ID: 1081993045

View in Genome Browser
Species Human (GRCh38)
Location 11:47347803-47347825
Sequence AGGGCCTCAGACTCCAGCAC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 358
Summary {0: 1, 1: 1, 2: 1, 3: 29, 4: 326}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081993038_1081993045 -4 Left 1081993038 11:47347784-47347806 CCCCCAGTCGAGACCCTGAAGGG 0: 1
1: 0
2: 0
3: 11
4: 72
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993042_1081993045 -7 Left 1081993042 11:47347787-47347809 CCAGTCGAGACCCTGAAGGGCCT 0: 1
1: 0
2: 1
3: 9
4: 68
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993035_1081993045 2 Left 1081993035 11:47347778-47347800 CCCTGACCCCCAGTCGAGACCCT 0: 1
1: 0
2: 0
3: 9
4: 186
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993028_1081993045 24 Left 1081993028 11:47347756-47347778 CCGCCCCGCAAATCATCCCCAGC 0: 1
1: 0
2: 1
3: 16
4: 181
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993034_1081993045 6 Left 1081993034 11:47347774-47347796 CCAGCCCTGACCCCCAGTCGAGA 0: 1
1: 0
2: 1
3: 13
4: 181
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993036_1081993045 1 Left 1081993036 11:47347779-47347801 CCTGACCCCCAGTCGAGACCCTG 0: 1
1: 0
2: 0
3: 10
4: 176
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993030_1081993045 20 Left 1081993030 11:47347760-47347782 CCCGCAAATCATCCCCAGCCCTG 0: 1
1: 0
2: 0
3: 14
4: 271
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993032_1081993045 8 Left 1081993032 11:47347772-47347794 CCCCAGCCCTGACCCCCAGTCGA 0: 1
1: 0
2: 2
3: 20
4: 280
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993031_1081993045 19 Left 1081993031 11:47347761-47347783 CCGCAAATCATCCCCAGCCCTGA 0: 1
1: 0
2: 1
3: 37
4: 347
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993041_1081993045 -6 Left 1081993041 11:47347786-47347808 CCCAGTCGAGACCCTGAAGGGCC 0: 1
1: 0
2: 1
3: 3
4: 69
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993033_1081993045 7 Left 1081993033 11:47347773-47347795 CCCAGCCCTGACCCCCAGTCGAG 0: 1
1: 0
2: 1
3: 24
4: 210
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993040_1081993045 -5 Left 1081993040 11:47347785-47347807 CCCCAGTCGAGACCCTGAAGGGC 0: 1
1: 0
2: 0
3: 8
4: 120
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326
1081993029_1081993045 21 Left 1081993029 11:47347759-47347781 CCCCGCAAATCATCCCCAGCCCT 0: 1
1: 0
2: 1
3: 14
4: 169
Right 1081993045 11:47347803-47347825 AGGGCCTCAGACTCCAGCACTGG 0: 1
1: 1
2: 1
3: 29
4: 326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081993045 Original CRISPR AGGGCCTCAGACTCCAGCAC TGG Intronic