ID: 1081995608

View in Genome Browser
Species Human (GRCh38)
Location 11:47361685-47361707
Sequence GCGTGTGTACGTGTGTACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 475
Summary {0: 1, 1: 0, 2: 1, 3: 41, 4: 432}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081995605_1081995608 -8 Left 1081995605 11:47361670-47361692 CCACCAGCCATGCGTGCGTGTGT 0: 1
1: 0
2: 0
3: 17
4: 192
Right 1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG 0: 1
1: 0
2: 1
3: 41
4: 432
1081995603_1081995608 19 Left 1081995603 11:47361643-47361665 CCAGGCAGTGTCTCTGGGACAAG 0: 1
1: 0
2: 5
3: 18
4: 211
Right 1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG 0: 1
1: 0
2: 1
3: 41
4: 432
1081995604_1081995608 -5 Left 1081995604 11:47361667-47361689 CCACCACCAGCCATGCGTGCGTG 0: 1
1: 0
2: 0
3: 11
4: 95
Right 1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG 0: 1
1: 0
2: 1
3: 41
4: 432
1081995600_1081995608 25 Left 1081995600 11:47361637-47361659 CCAGGTCCAGGCAGTGTCTCTGG 0: 1
1: 0
2: 2
3: 34
4: 299
Right 1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG 0: 1
1: 0
2: 1
3: 41
4: 432

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081995608 Original CRISPR GCGTGTGTACGTGTGTACAA AGG Intronic
900137385 1:1123691-1123713 GTGTGTGTAGGTGTGTGCACAGG - Intergenic
900337728 1:2172870-2172892 CCGTGTGTGCGTGTGTGAAACGG + Intronic
900337734 1:2172915-2172937 CCGTGTGTGCGTGTGTGAAACGG + Intronic
900337740 1:2172960-2172982 CCGTGTGTGCGTGTGTGAAACGG + Intronic
900489176 1:2937957-2937979 GTGTGTGTACATGTGTGCATGGG - Intergenic
901029675 1:6299697-6299719 ACGTGTGTGCGTGTGTTTAAGGG + Intronic
901233551 1:7654825-7654847 GGGTGTGTTCGTGTGTATAGGGG - Intronic
901233607 1:7655309-7655331 GTGTGTATAGGTGTGTATAACGG - Intronic
901658328 1:10783281-10783303 GTGTGTGTACATGTGCACATGGG + Intronic
902745964 1:18474620-18474642 GCGTGTGTACATGTGCACATGGG + Intergenic
904012930 1:27400118-27400140 GGGTGTGTACATGTGTGCAAGGG - Intergenic
904482172 1:30800924-30800946 GCATGTGTGTGTGTGTACATAGG - Intergenic
905005705 1:34708495-34708517 GTGTGTACATGTGTGTACAAGGG - Intergenic
905887475 1:41499183-41499205 CCGTGTGTCCGTGTGTGCATAGG + Intergenic
906944585 1:50284910-50284932 GTGTGTGTGTGTGTGTAGAAGGG + Intergenic
908641939 1:66233698-66233720 GTGTGTGTGTGTGTGTATAAAGG + Intronic
908688748 1:66753052-66753074 GTCTGTGTTCGTGTGTACGAAGG - Intronic
908721447 1:67130518-67130540 GCGTATGTGTGTGTGTATAATGG - Intronic
909281791 1:73765307-73765329 GTGTGTGTGTGTGTGTACACAGG + Intergenic
912429203 1:109620283-109620305 GTGTGTGTACGTGTGTTGGAGGG + Intronic
912724713 1:112048706-112048728 GGGTGTGTATGTGTATATAAAGG - Intergenic
913111233 1:115658936-115658958 GTGTGTGTGTGTGTGTACATGGG - Intronic
913160274 1:116139065-116139087 ATGTGTGTACGTGTGTGGAAAGG + Intergenic
913537049 1:119783059-119783081 GCATGTGTACCTGTGCACACAGG - Intergenic
915328589 1:155094190-155094212 GAGGGTGCACATGTGTACAAAGG - Intergenic
915979412 1:160410669-160410691 GTGTGTGTGTGTGTGTATAAGGG - Intronic
916001256 1:160618408-160618430 GTGTGTGTGTGTGTGTAAAATGG + Intronic
916001616 1:160621872-160621894 GTGTGTGTGTGTGTGTAAAATGG + Intronic
916477942 1:165187458-165187480 GTGTGTGTGTGTGTGTACATGGG + Intergenic
916510659 1:165469846-165469868 GTGTGTGTGTGTGTGTACACGGG - Intergenic
916745599 1:167682695-167682717 GTGTGTGTGTGTGTGTACAAGGG + Intronic
918110385 1:181450454-181450476 GTGTGTGTTTGTGTGTAGAAGGG + Intronic
918238971 1:182605140-182605162 GTGTGTGTGTGTGTGTGCAATGG - Intergenic
919249285 1:195031192-195031214 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
920198678 1:204245841-204245863 GTGTGTGTGTGTGTGTACACAGG - Intronic
921922724 1:220686929-220686951 GGGTGTGTACCTGTGTGCAGTGG - Intergenic
922330340 1:224569504-224569526 GCTCCTGTACGTGTGCACAAAGG - Intronic
922924618 1:229337731-229337753 GTGTGTGTGCGTGTCTCCAAGGG + Intronic
924230284 1:241957085-241957107 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
924245659 1:242081622-242081644 GTGTGTGTGTGTGTGTACACTGG - Intergenic
924745178 1:246825513-246825535 GTGTGTGTATGTGTGTATATGGG + Intergenic
1063055559 10:2500641-2500663 GCGTCTGAACGTGTGTACACTGG - Intergenic
1063185713 10:3649433-3649455 GTGTGTGTATGTGTGTAAAATGG - Intergenic
1063232802 10:4082504-4082526 GTGTGTGTATGTGTGTAACAGGG + Intergenic
1063288373 10:4714178-4714200 GCGTGTGTGTGTGTGTAAAGAGG - Intergenic
1064930870 10:20625036-20625058 GTGTGTGTATGTGTGAACATGGG - Intergenic
1065211092 10:23403859-23403881 CCGTCTGTACTTGTGTACATTGG + Intergenic
1065663977 10:28038472-28038494 GTGTGTGTGTGTGTGTAGAAAGG + Intergenic
1067166636 10:43870692-43870714 GTGTGTGTGTGTGTGTACAATGG - Intergenic
1067202465 10:44185253-44185275 GTGTGTGTATGTGTCTATAAAGG + Intergenic
1067823739 10:49553857-49553879 GTGTGTGTGCGTGTGTATAGTGG + Intergenic
1068067945 10:52155726-52155748 GTGTGTGTGTGTGTGTCCAATGG - Intronic
1068795544 10:61075648-61075670 GTGTGTGTGTGTGTGTACTATGG + Intergenic
1069204152 10:65660864-65660886 GTGTGTGTATGTGTATATAATGG + Intergenic
1070726094 10:78791990-78792012 GCTTGTGTATGTGTTTACAGTGG - Intergenic
1071020806 10:81053124-81053146 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1073760678 10:106625232-106625254 GTGTGTGTGTGTGTGTACACTGG + Intronic
1073839864 10:107485925-107485947 GTGTGTGTATGTGTGTATACAGG - Intergenic
1074198295 10:111208372-111208394 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
1075226527 10:120634413-120634435 TCGTGTGTACGTGTGTGTGACGG - Intergenic
1075508102 10:123043931-123043953 GTGTGTGCATGTGTGTACACAGG - Intronic
1076278688 10:129226560-129226582 GCATGTGTCCCCGTGTACAAGGG + Intergenic
1077425059 11:2471594-2471616 GCGTGTGCACCTGTGTATATGGG + Intronic
1077998452 11:7474040-7474062 GTGTGTGTATATGTGTACAGTGG - Intergenic
1078199698 11:9169482-9169504 GTGTGTGTGCGTGTGTATATAGG - Intronic
1079296574 11:19240658-19240680 GCCTGTGCACGTGTGTGTAAGGG - Intronic
1079506701 11:21160994-21161016 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1081840997 11:46201321-46201343 GTGTGTGTTTGTGTGTACACAGG + Intergenic
1081995608 11:47361685-47361707 GCGTGTGTACGTGTGTACAAAGG + Intronic
1085204005 11:74719375-74719397 GTGTGTGTGTGTGTGTACAGGGG - Intronic
1086553287 11:88078505-88078527 GTGTGTGTGTGTGTGTACAGTGG + Intergenic
1086666687 11:89491721-89491743 GTGTGTGTGTGTGTGTACAAGGG - Intronic
1086908677 11:92447241-92447263 GTGTGTGTGTGTGTGTACAGTGG + Intronic
1087420174 11:97912969-97912991 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1088214553 11:107493341-107493363 GTGTGTGTATGTGTGTGCAGAGG - Intergenic
1088888247 11:114024468-114024490 GTGTGTGTGTGTGTGTAGAATGG - Intergenic
1089658942 11:119973261-119973283 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
1089807939 11:121108274-121108296 GTGTGTGTATGTGTGTACTGGGG - Intronic
1090413001 11:126521716-126521738 GTGTGTGTGTGTGTGTATAAGGG + Intronic
1090482588 11:127081278-127081300 GTGTGTGTGCGTGTGTGCACAGG + Intergenic
1090484600 11:127101838-127101860 GTGTGTGTGTGTGTGTACAGAGG + Intergenic
1090568000 11:128016569-128016591 GTGTGTGTATGTGTGTGTAAGGG - Intergenic
1091189711 11:133680931-133680953 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1091196946 11:133739226-133739248 GTGTGTGTAGGTGTGTATATGGG + Intergenic
1091845680 12:3654551-3654573 GAGTGTGTACGTGTGAACTGAGG - Intronic
1091972434 12:4798593-4798615 GTGTGTGTATGTGTGTAGAAGGG - Intronic
1092072498 12:5643057-5643079 GTGTGTGTGTGTGTGTAAAATGG - Intronic
1092955929 12:13549860-13549882 GAGTGTGTGTGTGTCTACAAAGG + Exonic
1094310916 12:29081686-29081708 GTGTGTGTGTGTGTGTACTATGG + Intergenic
1095293201 12:40499805-40499827 GCATGTGTATGTGTGTGCATGGG + Intronic
1097489398 12:60246507-60246529 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1099360852 12:81698757-81698779 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1099558784 12:84147100-84147122 GTGTGTGTCCGTGTGTGAAATGG - Intergenic
1100611830 12:96196338-96196360 GCGTGTGTATGTGTGTTGAGAGG + Intronic
1101158332 12:101948756-101948778 GTGTGTGTGTGTGTGTATAATGG - Intronic
1101812059 12:108115926-108115948 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
1102419412 12:112792064-112792086 GTGTGTCTACGTGTGTGCACTGG + Intronic
1102666286 12:114576281-114576303 GCGTGTGTGTGTGTGTATACAGG + Intergenic
1102695847 12:114798799-114798821 GTGTGTGCACGTGTGTGTAAGGG + Intergenic
1103565402 12:121812774-121812796 GTGTGTGTATGTGTGCACAGAGG + Intronic
1103814539 12:123643342-123643364 TCGTATGTACTTGTGTACATGGG + Intronic
1104112955 12:125721228-125721250 CTGTGTGTACGTGTGTGCATAGG + Intergenic
1104124096 12:125828794-125828816 GTGTGTGTATGTGTGTGCATGGG + Intergenic
1104514248 12:129409373-129409395 GCATGTGTGTGTGTGTATAAGGG - Intronic
1104807630 12:131599628-131599650 GTGTGTGTATGTGTGTGCACAGG - Intergenic
1106317549 13:28608121-28608143 ACATGTGTAAGTGTGTACATGGG - Intergenic
1107250328 13:38351889-38351911 ACGTGTAAATGTGTGTACAAGGG + Intronic
1108140990 13:47421097-47421119 GCGTGTGTTCGTGCATAGAATGG - Intergenic
1111031042 13:82598752-82598774 GTGTGTGTATGTGTGTATAATGG - Intergenic
1111150184 13:84243151-84243173 GCGTGTGTGTGTGTGTAATATGG + Intergenic
1111269328 13:85860359-85860381 GGGTGTGTATGTGGGTGCAAGGG + Intergenic
1112730204 13:102352236-102352258 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1113017038 13:105839115-105839137 GTGTGTGTGTGTGTGTATAATGG - Intergenic
1113057552 13:106285589-106285611 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1113327138 13:109293268-109293290 GCGTGTGTAGGTGTGTGTATAGG - Intergenic
1113443201 13:110345867-110345889 GCATGTGTACCTGTGCACAGGGG + Intronic
1113639613 13:111947889-111947911 GCGTGTGTATATGTGTAAGAGGG + Intergenic
1113734219 13:112665712-112665734 GTGTGTGTCCGTGTGTGTAAGGG + Intronic
1114185701 14:20400296-20400318 GCGTGTGTGTGTGTGTGCAGTGG + Intronic
1115572374 14:34678958-34678980 GCGTGTGTGTGTGTGTATAGTGG + Intergenic
1116167123 14:41349107-41349129 GTGTGTGTGCGTGTGTGTAAGGG - Intergenic
1116338194 14:43686469-43686491 GTGTGTGTCTGTGTGTATAACGG - Intergenic
1116579746 14:46624683-46624705 GTGTGTGTGTGTGTGTACAAAGG - Intergenic
1118271822 14:64350591-64350613 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
1118384907 14:65247917-65247939 GCGTGTGCGTGTGTGTGCAAGGG - Intergenic
1118429205 14:65699139-65699161 GTGTGTGTGTGTGTGTAGAAGGG - Intronic
1119970954 14:78969841-78969863 GTGTGTGTGTGTGTGTATAAAGG + Intronic
1120614603 14:86688310-86688332 GTGTGTGTAGGTGTGTATATGGG - Intergenic
1121563235 14:94889590-94889612 GTGTGTATAGGTGTGTACATGGG + Intergenic
1122774486 14:104111117-104111139 GCGTGCATATGTGTGTGCAAAGG + Intronic
1123080254 14:105689526-105689548 GGGTGTGTATGTATGTACACGGG - Intergenic
1123432656 15:20231763-20231785 GTGTGTGTATGTGTGTAGAGAGG - Intergenic
1123830477 15:24131107-24131129 GTGTCTGTATGTGTGTAAAATGG + Intergenic
1123841338 15:24250562-24250584 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123850728 15:24353713-24353735 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123855608 15:24407953-24407975 GTGTGTGTATGTGTGTAAAATGG + Intergenic
1123864138 15:24500134-24500156 GTGTGTGTATGTGTATAAAATGG + Intergenic
1126107054 15:45153532-45153554 GTGTGTGTGTGTGTGTATAATGG + Intronic
1129209331 15:74058132-74058154 GTGTGTGTGTGTGTGTACAGTGG - Intergenic
1129270375 15:74416344-74416366 GCGTGTGAGCGTGTGTATGATGG - Intronic
1129551730 15:76458271-76458293 GTGTGTGTGCGTGTATATAAAGG + Intronic
1129617544 15:77111243-77111265 GTGTGTGTATGTGTCTACAGAGG + Exonic
1129683399 15:77671121-77671143 GGGTGTGCAGGTGAGTACAAGGG + Intronic
1130797050 15:87220916-87220938 GTGTGTTTGCGTGTGTACATGGG + Intergenic
1131026471 15:89146392-89146414 GTGTGTGTACGTATGTATATGGG + Intronic
1131712148 15:95067713-95067735 GTGTGTGCAAGTGTGTAGAAGGG - Intergenic
1132975857 16:2710901-2710923 GTGTGTGTATGTGTGCACATGGG + Intergenic
1133504956 16:6402645-6402667 GTGTGTGTATGTGTTTACATAGG - Intronic
1133638923 16:7698200-7698222 GTGTGTGTGTGTGTGTATAAAGG + Intronic
1134168186 16:11947261-11947283 GTGTGTGTGTGTGTGTACATAGG + Intronic
1134395334 16:13857484-13857506 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1134624891 16:15716526-15716548 GTGTGTGTATGTGTGTGGAAGGG + Intronic
1135165403 16:20134640-20134662 GTGTGTGTATGTGTGTACAGGGG + Intergenic
1135206425 16:20488432-20488454 GTGTGTGTGTGTGTGTACAGAGG - Intergenic
1135212499 16:20535513-20535535 GTGTGTGTGTGTGTGTACAGAGG + Intergenic
1137592608 16:49702896-49702918 GTGTGTGTGCGTGTGCACACAGG - Intronic
1137720303 16:50623749-50623771 GTGTGTGTGTGTGTGTACACAGG + Intronic
1137924338 16:52525688-52525710 GCGTGTGTGTGTGTGTACGCAGG - Intronic
1138660391 16:58513182-58513204 GTGTGTGTGTGTGTGTACATCGG + Exonic
1138936334 16:61729298-61729320 GTGTGTGTATGTGTGTATGAAGG + Intronic
1139719731 16:68842909-68842931 GCGTGTGTACGTCTGTACTTAGG + Intergenic
1140700539 16:77577412-77577434 GAGTGTGTGTGTGTGTATAATGG + Intergenic
1140843957 16:78868954-78868976 GTGTGTGTCTGTGTGTACATGGG - Intronic
1140888722 16:79267418-79267440 GTGTGTGTACGTGTGTGGTATGG + Intergenic
1140946153 16:79770268-79770290 GCGTGTGTGCGTGTGTTCAAGGG + Intergenic
1141983431 16:87564012-87564034 GGGTGTGTGCGTGTGTGCACGGG + Intergenic
1142268357 16:89076436-89076458 GCATGTGTACTCGTGTACATAGG + Intergenic
1142562020 17:815855-815877 GTGTGTGCACGTGTGTGCACAGG - Intronic
1142744074 17:1946434-1946456 GCATGTGTACGTGTGTGCACAGG + Intronic
1143355461 17:6324730-6324752 GCATGTGTAGGAGTGTATAAGGG - Intergenic
1143394441 17:6580893-6580915 GTGTGTGTGTGTGTGTACAGAGG - Intronic
1143911582 17:10254539-10254561 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1144662606 17:17080950-17080972 GCTTGTGTGTGTGTGTACCAGGG + Intronic
1147190380 17:38734969-38734991 GTGTGTGTATGTGTGGAAAATGG - Exonic
1149289691 17:55206208-55206230 GTCTGTGTATGTGTGTGCAAGGG + Intergenic
1150291546 17:63985207-63985229 GCGTGTGTGTGTGTGTACACTGG - Intergenic
1151851841 17:76695362-76695384 GTGTGTGTGTGTGTGTGCAACGG + Intronic
1151881903 17:76900977-76900999 GTGTGTGCATGTGTGTACATGGG + Intronic
1152526887 17:80893396-80893418 GTGTGTGTGTGTGTGTACAAGGG + Intronic
1152737852 17:82006077-82006099 GCGTGTGCACGTGTGTGCTTGGG + Intronic
1152859904 17:82690342-82690364 GAGTGTGTACGTGTGTCCAGGGG + Intronic
1152859934 17:82690582-82690604 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859947 17:82690662-82690684 GAGTGTGCACGTGTGTGCAGGGG + Intronic
1152859958 17:82690741-82690763 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152859969 17:82690820-82690842 GAGTGTGCACGTGTGTCCAGGGG + Intronic
1152903661 17:82958861-82958883 GTGTGTGTGTGTGTGTACACTGG + Intronic
1153378491 18:4408954-4408976 GTGTGTGTGTGTGTGTATAATGG - Intronic
1155387635 18:25297118-25297140 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1156336390 18:36176291-36176313 GTGTGTGTGCGTGTATACCAAGG + Intronic
1156691336 18:39710489-39710511 GTGTGTGTGTGTGTGTACGAAGG + Intergenic
1159327562 18:66942915-66942937 GTGTGTGTATGTGTATATAAGGG - Intergenic
1160097968 18:75892609-75892631 GCGTGTGTCCTTGTGCACACTGG + Intergenic
1161280860 19:3444796-3444818 GCGTGTGTGTGTGTGTGCAGGGG - Intronic
1161443153 19:4304017-4304039 GCGGGTGTACGTGTCTGCAGGGG - Intergenic
1162129534 19:8517566-8517588 GTGTGTGTGCGTGTGTGCAGGGG + Intergenic
1165439998 19:35820051-35820073 GTGTGTGTGTGTGTGTACATTGG - Intergenic
1166222953 19:41377239-41377261 GCATGTGTGCGTGTGTGCACAGG + Intronic
1167650487 19:50725909-50725931 GCGTTTGTACGCGTGTACTCCGG - Intergenic
925040401 2:728851-728873 CTGTGTGTGCGTGTGTGCAAGGG + Intergenic
927678421 2:25123783-25123805 GTGTGTGCACGTGTGTGCAGTGG - Intronic
930389323 2:50740613-50740635 GCCTGTGTACGTATATAAAATGG + Intronic
931166047 2:59749696-59749718 GTGTGTGTGTGTGTGTCCAAAGG + Intergenic
931201987 2:60106333-60106355 GTGTGTTTGCGTGTGTGCAAAGG - Intergenic
931207963 2:60166015-60166037 ACGTGTGTGTGTGTGTAGAAGGG - Intergenic
931544136 2:63362287-63362309 GTGTGTGTGTGTGTGTAGAAAGG + Intronic
932626006 2:73296259-73296281 GTGTGTGTATGTGTGTCCATTGG - Intergenic
932627636 2:73311096-73311118 GTGTGTGTACGTGTGTGTATGGG + Intergenic
934639892 2:96021540-96021562 GCTTGTGTACGTGTGTCTGACGG + Intergenic
935098150 2:99967176-99967198 ACCTGTGTACCTGTGTATAAGGG - Intronic
935842444 2:107128209-107128231 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
936012752 2:108935641-108935663 GCGTGTGTGTGTGTGTGAAAAGG - Intronic
937359561 2:121219350-121219372 GCGTGTTTACATGTGTACCTGGG - Exonic
937472630 2:122187126-122187148 TCCTGTGTGCGTGTGTAAAAGGG - Intergenic
940523119 2:154777021-154777043 GCGTGTGTACGTGTGAAAACTGG - Intronic
940627699 2:156196198-156196220 GCCTGTGTATGTGTGTATGAAGG + Intergenic
940999644 2:160188256-160188278 ATGTATGTATGTGTGTACAAGGG + Intronic
941467111 2:165841130-165841152 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
943393580 2:187302972-187302994 GTGTGTGTATGTGTGTGTAACGG + Intergenic
944905403 2:204257036-204257058 GTGTGTGTGTGTGTGTAAAAAGG - Intergenic
945179880 2:207081069-207081091 GTGTGTGTGTGTGTGTACAGAGG + Exonic
946165050 2:217858665-217858687 GTGTGTGTGTGTGTGTACATGGG - Intronic
946521632 2:220471111-220471133 GTGTGTGTATGTGTGTATAATGG + Intergenic
946692012 2:222316634-222316656 GTGTGTGTACACATGTACAATGG + Intergenic
946888821 2:224252590-224252612 GTGTGTGTGTGTGTGTACACAGG - Intergenic
947101668 2:226627838-226627860 GAGTGTGTGTGTGTGTACCATGG + Intergenic
947350350 2:229236973-229236995 GTGTGTGTATGTGTGTGTAAAGG - Intronic
948661564 2:239510096-239510118 GTGTGTGTGCGTGTGTGCAGTGG + Intergenic
1168740228 20:183094-183116 GTGTGTGTGTGTGTGTACAGAGG - Intergenic
1173761146 20:45561760-45561782 GTGTGTGTGTGTGTGTACAGTGG + Intronic
1174786984 20:53442180-53442202 GTGTGTGTACGTGTGTGTAAAGG + Intronic
1174821265 20:53728536-53728558 GTGTGTGTATGTGTGTGTAAGGG + Intergenic
1174874624 20:54213396-54213418 GTGTGTGTGAGTGTGTACACAGG - Intronic
1175528347 20:59652745-59652767 GATTGTGGACGTGTCTACAAGGG - Intronic
1175864738 20:62169273-62169295 GTGAGTGTGCGTGTGTGCAAGGG - Intronic
1176302790 21:5106685-5106707 GCGTGTGCAGGTGTGCACATAGG - Intergenic
1178706078 21:34874147-34874169 GTGTGTGTGCGTGTGTGCAAGGG - Intronic
1178710045 21:34908953-34908975 GTGTGTGTATGTGTGTGCTAGGG + Intronic
1179854234 21:44155238-44155260 GCGTGTGCAGGTGTGCACATAGG + Intergenic
1180195871 21:46193966-46193988 GCATGCGTACGTGTGTGCATAGG + Intronic
1181476573 22:23171520-23171542 GTGTATGTACATGTATACAATGG - Intergenic
1181991972 22:26844020-26844042 GAGTGTGTATGTGTGCACACTGG + Intergenic
1182760801 22:32720973-32720995 GGATGTGAACGTGTGTACTAAGG - Intronic
1182887201 22:33784939-33784961 ACGTGTATACATGTGTACATGGG + Intronic
1184303970 22:43582327-43582349 GTGTGTGTATGTGTATAGAAAGG - Intronic
1185316144 22:50179991-50180013 ACGTGTGTGCGTGTGCACAGAGG + Exonic
949284886 3:2390236-2390258 GTGTGTGTGTGTGTGTACAGAGG + Intronic
950160619 3:10758003-10758025 GGGTGTGTACGTGAGTACTGGGG + Intergenic
950908452 3:16561121-16561143 GTGTGTGTGTGTGTTTACAAAGG + Intergenic
951258510 3:20479699-20479721 GTGTGTGTCTGTGTGTGCAAGGG - Intergenic
951763308 3:26168613-26168635 GTGTGTGCACTTGTGTAAAAGGG - Intergenic
954850266 3:53594095-53594117 ACGTGTGTCCGTGTGTGTAAAGG + Intronic
955329234 3:58033166-58033188 GTGAGTGTACATGTGTACACAGG - Intronic
956524552 3:70143370-70143392 GTGTGTGTGTGTGTGTATAATGG + Intergenic
956768903 3:72507876-72507898 GCGTGTGTGTGTGTGTAGACGGG - Intergenic
956964797 3:74446406-74446428 TCGTGTGTGTGTGTGTAGAAAGG + Intronic
957614661 3:82510977-82510999 GTGTGTGTATGTGTATAAAAAGG - Intergenic
957662992 3:83184955-83184977 GTGTGTGTGTGTGTGAACAAAGG - Intergenic
958032541 3:88130250-88130272 GTGTGTGTATGTGTGTATATGGG - Intronic
960050466 3:113234351-113234373 GTGTGTGTATGTGTGCACATGGG + Intronic
960253308 3:115482034-115482056 GCGTGTGTGTGTGTGTGTAATGG + Intergenic
961356978 3:126345588-126345610 GTGTGTGTGCGTGAGTACATGGG - Intronic
961793766 3:129394831-129394853 GTGTGTGTATGTGTGTGCAGGGG - Intergenic
962366785 3:134792113-134792135 GCGTGTGTGTGTGTGTGCAGGGG + Intronic
962421398 3:135232385-135232407 GTGTGTGAACTTGTCTACAATGG + Intronic
962435871 3:135366291-135366313 ACGTGTGTGTGTGTTTACAAGGG + Intergenic
963284749 3:143423202-143423224 GTGTGTGTACGTGTGTGTGAGGG - Intronic
963334712 3:143961342-143961364 GCGTGTGTATGTGTGTAGAGGGG + Intergenic
963778011 3:149459324-149459346 GTGTGTGTGTGTGTGTACAAAGG + Intergenic
964626535 3:158765305-158765327 GCGTGTGTGTGTGTGTGCGAGGG - Intronic
965297490 3:166968316-166968338 GTGTGTGTGTGTGTGTGCAATGG + Intergenic
965652931 3:170952701-170952723 GTGTGTGTATGTGTGTATAGAGG + Intergenic
967151318 3:186653368-186653390 GCATGTGTGCGTGTGCACATAGG - Intergenic
967563891 3:190951116-190951138 GTGTGTGTGTGTGTGTATAATGG - Intergenic
967974324 3:195024120-195024142 GCGTGTGTGTGTGTGTAGATGGG - Intergenic
971724643 4:30294661-30294683 TTGTGTGTATGTGTGTATAAAGG - Intergenic
971772463 4:30914938-30914960 GTGTGTGTATGTGTGTTTAATGG - Intronic
972889436 4:43538159-43538181 GAGTGTGTGTGTGTATACAATGG + Intergenic
974686593 4:65240020-65240042 GTGTGTGTGTGTGTGTAGAAGGG + Intergenic
974714116 4:65644221-65644243 GAGTGTGTATGTGTGTGCATGGG - Intronic
974889196 4:67858669-67858691 GGGTGTGCAGGTGTGTACATGGG - Intronic
975557432 4:75678326-75678348 GTGTGTGTGTGTGTGTACACAGG + Intronic
977284538 4:95085997-95086019 GTGTGTGTGTGTGTGTAAAAAGG + Intronic
978402519 4:108345654-108345676 GTGTGTGTATGCGTGTATAATGG + Intergenic
979234170 4:118380915-118380937 GTGTGTGTGTGTGTGTACACTGG + Intergenic
979876962 4:125905070-125905092 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
981107665 4:140899570-140899592 GCATGTGTATGTGTGTGCACAGG + Intronic
982950134 4:161684104-161684126 CCATGTGTACATGTGTACCATGG - Intronic
983260314 4:165449020-165449042 GCGTGTGTTTGTGTGCACACAGG + Intronic
983333926 4:166367861-166367883 GTGTGTGTGTGTGTGTATAATGG + Intergenic
983922417 4:173360130-173360152 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
984043408 4:174767117-174767139 GTGTGTGTGTGTGTGTAAAATGG - Intronic
984249957 4:177319782-177319804 GGGTGTGTGTGTGTGTAAAATGG + Intronic
985329443 4:188813503-188813525 GTGTGTGTGCGTATGTACACAGG + Intergenic
985752423 5:1688333-1688355 GTGTGTGTGTGTGTGTACCATGG + Intergenic
985959886 5:3293446-3293468 GGGTGTGTGCGGGTGTGCAAAGG - Intergenic
986713913 5:10508729-10508751 GTGTGTGTGTGTGTGTACAGGGG - Intronic
987122798 5:14783283-14783305 GTGTGTGTGTGTGTGTAGAATGG - Intronic
987466670 5:18280113-18280135 GTGTGTGTGCTTGTGTACATGGG + Intergenic
987698015 5:21357081-21357103 GTGTGTGTGTGTGTGTACATGGG + Intergenic
987848023 5:23313299-23313321 GTGTGTGTGTGTGTGTACATGGG + Intergenic
987902639 5:24032343-24032365 GTGTGTGTGTGTGTGTAGAAAGG - Intronic
988433924 5:31151049-31151071 GTGTGTGTGTGTGTGTAAAAGGG - Intergenic
988520876 5:31944733-31944755 GCGTGTGCACGTGTGTCCCCAGG + Intronic
988848384 5:35153711-35153733 GTGTGTGTGTGTGTGTACAATGG - Intronic
990603579 5:57385160-57385182 GTGTGTGTATGTGTGTAGCAGGG + Intergenic
991230073 5:64322623-64322645 GTGTGTGTGTGTGTGTATAACGG + Intronic
991410931 5:66344993-66345015 GTGTGTGTGTGTGTGCACAAGGG + Intergenic
991742425 5:69695297-69695319 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991755269 5:69859911-69859933 GTGTGTGTGTGTGTGTACATGGG + Intergenic
991793999 5:70275037-70275059 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991821815 5:70570600-70570622 GTGTGTGTGTGTGTGTACATGGG - Intergenic
991834596 5:70735059-70735081 GTGTGTGTGTGTGTGTACATGGG + Intergenic
991886376 5:71274569-71274591 GTGTGTGTGTGTGTGTACATGGG - Intergenic
992892476 5:81216342-81216364 GTGTGTGTGTGTGTGTAGAAAGG - Intronic
993378838 5:87182450-87182472 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
993503459 5:88686120-88686142 GTGTGTGTGTGTGTGTACAGAGG - Intergenic
993612078 5:90066753-90066775 GTGTGTGTATGTGTGTGCATGGG - Intergenic
993843499 5:92910176-92910198 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
993885238 5:93408368-93408390 GTGTGTGTGTGTGTGTATAAGGG - Intergenic
995549434 5:113266232-113266254 GTGTGTGTGTGTGTGTAGAAGGG - Intronic
996541083 5:124630497-124630519 GCATGTGTGCGTGTGTGCTAGGG + Intergenic
998270909 5:140705804-140705826 GCGTGTGTGTGTGTGTAGTAGGG + Exonic
998351010 5:141501284-141501306 GTGTGTGTGTGTGTGTATAAGGG - Intronic
998906940 5:146915441-146915463 GTGTGTGTGTGTGTGTACATAGG - Intronic
999514787 5:152290162-152290184 GTGTGTGTGTGTGTGTATAAAGG + Intergenic
1000408685 5:160915834-160915856 GCAAGTGTATGTGTGTGCAAAGG - Intergenic
1000408808 5:160916990-160917012 GCAAGTGTACGTGTGTGCAAAGG + Intergenic
1001462855 5:171933585-171933607 GTGTGTGTATGTGGGTAGAAGGG + Intronic
1001552853 5:172617173-172617195 GCGTGTGTGGGTGTGTGCAGGGG - Intergenic
1001570027 5:172724772-172724794 GTGTGTGTGTGTGTGTACAGAGG + Intergenic
1001631209 5:173176941-173176963 GCGTGTGTAAATGTGTAAAATGG + Intergenic
1002599921 5:180348267-180348289 GCGTGTGCACGTGTGTGCCTGGG + Intronic
1003435994 6:6088774-6088796 GTGTGTGTGTGTGTATACAAAGG - Intergenic
1003811040 6:9780949-9780971 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1004165219 6:13250994-13251016 GTGTGTGTGTGTGTGTAAAATGG - Intronic
1004281498 6:14283278-14283300 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1004573619 6:16871611-16871633 GTGTGTGTGTGTGTGTAGAAGGG + Intergenic
1004648588 6:17586709-17586731 GCGTGTGTATGTGTATATATGGG - Intergenic
1004784106 6:18946501-18946523 GTATGTGTATGTGTGTACACAGG - Intergenic
1005442144 6:25881700-25881722 GCGTGTGTGTGTGTGTGTAAGGG - Intronic
1005552834 6:26941297-26941319 GTGTGTGTGTGTGTGTACATGGG - Intergenic
1005586562 6:27282215-27282237 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1005952313 6:30641102-30641124 GTGTGTGTATGTGTGTATATGGG - Intronic
1006173139 6:32106980-32107002 GTGTGTGCACGTGTGTGCATGGG - Intronic
1007080759 6:39101902-39101924 GTGTGTGTGTGTGTGTTCAAGGG - Intergenic
1007418326 6:41705057-41705079 GAGTGTGTATGTGTGGACAGTGG - Intronic
1007430328 6:41772764-41772786 GTGTGTGTGTGTGTGTACACTGG + Intronic
1007624440 6:43235687-43235709 GTGTGTGTGTGTGTGTATAACGG + Intergenic
1007707316 6:43798806-43798828 GCGTGTGTGTGTGTGTGCAGGGG + Intergenic
1007809265 6:44474698-44474720 GTGTGTGTGTGTGTGTAAAAAGG + Intergenic
1008481381 6:51989488-51989510 GCACGTGTATGTGTGTAGAAAGG + Intronic
1011193203 6:84755032-84755054 GTGTGTGTGCGTGTGTAGAGAGG - Intronic
1011966736 6:93168007-93168029 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1012818763 6:104058249-104058271 GTGTGTGTATGTGTGTAGATGGG - Intergenic
1012872480 6:104688345-104688367 GTGTGTGTGTGTGTTTACAAAGG - Intergenic
1015209691 6:130683165-130683187 GTGTGTGTGTGTGTGTAGAAAGG - Intergenic
1015305094 6:131698115-131698137 GCGTGTGTATGTGTTTTGAAGGG + Intronic
1016125551 6:140398426-140398448 GTGTGTATGTGTGTGTACAATGG + Intergenic
1019135837 6:169907114-169907136 GCGTATGTGCATGTGTACACAGG - Intergenic
1019264736 7:108163-108185 GTGTGTGCACATGTGTACATGGG - Intergenic
1021438388 7:20648513-20648535 GTGTGTGTGCGTGTGTGTAAAGG - Intronic
1021946110 7:25729079-25729101 GTGTGTGTGTGTGTGTAAAAGGG + Intergenic
1021988788 7:26122702-26122724 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1022158255 7:27681929-27681951 GTGTGTGTGTGTGTGTAAAATGG + Intergenic
1022322771 7:29302954-29302976 ATGTGTATACGTGTGTATAATGG - Intronic
1023111980 7:36822855-36822877 GCATGTGTATGTGTGTTCATGGG + Intergenic
1023366588 7:39470578-39470600 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1023615514 7:42015724-42015746 GTGTGTGTGCGTGTGTAAACTGG - Intronic
1023795537 7:43789030-43789052 GTGTGTGTGTGTGTGTACAGGGG - Intronic
1023986022 7:45096541-45096563 GTGTGTGTATGTGTGTGCACTGG - Intergenic
1024006122 7:45225840-45225862 GAGTGTGTACAGGTGTTCAATGG + Intergenic
1024148786 7:46545380-46545402 GAGTGTGCACGTGTGTGCATTGG - Intergenic
1024557949 7:50619911-50619933 GTGTGTGTACGTGTCCACAGCGG - Intronic
1024846299 7:53646916-53646938 GTTTGTGTATGTGTTTACAAAGG + Intergenic
1026230024 7:68474745-68474767 GTGTGTGTGTGTGTGTACAGTGG + Intergenic
1026616308 7:71907944-71907966 GCGTGTGTGCGCGTGGACATGGG + Intronic
1026678487 7:72447814-72447836 GGGTGGGTATGTGTGTACATAGG - Intergenic
1026678500 7:72447901-72447923 GTGTGTGTATGTGTGTACATGGG - Intergenic
1026679569 7:72455349-72455371 GTGTGTGTGTGTGTGTACATAGG + Intergenic
1027963040 7:84970987-84971009 GTGTGTGTATGTGTGTTCATAGG - Intergenic
1030115214 7:106057660-106057682 GGGTGTGTGCGTGTGTGCACGGG - Intergenic
1030740655 7:113105410-113105432 GTGTGTGTGTGTGTGTATAATGG + Intergenic
1030930307 7:115515432-115515454 GCGTGTGTGTGTGTGTAAGAAGG - Intergenic
1031949804 7:127880723-127880745 GTGTGTGTGTGTGTGTATAATGG + Intronic
1031989179 7:128185747-128185769 GTGTGTGTGTGTGTGTACAGGGG - Intergenic
1032064636 7:128757377-128757399 GTGTGTGTGTGTGTGTACACAGG + Intronic
1032714900 7:134499629-134499651 GTGTGTGTGTGTGTGTACATAGG - Intergenic
1032807903 7:135375952-135375974 GTGTGTGTATGTGTGTACAGGGG + Intronic
1033790831 7:144790841-144790863 GTGTGTGTACGTGTGTTGAAGGG + Intronic
1033817611 7:145093894-145093916 GTGTGTGTATGTGTGCACACAGG + Intergenic
1035325587 7:158063903-158063925 ATGTGTGTAAGTGTGTAGAATGG - Intronic
1036063492 8:5352381-5352403 GTGTGTGTATGTATGTATAAAGG - Intergenic
1036473497 8:9072057-9072079 GTGTGTGTACGTGTGTGACAGGG - Intronic
1037080187 8:14775485-14775507 GTGTGTGTGTGTGTGTACACAGG + Intronic
1037172829 8:15913886-15913908 GTGTGTGCACGTGTGTCTAAAGG + Intergenic
1037209178 8:16364157-16364179 GTGTGTGTATGTGTGTAATATGG - Intronic
1037647606 8:20807287-20807309 GTGTGTGTGTGTGTGTACATGGG - Intergenic
1037768557 8:21786193-21786215 GGGTGTGTATGTGTGTGCATGGG - Intronic
1038380021 8:27084225-27084247 GTGTGTGTGCATGTGTGCAAGGG - Intergenic
1039420548 8:37434611-37434633 GCGTCTCTCTGTGTGTACAAAGG + Intergenic
1039778153 8:40757349-40757371 GTGTGTGTATGTGTGTACAGTGG - Intronic
1040021366 8:42744320-42744342 GTGTGTGTGTGTGTGTAGAATGG + Intergenic
1041580390 8:59452243-59452265 GCTTGTGTGTGTGTGTACATGGG - Intergenic
1041931430 8:63291697-63291719 TCGTGTGTGTGTGTGTACACAGG + Intergenic
1042178568 8:66061627-66061649 GTGTGTGTGCGCGTGTATAAGGG + Intronic
1042344274 8:67711680-67711702 GTGTGTGTGTGTGTGTACACAGG - Intronic
1043196062 8:77293062-77293084 GTGTGTGTGTGTGTGTACAATGG - Intergenic
1043421646 8:80104416-80104438 GTGTGTGTACGTGTGTATGTAGG - Intronic
1043805556 8:84668385-84668407 GTGTGTGTACGTATGTAACAGGG + Intronic
1043919322 8:85963148-85963170 GTGTGTGTGTGTGTGTACACTGG + Intergenic
1044341509 8:91051153-91051175 GTGTGTGTGTGTGTGTCCAAGGG - Intergenic
1044533603 8:93335658-93335680 GTGTGTGTGTGTGTGTACAGGGG + Intergenic
1046603749 8:116347603-116347625 GTGTGTGTGTGTGTGTACACAGG - Intergenic
1048865369 8:138757032-138757054 GTGTGTGCACGTGTGTGCAGGGG - Intronic
1049188448 8:141271842-141271864 GCGTGTGTGTGTGTGTACACAGG - Intronic
1050168636 9:2792437-2792459 GCGTGTGTGTGTGTATAAAAGGG - Intronic
1050305262 9:4299718-4299740 GTGTGTGTATGTGTGTAGCAGGG - Exonic
1050529695 9:6577692-6577714 GCGTGTGTGTGTGTGCACAGGGG - Intronic
1050787203 9:9419122-9419144 GTGTGTGTGTGTGTGTATAAGGG - Intronic
1051872579 9:21755785-21755807 GTGTGTGTATGTGTGTAAAGTGG - Intergenic
1052243175 9:26299817-26299839 GTGTGTGTGTGTGTATACAATGG - Intergenic
1052456151 9:28700619-28700641 GTGTGTATGCGTATGTACAAAGG + Intergenic
1052611326 9:30778131-30778153 GTGTGTGTATGTGTGTACAGAGG + Intergenic
1053263927 9:36696719-36696741 GTGTGTGTGTGTGTGTACAAAGG - Intergenic
1053366269 9:37524669-37524691 GTGAGTGTATCTGTGTACAATGG + Intronic
1053366494 9:37526073-37526095 GTGTGTGTATGTGTGTACATGGG + Intronic
1054761034 9:69004355-69004377 GTGTGTGTGTGTGTGTACAGAGG + Intronic
1055612133 9:78033401-78033423 GTGTGTGTATGTGTGTGAAACGG - Intergenic
1056331163 9:85522470-85522492 GCGTGTGTGTGTGTGTCCAGAGG - Intergenic
1056840311 9:89993358-89993380 ATGTGTGTAAGTGTGTATAAGGG + Intergenic
1057017673 9:91666937-91666959 GTGTGTGTGTGTGTGTACATAGG + Intronic
1057356305 9:94334460-94334482 GAGTGTGTGTGTGTGTTCAAGGG + Intergenic
1057414240 9:94847121-94847143 GTGTGTGTGTGTGTGTACAAAGG - Intronic
1057435122 9:95032897-95032919 GCATGTATAGGTGTGTATAATGG + Intronic
1057651445 9:96923168-96923190 GAGTGTGTGTGTGTGTTCAAGGG - Intronic
1059428486 9:114236088-114236110 GTGTGTGTGTGTGTGTACAGAGG - Intronic
1059483516 9:114610517-114610539 GCGTGTGTGCGTTTACACAAAGG - Intergenic
1059502780 9:114769420-114769442 GTGTGTGTCTGTGTGCACAAAGG + Intergenic
1059909151 9:119023148-119023170 GTGTGTGTGTGTGTGTACATAGG - Intergenic
1059942062 9:119368699-119368721 GTGTGTGTCCGTGTGTGTAAGGG - Intronic
1060652633 9:125342395-125342417 GAGTGTGTCTGTGTGTACAGTGG + Intronic
1060781104 9:126413838-126413860 GTGTGTGTGTGTGTGTATAAGGG + Intronic
1061005184 9:127924867-127924889 GCGTGTGTGTGTGTGTAGAGGGG - Intronic
1062187522 9:135226540-135226562 GTGTGTGAATGTGTGTGCAATGG - Intergenic
1062197981 9:135285156-135285178 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198083 9:135285717-135285739 GCGTGTGCACGTGTGTGCCTGGG - Intergenic
1062198194 9:135286340-135286362 GCGTGTGTACGTGTGTGCCTGGG - Intergenic
1062221705 9:135419541-135419563 GCGTGTGCACGTGTGCTCACTGG - Intergenic
1062267023 9:135691305-135691327 TCGTGTGTACGTGTGTGCACTGG - Intergenic
1185889291 X:3810080-3810102 GTGTGTGTGTGTGTGTAAAATGG - Intergenic
1185908283 X:3958317-3958339 GTGTGTGTATGTGTGTGTAAGGG + Intergenic
1185937296 X:4273147-4273169 GTGTGTGTGTGTGTGTAAAAAGG - Intergenic
1186057058 X:5661094-5661116 GTGTGTGTATGTGTGTAAGAGGG + Intergenic
1186812341 X:13202575-13202597 GCGTGTGTGTGTGTTTACAAAGG + Intergenic
1187082676 X:16007567-16007589 GTGTGTGTGTGTGTGTGCAAGGG + Intergenic
1188432969 X:30127494-30127516 GTGTGTGTGTGTGTGTATAAAGG - Intergenic
1188923243 X:36005671-36005693 GTGTGTGCACATGTGTGCAATGG + Intergenic
1191783279 X:64891608-64891630 GTGTGTGTATGTGTGCACACGGG - Intergenic
1192284411 X:69719709-69719731 GTGTGTGTGTGTGTGTATAACGG - Intronic
1192542949 X:71990519-71990541 GGGTGTGTGTGTGTGTAGAAGGG - Intergenic
1192899017 X:75474567-75474589 GTGTGTGTGTGTGTGTATAAAGG - Intronic
1193402468 X:81062313-81062335 GTGTGTGTATGTGTGTGTAATGG + Intergenic
1193488530 X:82117914-82117936 GTGTGTGTGTGTGTGTATAATGG - Intergenic
1193850337 X:86529936-86529958 GTGTGTGTGTGTATGTACAATGG - Intronic
1194923728 X:99797681-99797703 GAGTGTGTATGTGTGTGCATAGG - Intergenic
1195770244 X:108343194-108343216 GTGTGTGTGTGTATGTACAAAGG + Intronic
1195848050 X:109249445-109249467 GTGTGTGTGTGTGTGTAAAAAGG + Intergenic
1196615730 X:117765103-117765125 GTGTGTGTGTGTGTGTATAAGGG - Intergenic
1197357831 X:125458408-125458430 GCGTGTGTGTGTGTGTGTAATGG - Intergenic
1197436784 X:126438521-126438543 GTGTGTGCATGTGTGTAAAATGG - Intergenic
1198428751 X:136545314-136545336 GAGTGTGTACATGTTTGCAACGG + Intronic
1198676009 X:139131407-139131429 GTGTGTGTGTGTGTGTGCAAAGG + Intronic
1198986400 X:142459096-142459118 GCGTGTGTGTGTGTGTATAGAGG - Intergenic
1199199996 X:145075944-145075966 GCCTGTGTGCGTGTGTATTAAGG - Intergenic
1202040889 Y:20682313-20682335 GCTTGTTTAAGTGTGTACACAGG + Intergenic