGG - Intergenic
917583951 1:176405936-176405958 GGGGACTCCAACAGCCCACTTGG + Intergenic
917926454 1:179793198-179793220 GGGAACACTCACAGCCATGCAGG - Intronic
919336631 1:196244383-196244405 GGGGACAGTAAAAGCCCACTTGG - Intronic
919726135 1:200885570-200885592 GGGTGCTCTCACAGCCCTGTGGG - Intergenic
919740046 1:200975773-200975795 GGTGACAGCCACTGCCCTCTGGG + Intronic
920035095 1:203060407-203060429 GGGGCCACTCACAGTCCTGGAGG - Exonic
921841813 1:219836393-219836415 GGGCACAATCACAGCCCACTGGG + Intronic
922764655 1:228150668-228150690 GGGGAGGCCCACACCCCTCTGGG + Intronic
923714863 1:236416112-236416134 GAGGCCACTCACAGCCTTTTTGG - Intronic
924738472 1:246780283-246780305 GGAGACACTCACTGTCCTGTTGG + Intergenic
1070512790 10:77176574-77176596 GGGGTCATTCACGGCCCTTTGGG - Intronic
1070560357 10:77561793-77561815 AGGGACACTCACAGCACTTAGGG + Intronic
1070825421 10:79387774-79387796 GAGGACACTCAGAGCGGTCTGGG + Intronic
1071707640 10:88016570-88016592 TGGAACTCTCAGAGCCCTCTTGG + Intergenic
1075762094 10:124864719-124864741 TGGGACACACACAGGCCTCAGGG - Intergenic
1076765784 10:132632290-132632312 AGGGACACACACAGAGCTCTAGG - Intronic
1079120281 11:17678462-17678484 GGGGACACTTTCAGGCTTCTGGG + Intergenic
1079687525 11:23379041-23379063 GAGGACACTCAATGCCCTCAAGG + Intergenic
1080836585 11:35945340-35945362 GGGCATCCTCACAGCCCACTGGG + Intronic
1081562035 11:44226612-44226634 GGATTCACTCTCAGCCCTCTGGG - Intronic
1081990670 11:47335865-47335887 GGGGACACTCACAGCCCTCTGGG + Exonic
1083274298 11:61588056-61588078 CGGGACAGTCACAGCTCTCCCGG - Intergenic
1083306619 11:61765047-61765069 GGAGACTCCCACAGCCCTGTGGG + Intronic
1084044874 11:66562730-66562752 GGGGACACTGGGAGCCCTCCTGG + Intronic
1084459761 11:69290053-69290075 GGGGCCACTCTCAGCTCCCTTGG + Intergenic
1084569161 11:69949236-69949258 GGGGGCATGCACAGCCCTGTAGG + Intergenic
1084763838 11:71294634-71294656 GGGGACACCAGCAGCCCACTTGG + Intergenic
1084947359 11:72645620-72645642 GGGGACATTCACAAACATCTGGG - Intronic
1090407745 11:126487359-126487381 GGAGACACACACAGTCCTTTGGG + Intronic
1092285742 12:7128484-7128506 AGGGAAACTCACAGCCCTGAGGG - Intronic
1094853503 12:34392776-34392798 AGGGACACTCAGTGTCCTCTGGG - Intergenic
1095538585 12:43281275-43281297 GGGAAAACTCAAAGCCCACTGGG - Intergenic
1100717571 12:97322087-97322109 TAGGACACACACAGCCCTCTTGG - Intergenic
1101745358 12:107537641-107537663 GTTGACACTCACTGTCCTCTGGG - Intronic
1101819379 12:108172085-108172107 GAGGTCTCTGACAGCCCTCTAGG - Intronic
1102167577 12:110818974-110818996 AGGGCCACTAACAGCCCTCAGGG - Intergenic
1103504212 12:121430330-121430352 CTGGACACTCACAGACATCTCGG + Exonic
1104278746 12:127354441-127354463 GGGGACACCCTCAGCCTTCACGG + Intergenic
1104612005 12:130236528-130236550 GGAGACACTCACTGCCTTCCTGG + Intergenic
1111576953 13:90167153-90167175 GGGGAACCTTACAGCCATCTTGG - Intergenic
1113055295 13:106260648-106260670 AGGGACACTCAGAGCCTTGTGGG - Intergenic
1113296027 13:108959486-108959508 AGGGAGACTCATAGCCTTCTTGG + Intronic
1113537162 13:111076864-111076886 GGAGACGCTCTCAGCCCTCTTGG - Intergenic
1116669429 14:47821865-47821887 GGGGACCCTAAGAGCCCACTTGG + Intergenic
1121275646 14:92665982-92666004 GGGGTCACTCACAGCTCCCAGGG - Intronic
1122300446 14:100728282-100728304 GAGGGCACCAACAGCCCTCTTGG - Intronic
1122533387 14:102445012-102445034 AGGGCCAGTCTCAGCCCTCTTGG - Intronic
1123146837 14:106141348-106141370 GGGGACACTCACAACCACCAGGG - Intergenic
1127155746 15:56123019-56123041 GGGGACCCCAAAAGCCCTCTTGG + Intronic
1127353398 15:58174540-58174562 GGGGTTACTGAGAGCCCTCTGGG + Intronic
1127825055 15:62695901-62695923 GGGGAAGGTCCCAGCCCTCTGGG - Intronic
1128513164 15:68326099-68326121 AGGGTCACTCAGAGCCCTCCTGG - Intronic
1129393931 15:75234220-75234242 GGGGACACTGACACTCCTCAAGG + Intergenic
1129698968 15:77756805-77756827 GGGGACATTCAGTGCCCTCTAGG - Intronic
1129702140 15:77774173-77774195 GTGCACACTCACCACCCTCTAGG - Intronic
1129829403 15:78658507-78658529 GGGGACAAACCCAGTCCTCTTGG + Intronic
1132298185 15:100759856-100759878 TCGGACACTCCCAGCCCTCCCGG + Intergenic
1132298682 15:100763341-100763363 GGGGGCACTCACAGCTTTCTGGG - Intergenic
1132517130 16:371083-371105 CGAGACACTCACAGGCCTCAGGG + Exonic
1132724349 16:1332431-1332453 CTGGACACTCGCAGCCCTTTGGG - Intergenic
1133387904 16:5385577-5385599 AGGGACACTGACAGCCCATTAGG - Intergenic
1133730008 16:8570647-8570669 CTGGACACTCACAGGCCACTGGG - Intronic
1134853416 16:17500285-17500307 AGGGACACTTGCAGTCCTCTGGG - Intergenic
1135957686 16:26969935-26969957 GGTCACTCTCACAGCCATCTTGG - Intergenic
1136995635 16:35186688-35186710 GGTGACAGTCACAGCCCAGTGGG + Intergenic
1138549520 16:57739953-57739975 GGGGACAGACAGAGCCCTCCAGG + Intronic
1138585215 16:57964753-57964775 GGGGGCCCTCACAGCCCCCAAGG + Intronic
1139373340 16:66481561-66481583 GGAGGCCCTCACAGCCCACTAGG + Exonic
1139476178 16:67203573-67203595 GCGGACACTCACCTCCCGCTTGG - Exonic
1139482793 16:67239962-67239984 GAGGAAGCTCACAGCCCTGTGGG + Intronic
1143647203 17:8238463-8238485 AGGGACACTAACAGACCTATCGG - Exonic
1144090798 17:11854418-11854440 GGGGTCACTCACAGCGATCTTGG - Exonic
1145007543 17:19346080-19346102 GGGGACCCACACAGCCATCCAGG - Intronic
1148107461 17:45127060-45127082 GTGGCCACACACAGCCCTTTGGG - Intronic
1151935715 17:77259629-77259651 GGGGACACCCATAGCCCCCAGGG - Intergenic
1152514402 17:80814815-80814837 AGAGACATTCACAGCTCTCTGGG + Intronic
1161061626 19:2217908-2217930 GGAGCCACTCACCGCCCTCTCGG - Exonic
1161293715 19:3508886-3508908 AGGCACACTCACTGCCCTCACGG - Intronic
1161984386 19:7645643-7645665 GGGGACCCTCAGAGACCCCTGGG - Intronic
1162094757 19:8303793-8303815 GGGGACACCCACTGCCTGCTGGG - Intronic
1163342236 19:16716439-16716461 GGGCACACTCCCAGCACTTTGGG - Intergenic
1164491085 19:28714855-28714877 AGGGACACTAATAGCCCGCTGGG - Intergenic
1164727413 19:30475660-30475682 GGGTACAGCCACAGCCCACTGGG + Intronic
1164933685 19:32194997-32195019 GGGGACCCTCTCACCCCTCCTGG + Intergenic
1165330598 19:35139507-35139529 GGGGTCACGCACAGCCCTGCCGG - Intronic
1165728137 19:38126400-38126422 GGTGCCATTCAAAGCCCTCTTGG - Intronic
1166032136 19:40139759-40139781 GGGCTCACTCACACTCCTCTGGG - Intergenic
1167601165 19:50455634-50455656 AGGGTCACTCACAGCCTTCCAGG - Exonic
925429601 2:3779746-3779768 GGGGACACTCGCAGCCTTGCCGG + Intronic
925561866 2:5204698-5204720 GGGGTTACTTCCAGCCCTCTTGG - Intergenic
926334588 2:11853683-11853705 GGGGACACTCACAGACATGGAGG + Intergenic
927865014 2:26582706-26582728 CTGGAAACTCACAGCCTTCTTGG + Intronic
930091597 2:47535045-47535067 GGGGGCACGCAGAGCCCTCGGGG + Intronic
934158266 2:89223323-89223345 GGGGACACTCAGATCTCACTTGG - Intergenic
934209000 2:89959101-89959123 GGGGACACTCAGATCTCACTTGG + Intergenic
934732309 2:96667109-96667131 AGGGACAATCACAGTCCTCAAGG + Intergenic
936977912 2:118237656-118237678 GGGGACATTTTCAGCTCTCTGGG + Intergenic
945018980 2:205552135-205552157 GGGGCCAGTCACTGCCCTTTAGG + Intronic
945437422 2:209835300-209835322 GAGGACACTCCCAGCCCACCTGG - Intronic
948741247 2:240047512-240047534 GGGGACACTCACTGTCCTGAGGG + Intergenic
949050594 2:241895537-241895559 CGGGACCCTCTCAGCTCTCTGGG + Intronic
1168829120 20:834615-834637 GGGGACACCCCCTGCCCCCTAGG + Intronic
1168829956 20:840458-840480 GGTGACAGTCACCTCCCTCTGGG + Intronic
1168896048 20:1324415-1324437 GGGGACAGTCATATCCCTGTCGG + Intronic
1175171398 20:57084019-57084041 GGTGACAGTCACAGGCTTCTGGG - Intergenic
1175294322 20:57897845-57897867 CAGGACACTGACAGCCCTCCTGG - Intergenic
1176020088 20:62958429-62958451 GGGGCCCCTCAAAGCCCCCTTGG - Intronic
1179117143 21:38503882-38503904 GAAGACACTCTCAGCCCTCAAGG + Intronic
1179294918 21:40053247-40053269 TGGGATACTCACAGACATCTTGG - Intronic
1179950810 21:44707937-44707959 GGGGTCACACACATCCCTCCTGG + Intronic
1180698737 22:17770320-17770342 GGGGACACTCCCTGCCTTGTGGG + Intronic
1183596220 22:38813757-38813779 GGTGACTCTCAAAGCCCTCTGGG - Intergenic
1183598921 22:38828788-38828810 GGGGACCTTCACAGCACTCATGG - Intronic
949443294 3:4107005-4107027 GGAAACCCTCAAAGCCCTCTAGG - Intronic
949894667 3:8760299-8760321 GGGTACACCCACAGACCTCTGGG - Intronic
950549800 3:13659234-13659256 GGAGACACCCACAGCCCTCTTGG + Intergenic
951102394 3:18703808-18703830 GGGGAACCTCACAGCCCTAAAGG + Intergenic
952186443 3:30974544-30974566 GGGGACACTCACAGCCTTGTAGG + Intergenic
953562419 3:44002366-44002388 GGTGACTCTCAAAGCCTTCTAGG - Intergenic
953901592 3:46846758-46846780 AGAGACACTCACAGCCCACACGG + Intergenic
956102952 3:65787593-65787615 GGGCACATTCCCTGCCCTCTGGG + Intronic
956539946 3:70325365-70325387 TGAGACACTCACAGCCCGCATGG - Intergenic
961564852 3:127756109-127756131 TGGAACTCTCACAGCCATCTTGG + Intronic
963365040 3:144323769-144323791 GGGGACACTAAGAGCCCATTTGG - Intergenic
967388102 3:188929825-188929847 CCCCACACTCACAGCCCTCTTGG + Intergenic
968570479 4:1337938-1337960 CGAAACACTCACTGCCCTCTGGG - Intronic
968772010 4:2513427-2513449 GGGGTCCCTCATAACCCTCTTGG + Intronic
982932767 4:161429280-161429302 GGGGAAACTCACTGCCCTGAAGG + Intronic
985005931 4:185535450-185535472 GGGGACACTTAGAGCCCGGTGGG - Exonic
985632083 5:1018993-1019015 TGGGAGACTCAGAGCCCTGTTGG + Intronic
985819542 5:2150230-2150252 GAGGACCCACACAGCCCTCCAGG - Intergenic
985989155 5:3540807-3540829 GGACACACACACAGACCTCTGGG + Intergenic
986629478 5:9755875-9755897 GGTGACTCTCATAGCCATCTTGG + Intergenic
988241271 5:28612449-28612471 GTGGAGCCTCACACCCCTCTGGG + Intergenic
991107388 5:62860509-62860531 GGGGAAACTCACTGCCCTGAAGG - Intergenic
997645180 5:135477268-135477290 GGGGCCCCTCACAGCCCCCTCGG - Intergenic
997710356 5:135999003-135999025 GGGGACCTGCACGGCCCTCTAGG - Intergenic
997742416 5:136268580-136268602 GGGGAAACTCAAAGCCAGCTTGG - Intronic
997878873 5:137572326-137572348 GGGCACAGTCACAGGCTTCTGGG - Intronic
997890707 5:137673764-137673786 AGGTACCCTCACAGCCCTCAAGG + Intronic
998328036 5:141299492-141299514 GGGGACAATCCCAGCACTTTGGG + Intergenic
999070111 5:148735739-148735761 GGGGACACTGACAGCCCCCAGGG - Intergenic
999929159 5:156411724-156411746 GGGGACACTGAAACCTCTCTGGG - Intronic
1000064398 5:157682600-157682622 AGGGACACACACAGCCTTCCAGG - Intergenic
1002095394 5:176828006-176828028 TGGGCCTCTCTCAGCCCTCTCGG + Intronic
1004530743 6:16453199-16453221 GGGTACACTCTCAGCACTTTGGG + Intronic
1007703791 6:43779398-43779420 CGGCAGACACACAGCCCTCTTGG + Intronic
1010230311 6:73528778-73528800 GGTGAGACTCTCTGCCCTCTGGG - Intergenic
1010781875 6:79953439-79953461 GGGGCCATTCACAGTCTTCTGGG + Intergenic
1010807710 6:80258579-80258601 GGGGAGCCTCAGAGCCATCTGGG - Intronic
1011271095 6:85580523-85580545 GGGGACCCCAAAAGCCCTCTTGG - Intronic
1017328930 6:153172973-153172995 TGTGACAATCACAGCCATCTGGG - Intergenic
1017653120 6:156601262-156601284 GGGTCCACACCCAGCCCTCTGGG + Intergenic
1019445411 7:1068390-1068412 GGGGACAGTCACAGACCCCCGGG - Intronic
1020071216 7:5228173-5228195 GGGCACACTCGCCGCCCTCCTGG - Exonic
1020287725 7:6698115-6698137 GGGGACACTCACAGAACCCCAGG + Intronic
1021574310 7:22093775-22093797 GAGGACTCTCACAGGCCCCTAGG + Intergenic
1022415481 7:30173335-30173357 TGGGCCACACACAGCACTCTTGG + Intergenic
1022816392 7:33918485-33918507 AGAGACACTCACAGCCTGCTGGG + Intronic
1024301005 7:47887650-47887672 GGTGACGGACACAGCCCTCTGGG + Intronic
1024562818 7:50658938-50658960 GAGGTCTCTCACAGCTCTCTAGG - Intronic
1027138399 7:75639896-75639918 GGGGACGCTCAGAGCCTTCCTGG - Intronic
1027739940 7:81988827-81988849 GGGAACAATCCCTGCCCTCTTGG + Intronic
1028684521 7:93576311-93576333 TGAGTCACACACAGCCCTCTGGG - Intergenic
1028950573 7:96630591-96630613 GGGGACCCTGAGAGTCCTCTTGG + Intronic
1029365187 7:100112096-100112118 TGGGGCCCTCACCGCCCTCTTGG + Exonic
1029409728 7:100401152-100401174 GGGGACACTTCCAGCCTCCTGGG + Exonic
1029490753 7:100868688-100868710 GGGGAGCCTCTCAGGCCTCTGGG + Exonic
1029513746 7:101013132-101013154 GGGGACACTCACAGGCAGCGGGG - Exonic
1031472431 7:122182778-122182800 GGGGACCCTAAGAGCCCACTTGG - Intergenic
1031571414 7:123364441-123364463 GGGGAGTCGCACAGCCTTCTGGG - Intergenic
1033507392 7:142019233-142019255 GGGAACACTTACAGCTCCCTGGG - Exonic
1034228549 7:149501215-149501237 TGGGAGACTCACAGTCCTCTGGG + Intergenic
1035436743 7:158865123-158865145 GAGGACACTCACAGCCCAGATGG - Intronic
1035686336 8:1526330-1526352 GGGGAGACTCTCAGCCCTGCCGG - Intronic
1035753968 8:2017481-2017503 GGGGAAACTCACTGCCCTAAAGG - Intergenic
1040491170 8:47923705-47923727 GAGGACACTCAGAGGCCTCCAGG + Intronic
1041437228 8:57855600-57855622 GGTGAGTCTCACAGCTCTCTGGG + Intergenic
1042178752 8:66063539-66063561 GGCCATACTCACAGCCCACTTGG + Intronic
1045124239 8:99072034-99072056 GGGGACCCTAGCAGCCTTCTTGG + Intronic
1045589960 8:103582472-103582494 GGGGACCCCAAGAGCCCTCTTGG - Intronic
1049274763 8:141714648-141714670 CAGGACACTCACAGTCCTCCTGG - Intergenic
1049637250 8:143695749-143695771 AGGGTCACACACAGCCCCCTCGG - Intronic
1049828411 8:144685115-144685137 GGGCACACTCACACCCATCTAGG + Intergenic
1049828418 8:144685141-144685163 GGGCACACTCACACCTCCCTCGG + Intergenic
1049828425 8:144685168-144685190 GAGCACACTCACACCCCCCTGGG + Intergenic
1049828465 8:144685301-144685323 GGGCACACTCACACCCACCTAGG + Intergenic
1052012780 9:23430767-23430789 GGTCACAGTGACAGCCCTCTTGG + Intergenic
1053433310 9:38058307-38058329 TGGGACACTCTCTGCCCTCTGGG - Intronic
1056951812 9:91046126-91046148 GGGGCCACGCAGAGCCTTCTTGG - Intergenic
1059330048 9:113529115-113529137 GGTGCCACACACAGCCTTCTGGG + Intronic
1060222946 9:121774002-121774024 AGGGTCACTCACTGTCCTCTTGG + Intronic
1060555864 9:124506942-124506964 AGACACACTCACAGACCTCTAGG + Intronic
1060664965 9:125427405-125427427 TGGGACACTCTCAGGCCACTTGG - Intergenic
1062252530 9:135605483-135605505 GGGGACACCCATGGCCCCCTGGG - Intergenic
1062712784 9:137985807-137985829 GGGCACGGTCACTGCCCTCTGGG + Intronic
1185619212 X:1443074-1443096 GTGGACACACACTGCCATCTGGG + Intronic
1185619229 X:1443188-1443210 GTGGACACACACTGCCATCTGGG + Intronic
1185619277 X:1443518-1443540 GTGGACACACACCGCCATCTTGG + Intronic
1185619304 X:1443689-1443711 GTGGACACACACTGCCATCTTGG + Intronic
1185619314 X:1443752-1443774 GTGGACACACACTGCCATCTTGG + Intronic
1185619954 X:1447857-1447879 TGGGACACACACTGCCATCTTGG + Intronic
1185619987 X:1448077-1448099 TTGGACACACACAGCCATCTTGG + Intronic
1185620023 X:1448331-1448353 TGGGACACACACTGCCATCTTGG + Intronic
1188491638 X:30744366-30744388 AGGGAAACTGACAGCACTCTGGG + Intergenic
1189320866 X:40086428-40086450 GGTGACACTCACGGCCCCGTGGG + Intronic
1190733889 X:53242593-53242615 GGGGGCACTCACAGACCAGTCGG - Intronic
1192617292 X:72639655-72639677 GTGGACACTCTCAGCACTCCTGG - Intronic
1195122936 X:101775027-101775049 GGGGACACCAAGAGCCCTCTTGG + Intergenic
1198508281 X:137323480-137323502 TGGGCACCTCACAGCCCTCTGGG - Intergenic
1199455188 X:148020358-148020380 GGGTACACTAAAAGCCCACTTGG + Intronic
1201293182 Y:12441660-12441682 GTGGACTCTCACATCCCTCCAGG - Intergenic
1202195368 Y:22295042-22295064 GTGGACACTCCCACCCCTCAGGG + Intergenic