ID: 1081998306

View in Genome Browser
Species Human (GRCh38)
Location 11:47378265-47378287
Sequence CCAGCCCAACCCGTGGCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 3, 3: 27, 4: 286}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081998306_1081998319 11 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1081998306_1081998314 3 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998314 11:47378291-47378313 AGGAGTCCCGGTACTCACAGGGG 0: 1
1: 0
2: 1
3: 8
4: 85
1081998306_1081998312 1 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998312 11:47378289-47378311 GGAGGAGTCCCGGTACTCACAGG 0: 1
1: 0
2: 1
3: 17
4: 164
1081998306_1081998311 -9 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998311 11:47378279-47378301 TTGGGCTGGTGGAGGAGTCCCGG 0: 1
1: 0
2: 3
3: 43
4: 473
1081998306_1081998320 12 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998320 11:47378300-47378322 GGTACTCACAGGGGGGACGAGGG 0: 1
1: 0
2: 1
3: 4
4: 80
1081998306_1081998313 2 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 61
1081998306_1081998321 13 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998321 11:47378301-47378323 GTACTCACAGGGGGGACGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1081998306_1081998316 5 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998316 11:47378293-47378315 GAGTCCCGGTACTCACAGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 65
1081998306_1081998315 4 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998315 11:47378292-47378314 GGAGTCCCGGTACTCACAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081998306 Original CRISPR CCAGCCCAACCCGTGGCCCT CGG (reversed) Intronic
900013633 1:135299-135321 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
900043703 1:491282-491304 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
900065141 1:726285-726307 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
900427963 1:2589069-2589091 CCAGCCCACGCCCTGCCCCTAGG + Intronic
900643932 1:3700222-3700244 TCAGCCAAAACCGTGGCCTTTGG + Intronic
900969754 1:5984890-5984912 CCAGCTAAAGCCGTCGCCCTGGG + Intronic
901022135 1:6260914-6260936 CCAGCCACCCCCGCGGCCCTCGG - Exonic
901101000 1:6718789-6718811 CTTGTCCAACCCGTGGCCCGTGG + Intergenic
901812883 1:11777822-11777844 CCAGCCCATCCTCTGGCCTTTGG + Intronic
902469389 1:16638091-16638113 CTAGTCCAACCCTTGCCCCTAGG + Intergenic
903349591 1:22710176-22710198 CCAGCCCCACCCCAGGCCCTCGG + Intergenic
903968031 1:27101927-27101949 CCTGCCCTGCCCGTGCCCCTCGG - Intronic
904031610 1:27536809-27536831 CCAGCCTGCCCCGGGGCCCTTGG - Intronic
906614512 1:47225405-47225427 CCCGCCCAGCCCCTGGCCCCTGG + Intronic
907441424 1:54480843-54480865 CTTGTCCAACCCGTGGCCCATGG + Intergenic
912472186 1:109913384-109913406 TCATCCCTACCCCTGGCCCTAGG - Intronic
914462690 1:147899240-147899262 ACAAACCAACCCATGGCCCTGGG + Intergenic
915358807 1:155273306-155273328 CCCCCCCAACCCGGGACCCTGGG + Intronic
917352218 1:174090083-174090105 CCAGTCCAGCCTGTGGGCCTTGG - Intergenic
918040840 1:180913030-180913052 CCAGACCCACCCGGGGCCCGGGG + Intergenic
920039090 1:203084497-203084519 CCAGCCCACCCTTTGGGCCTTGG + Intronic
920310572 1:205045885-205045907 CCAGCCCAACCTTTGCCTCTAGG - Intronic
922100048 1:222472294-222472316 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
922100252 1:222473122-222473144 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
922734994 1:227973954-227973976 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
924343244 1:243053959-243053981 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
1062769271 10:86552-86574 CCAGCCCATCCCCTGTCCCTGGG + Intergenic
1063448387 10:6134638-6134660 CCAGGCCAACCGTGGGCCCTTGG + Intergenic
1064959521 10:20948073-20948095 CTTGTCCAACCCATGGCCCTTGG - Intronic
1066733249 10:38451638-38451660 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
1067522132 10:47015947-47015969 CCAGCCCATCCCCTTGTCCTTGG - Intergenic
1067881121 10:50046125-50046147 CTTGTCCAACCCGTGGCCCATGG + Intergenic
1068811118 10:61257091-61257113 CCAGTCCAGCCTGTGGGCCTCGG - Intergenic
1069340566 10:67403624-67403646 CCAGTCCAACCTGTGGGCCTTGG + Intronic
1069759298 10:70797796-70797818 CCAGTCCAGCCTGTGGGCCTTGG - Intergenic
1069910597 10:71756733-71756755 CCAGCCCATCTTTTGGCCCTGGG - Intronic
1070651490 10:78240136-78240158 CCACCCCTACCCCTAGCCCTGGG - Intergenic
1070771426 10:79084771-79084793 CCAGCCCAGCCGCTGACCCTAGG - Intronic
1071972259 10:90920209-90920231 CTAGCCCACCCTGTGACCCTGGG - Exonic
1072176782 10:92932279-92932301 CCTGCCGAACCCATAGCCCTTGG - Intronic
1072921723 10:99582460-99582482 GCAGGTCAACCAGTGGCCCTCGG - Intergenic
1073309721 10:102531741-102531763 CCAGGCCAACCACTAGCCCTGGG - Intronic
1075077159 10:119359184-119359206 CCAGCCCCACCCCTGGCCTCTGG - Intronic
1075469669 10:122678559-122678581 GGAGCCCAGCCCATGGCCCTAGG - Intergenic
1076844091 10:133060572-133060594 CCTGCCCAGCCCTCGGCCCTCGG - Intergenic
1076864546 10:133160421-133160443 CCAGCCCAGCCGGAGGCCCCGGG + Intergenic
1076969977 11:127513-127535 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
1077096915 11:802922-802944 CCAGCCCAGCCCACGGCGCTGGG + Intronic
1077103586 11:832677-832699 CCAGCCTAGCCAGAGGCCCTGGG - Intergenic
1077218937 11:1406759-1406781 CCAGCCCCACCACAGGCCCTGGG - Intronic
1077330178 11:1980722-1980744 CCACCCCTCCCCGTGGACCTAGG + Intronic
1077431993 11:2520338-2520360 CCAGCCCAGCGTGGGGCCCTCGG + Intronic
1077464923 11:2729181-2729203 CCAGACCAGCCCTTGCCCCTAGG - Intronic
1078726986 11:13940491-13940513 CCTGCCCCACCCGCTGCCCTGGG - Intergenic
1079107085 11:17578575-17578597 CCACTCCACCCTGTGGCCCTTGG - Intronic
1081526888 11:43933728-43933750 CAAGCCCAGCCTGTGGACCTGGG - Intronic
1081604848 11:44520635-44520657 CCGGCCCCACCCTTGGCTCTTGG + Intergenic
1081998306 11:47378265-47378287 CCAGCCCAACCCGTGGCCCTCGG - Intronic
1083324452 11:61866309-61866331 CCAGCCCAAACCTTGGGCCCTGG + Exonic
1084005000 11:66317880-66317902 CCAGCTCAGCCTGGGGCCCTGGG + Intergenic
1084150102 11:67284112-67284134 CCATCCCTACCCAGGGCCCTGGG + Intronic
1084304443 11:68272244-68272266 CCAGCCCAACCCGCGCACCCCGG - Intergenic
1084618364 11:70251612-70251634 CCCCCCCACCACGTGGCCCTGGG + Intergenic
1084682848 11:70677159-70677181 CCAGACCAGACCGTGGGCCTTGG - Intronic
1085280139 11:75324874-75324896 CCACCCCCACCCCTGTCCCTGGG + Intronic
1085450408 11:76628812-76628834 CCAGCCCAACCCTCAGCCCAGGG - Intergenic
1085524847 11:77158152-77158174 CCAGGCCAGCCCGGGGCCCCAGG - Intronic
1090413312 11:126523664-126523686 CCAGCCCCTCTCCTGGCCCTGGG - Intronic
1090803728 11:130189903-130189925 CCACGCCCACCCCTGGCCCTCGG - Intronic
1091360396 11:134974748-134974770 CCAGCCAAGCCGGTGGCCCTGGG - Intergenic
1202813155 11_KI270721v1_random:35901-35923 CCACCCCTCCCCGTGGACCTAGG + Intergenic
1094218336 12:27969354-27969376 CCTCCCCAACCCGGCGCCCTGGG + Intronic
1095366938 12:41418783-41418805 CCAGCCAAACCCTTTTCCCTTGG - Intronic
1096187206 12:49588992-49589014 CCAGCCCCAGCCCTGGCACTGGG + Intronic
1100309918 12:93384660-93384682 CCTGCTCAACCTGTGGCCCGTGG - Intronic
1101158535 12:101950880-101950902 CCTGTCCAACCCGCGGCCCATGG - Intronic
1101425886 12:104588248-104588270 CCATCCCCACCCCTGGCCTTAGG + Intronic
1102314046 12:111871846-111871868 CCAACTTAACCCCTGGCCCTAGG + Intronic
1103562681 12:121800521-121800543 CCCGCCGACCCCGTGGCCCTCGG + Intronic
1104178507 12:126355706-126355728 CTAGCCCAAGCCTTGGCCCAGGG - Intergenic
1104938383 12:132379725-132379747 CGAGAGCCACCCGTGGCCCTGGG + Intergenic
1104952922 12:132450546-132450568 CCAGGCCCACCCGGGGCCCCAGG - Intergenic
1105358625 13:19685215-19685237 CCAGCCCAACCTTTGGCCCTTGG + Intronic
1106007077 13:25780901-25780923 CCAGTCCAGTCCGTGGCCCAGGG + Intronic
1108222352 13:48248798-48248820 CTTGTCCAACCCGTGGCCCATGG - Intronic
1109361509 13:61299719-61299741 CCAGTCCAGCCTGTGGGCCTTGG + Intergenic
1109416379 13:62046485-62046507 GCAGCTCAGCCTGTGGCCCTGGG - Intergenic
1114549644 14:23525518-23525540 CCACCCCCACCTGAGGCCCTCGG - Exonic
1122005108 14:98697014-98697036 CCACCCCCACCTGTGGCCCCAGG - Intergenic
1122296578 14:100709388-100709410 CCAGCCCAACCCTCCTCCCTGGG + Intergenic
1122981170 14:105192955-105192977 CCAGCCCAGCCCCTGCCCCCAGG - Intergenic
1124972019 15:34496784-34496806 CCAGCCCCAGCCCTGGGCCTGGG + Intergenic
1124996081 15:34724014-34724036 TCAGCCCTTCCCTTGGCCCTTGG + Intergenic
1128606684 15:69041759-69041781 CTTGTCCAACCTGTGGCCCTTGG + Intronic
1128745543 15:70111703-70111725 CCAGCCCACCCCCAGCCCCTGGG - Intergenic
1130521205 15:84661903-84661925 CCTGTCCAACCCGCGGCCCTCGG - Intergenic
1132458383 16:36796-36818 CCAGCCCATGCCCTGTCCCTGGG + Intergenic
1132550630 16:552559-552581 GCAGCCCTCCCCGTGGGCCTGGG - Intronic
1132647156 16:1004375-1004397 CCAGCCCCACTCCTGGGCCTGGG + Intergenic
1132765077 16:1530477-1530499 CCAGCCCCACACCTGGGCCTCGG - Intronic
1133010172 16:2906041-2906063 ACCGCCCAGCCCGTGGCCATTGG - Intergenic
1134054433 16:11160598-11160620 CCAGCCCGTCCCTTGTCCCTAGG + Intronic
1134119631 16:11574650-11574672 CCTGCCCAGCACCTGGCCCTGGG + Intronic
1136458293 16:30394958-30394980 CCACCCCCACCCCGGGCCCTCGG + Intronic
1136991182 16:35152251-35152273 GCAGCCAAAGCTGTGGCCCTGGG - Intergenic
1137731497 16:50693675-50693697 CCAGCCCACCCCCAGGCGCTGGG - Intronic
1139290005 16:65849458-65849480 CCAGCCCAACCCCTTGCTCCTGG - Intergenic
1140474086 16:75229932-75229954 CCAGCCCAACCCCTGGCCCCGGG - Exonic
1142450702 16:90171619-90171641 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
1142456863 17:62072-62094 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
1142959745 17:3545131-3545153 CCAGCCCAACCCCTTGCCCTGGG - Intronic
1144096077 17:11901844-11901866 CTTGTCCAACCCATGGCCCTTGG - Intronic
1144810934 17:17998345-17998367 CCAGCCCAAGCAGGGGCCATTGG + Intronic
1146906611 17:36622140-36622162 CCAGCCCAGCCTCTGGCCCCTGG - Intergenic
1147048531 17:37772947-37772969 CCTGTCCAACCCATGGCCCATGG - Intergenic
1147120476 17:38332535-38332557 CCAGCCCCACAGCTGGCCCTAGG + Intronic
1147360613 17:39927436-39927458 CCCGCCCCTCCCGTAGCCCTGGG + Intronic
1147603869 17:41762988-41763010 CCAGCCCAACCAGTGGCCACTGG - Exonic
1148125461 17:45234267-45234289 CCAGCCCACCCCGGGCCCTTGGG + Intronic
1150286784 17:63959230-63959252 CCATCCCAGCCCCTGGCCCTGGG + Intronic
1151467875 17:74299460-74299482 CCTACCCAACACTTGGCCCTGGG - Intronic
1151563045 17:74881039-74881061 CCACCCCAACCTGGGGCGCTGGG - Intronic
1152294738 17:79460088-79460110 CCATCCCCTCCCGTAGCCCTTGG - Intronic
1152391375 17:80005891-80005913 CCACCCCACCCCGGGGGCCTAGG - Intronic
1152561711 17:81081941-81081963 CCAGCCCCAGCCCTGGCCCAGGG - Intronic
1152962341 18:87353-87375 CCAGCCCATCCCCTGTCCCTGGG + Intergenic
1154080333 18:11250041-11250063 CCAGCCCCACCAATTGCCCTCGG - Intergenic
1155877104 18:31101611-31101633 CCAGCCAAAATCGTGGCCCCTGG - Intronic
1158643801 18:59225644-59225666 CCACCTCAACCCAAGGCCCTGGG + Exonic
1160646776 19:197431-197453 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
1160824617 19:1073900-1073922 CCAGCCCCATGCGGGGCCCTGGG - Intronic
1161086320 19:2337245-2337267 GCAGCCCAGCCCGTCGCCCAGGG + Intronic
1161408355 19:4102756-4102778 CCAGCCCAAGCCGCGGCCGGGGG + Intronic
1162549024 19:11348252-11348274 CCAGCCCAAACCTTGGGGCTGGG + Intronic
1163326618 19:16607657-16607679 CTTGTCCAACCCATGGCCCTCGG + Intronic
1163460697 19:17435822-17435844 CCAGCCGTGCCCCTGGCCCTGGG + Exonic
1165355130 19:35299767-35299789 GCAGCCCAGCCTGTGGCCGTTGG - Exonic
1165385178 19:35506168-35506190 CCAGCTCGACCCTTGCCCCTGGG + Intronic
1166255201 19:41599372-41599394 CCGCCCCCACCCCTGGCCCTGGG + Intronic
1166412048 19:42561851-42561873 CCACCCCCACCCATGACCCTGGG - Intergenic
1166777805 19:45323235-45323257 CCAGCCCTTCCTGTGGCCCTCGG + Intergenic
1167035812 19:46994416-46994438 CCAGCCCAGCCCGTGCACCCTGG - Intronic
1167045223 19:47045600-47045622 CCTGCCCTACCCGGGGCCCGCGG + Exonic
1168672432 19:58250787-58250809 CCAGCCCAATCTTTGGCCTTGGG - Intronic
925032770 2:663663-663685 CCAGCCCAACCTGAGGTCATCGG + Intergenic
926316840 2:11716099-11716121 CCAGCCCAGACCTTGTCCCTTGG - Intronic
929258348 2:39838629-39838651 TCAGCCCAACCTCAGGCCCTTGG + Intergenic
929561473 2:42959109-42959131 GCATCCCAACCCGTGGACTTGGG + Intergenic
929974227 2:46616663-46616685 CCACCCCAACCCGGGTCCCTCGG + Intronic
930892942 2:56412295-56412317 CCAGCCCACCCCTTAGTCCTTGG + Intergenic
931572769 2:63687168-63687190 CTTGTCCAACCCATGGCCCTTGG - Intronic
934655606 2:96115509-96115531 CCAGGCCCCCCCTTGGCCCTGGG + Exonic
935371377 2:102350611-102350633 CCATTCCATCCAGTGGCCCTGGG + Intronic
937329354 2:121016158-121016180 CCAGCCCAGCCCCAGGCCCGCGG - Intergenic
937871318 2:126788236-126788258 CCAGCCCACCCTGCTGCCCTTGG + Intergenic
937976262 2:127583749-127583771 GCAGCCCTACCCGTGAGCCTTGG - Intronic
937994024 2:127679687-127679709 CCAGCCCCTCTCTTGGCCCTGGG - Intronic
938099581 2:128489692-128489714 CCAGCCCCACCCTCGGCCCCAGG + Intergenic
945426842 2:209716430-209716452 CTTGTCCAACCCATGGCCCTTGG + Intronic
947448428 2:230182645-230182667 CCACCCCTACCCGTGTCTCTAGG - Intronic
948257822 2:236580780-236580802 GCAGCACAACCAGTGGCCCATGG + Exonic
948824930 2:240569411-240569433 CCAGCCCAACCCTTGGTGCCAGG - Intronic
948981749 2:241498176-241498198 CCAGCCCATCCCACGGCCCCAGG + Intronic
1168886915 20:1266464-1266486 CCACCCCACCCCCTGGCACTCGG - Intronic
1173162775 20:40664505-40664527 CCAGCCCAGCAAGGGGCCCTGGG + Intergenic
1173817755 20:46000683-46000705 CCAGCCCAGCCTGCAGCCCTGGG + Intergenic
1175175588 20:57109872-57109894 CCAGCCCAGGGCCTGGCCCTTGG - Intergenic
1175223760 20:57433111-57433133 CCAGCTCAAGGCGAGGCCCTGGG - Intergenic
1175390575 20:58624866-58624888 GCAGCCCGAGCCGAGGCCCTGGG + Intergenic
1175406211 20:58731194-58731216 CCTGTCCAACCCGTGGCCTGTGG - Intergenic
1176028775 20:63000160-63000182 CCTGCCCCACCCGGGGCCCCTGG - Intergenic
1176131115 20:63497269-63497291 CCAGCCCCAGCCTTGGCCCTGGG + Intronic
1176278727 20:64288795-64288817 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
1178455312 21:32744382-32744404 CTTGTCCAACCCGTGGCCCATGG - Intronic
1182063228 22:27412729-27412751 CCAACCCAGCCCATGGCCCTTGG - Intergenic
1183522490 22:38303475-38303497 TCGCCCCAACCTGTGGCCCTGGG - Intronic
1184469155 22:44685768-44685790 CCAGCCCCACCCTTGGTGCTTGG - Intronic
1184773737 22:46612949-46612971 CCTGCCCCACCCGTGGACTTTGG + Intronic
1184894568 22:47399591-47399613 GCAGCCCCGCCCGAGGCCCTGGG - Intergenic
1185339331 22:50284514-50284536 CCCACCCCACCCGGGGCCCTGGG + Intronic
950652126 3:14413696-14413718 CCAGCCCCACCCCCGGCCCCAGG - Intronic
950667012 3:14503748-14503770 CGAGCCCAACGCTGGGCCCTGGG - Intronic
950669112 3:14514540-14514562 CCTGCCCATCCCGGGGCCCTAGG + Intronic
951218235 3:20043633-20043655 GCACCCCAGCCGGTGGCCCTAGG - Intronic
951714509 3:25625456-25625478 CTTGTCCAACCCGTGGCCCGTGG + Intronic
952334359 3:32391981-32392003 CCAGCCCAGCGCGAGCCCCTTGG + Exonic
952583480 3:34863608-34863630 CCAGCCCAACCCTGGGCCCATGG - Intergenic
953313088 3:41899504-41899526 CCTGTCCAACCCGTAGCCCATGG + Intronic
953546111 3:43864645-43864667 CCATCCCAGCCTGTGGCTCTGGG + Intergenic
953901211 3:46845292-46845314 CCAGCCCTGCCCAGGGCCCTGGG - Intergenic
954300047 3:49696121-49696143 CTAGTCCAACCCTTGCCCCTAGG - Intronic
954333657 3:49903895-49903917 CCCGCCCAGCCCGGCGCCCTCGG - Intronic
954361953 3:50126769-50126791 CCAGCCCAAACCTTTGTCCTGGG + Intergenic
954617022 3:51974341-51974363 CCAGGCCAACAAGTTGCCCTGGG - Intronic
954697798 3:52436833-52436855 CCAGCCCAACAGCTGGCCCAAGG + Intronic
955704101 3:61710511-61710533 CTTGTCCAACCCGTGGCCCAGGG + Intronic
959992833 3:112647657-112647679 CTTGCCCAACCCGTGGCCCATGG + Intronic
961431103 3:126883717-126883739 CCAGCACAACCCGTGTGCCATGG + Intronic
961651304 3:128417970-128417992 CCAGCCCACCCTATGGCCCCAGG + Intergenic
962677974 3:137770381-137770403 CTAGCCCAGCCCCTGGCCCTGGG + Intergenic
962819245 3:139032073-139032095 CTTGTCCAACCCTTGGCCCTTGG + Intronic
967141039 3:186560660-186560682 ACAGCCCTACCCATGGCCATGGG + Intronic
967166356 3:186783361-186783383 CCAACCCAACCCCGGGCCCTAGG + Intronic
967533102 3:190571739-190571761 CTTGTCCAACCCGTGGCCCGCGG + Intronic
968370905 3:198222091-198222113 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
968500826 4:949095-949117 CAAGCCCACCCCATGGGCCTCGG - Intronic
969496078 4:7527078-7527100 CCAGCCCTCTCTGTGGCCCTGGG + Intronic
969716587 4:8871053-8871075 CCAGCCCAACCAGGGGCTCCTGG + Intronic
970842307 4:20488882-20488904 ACAGACCAACCCGAGGCCTTTGG - Exonic
979692613 4:123575838-123575860 CCAGCCCAGCCTGGGGACCTAGG + Intergenic
981751597 4:148097636-148097658 CCTGTCCAACCCATGGCCCACGG + Intronic
985281020 4:188285380-188285402 CCTGTCCAACCCATGGCCCGTGG + Intergenic
985732273 5:1556073-1556095 CCAACCCCAGCCGAGGCCCTAGG + Intergenic
986064542 5:4222906-4222928 CCAGCCTAACTCCTGCCCCTTGG + Intergenic
986161364 5:5232420-5232442 CCAGTCCGACCAGTGGCCATGGG - Exonic
988798040 5:34670269-34670291 CAAGCCCAACACGTGACACTGGG - Intronic
991273375 5:64813967-64813989 CTTGTCCAACCCGTGGCCCATGG + Intronic
991351144 5:65721971-65721993 CCCGCCCGACCCCTGGTCCTCGG + Exonic
991605367 5:68395675-68395697 CCAGCCCTGGCCTTGGCCCTGGG + Intergenic
995022366 5:107381026-107381048 CCACCCCCAGCCCTGGCCCTTGG - Exonic
998158035 5:139797058-139797080 CAAACCCAACCCGTGGCCCAGGG + Intronic
998405916 5:141874657-141874679 CCAGCCCACCCCGGGGACCAAGG + Intronic
998931853 5:147189942-147189964 CTGGTCCAACCCGTGGCCCATGG - Intergenic
999096073 5:148979220-148979242 CCTGCCCAACCCATGGCTCCAGG + Intronic
999198362 5:149798592-149798614 TCAGGCCACCCCATGGCCCTAGG - Intronic
999305660 5:150517941-150517963 CCAGCCCCACCCCTTGGCCTAGG - Intronic
999321611 5:150618723-150618745 CCAGCCCCAGCCCTGGCCCTGGG + Exonic
1001982687 5:176047431-176047453 CCAGCACAACGCCTGGCCCCAGG - Intergenic
1002234776 5:177796626-177796648 CCAGCACAACGCCTGGCCCCAGG + Intergenic
1002316562 5:178348046-178348068 CCAGCCCCAGCAGTGCCCCTCGG + Intronic
1002460785 5:179372563-179372585 CCAGCCCTTCCCGAGGCTCTGGG + Intergenic
1002730140 5:181327647-181327669 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
1002754392 6:146452-146474 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
1003900638 6:10652097-10652119 CCTGTCCAACCCGTGGCCCATGG - Intergenic
1004609186 6:17222879-17222901 CTTGTCCAACCCGTGGCCCATGG - Intergenic
1004682000 6:17905019-17905041 CTTGCCCAACCCGTGGCCTACGG + Intronic
1005039527 6:21588491-21588513 CTACCCCATCCCCTGGCCCTTGG - Intergenic
1006338336 6:33432298-33432320 CCAGCCCCAACTGGGGCCCTAGG + Intronic
1006797641 6:36741733-36741755 CCAGCGCATCCAGTGTCCCTGGG + Exonic
1008501788 6:52190763-52190785 CCAGCCCACCCAGAGGCCCATGG + Intergenic
1009909212 6:69904846-69904868 CCAGCACAAGCCGTGTGCCTAGG - Intronic
1012869457 6:104656619-104656641 CCAGTCCAACCTGTGGGCCTTGG + Intergenic
1013631631 6:111991614-111991636 CCAGCCCATCCCGTGGGACACGG - Intergenic
1014098303 6:117482974-117482996 CCGGCCCGCCCCGTAGCCCTCGG - Intronic
1017858327 6:158371306-158371328 CCAGCCCAGCCAGTGTCACTAGG - Intronic
1018051031 6:160008160-160008182 CTTGTCCAACCCGTGGCCCATGG - Intronic
1018686314 6:166307455-166307477 CCAGCTCAGCCCGCGGCCCGGGG - Exonic
1018722038 6:166580558-166580580 CTTGTCCAACCCGTGGCCCAGGG - Intronic
1019417599 7:934560-934582 CCAGCCCCACTCGTGGGACTTGG - Intronic
1019964895 7:4490734-4490756 CCAGGCAAAGCCGTGGCCCAGGG - Intergenic
1020001939 7:4761183-4761205 CCCGCCACACCCGTGACCCTCGG + Exonic
1020032799 7:4944596-4944618 CCAGCCCGGCCAGTGGCCATGGG + Intronic
1020139873 7:5606365-5606387 CCAGCCCCAGCCCTGGGCCTGGG + Exonic
1023401311 7:39794203-39794225 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
1023819635 7:43973351-43973373 CCAGGCCACCCCCAGGCCCTGGG + Intergenic
1023873237 7:44273863-44273885 CCAACCCAGCCCGAGGCCCAAGG + Intronic
1024648300 7:51386476-51386498 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
1024648831 7:51388549-51388571 CCAGCCCAGCTCATGGCTCTCGG - Intergenic
1025177498 7:56809517-56809539 CCAGCCCAGCTCGTGGCTGTAGG - Intergenic
1025694265 7:63766736-63766758 CCAGCCCAGCTCGTGGCTGTAGG + Intergenic
1025694294 7:63766871-63766893 CCAGCCCAGCTCGTGGCTGTAGG + Intergenic
1027124264 7:75544869-75544891 CCAGACCACCCCATCGCCCTTGG + Intronic
1028136477 7:87228216-87228238 CTTGTCCAACCCGTGGCCCATGG - Intergenic
1029747098 7:102522061-102522083 CAAGCCCAGCCTGTGGACCTTGG - Intergenic
1029765051 7:102621150-102621172 CAAGCCCAGCCTGTGGACCTTGG - Intronic
1030176486 7:106660391-106660413 CCGGCCAAGCCCGTGGCCCCCGG - Exonic
1030438253 7:109552480-109552502 CCAGCCCAGCCTGTGGGCCTTGG + Intergenic
1034285541 7:149881116-149881138 CCAGCCCAGCCTGTAGCCCAGGG + Intergenic
1034425004 7:151009630-151009652 CCAGCCCCACCCCCGGCCCCAGG + Intronic
1035390701 7:158502519-158502541 CCAGCCCCACCCCTGCTCCTCGG + Intronic
1035490723 7:159274795-159274817 CCTGTCCAACCCATGGCCCCGGG - Intergenic
1035522243 8:284229-284251 CCAGACCGACCCCTGGGCCTGGG - Intergenic
1037855343 8:22367424-22367446 GCTGCCCATCCCGCGGCCCTTGG - Intronic
1042734967 8:71977995-71978017 CCACCCCACCCCTTGGCTCTGGG + Intronic
1044159530 8:88896028-88896050 CCAGCCCAACAAGTAGCCATTGG - Intergenic
1045459071 8:102411705-102411727 CCAGCCCACCCCGGGGCCCCTGG + Intronic
1046476411 8:114750237-114750259 CTGGCCCAACCCGTAGCCCAGGG - Intergenic
1046519414 8:115305040-115305062 CCAGCCCAGCATGTGCCCCTGGG - Intergenic
1047654021 8:126955843-126955865 CTTGTCCAACCCATGGCCCTTGG + Intergenic
1049090825 8:140512108-140512130 CCGGCCCTACCCGTGGGCGTCGG + Intronic
1049291760 8:141807005-141807027 ACAGGGCAACCCGTGCCCCTGGG - Intergenic
1049419271 8:142509873-142509895 CCAGCCCCACCCAAGGTCCTGGG - Intronic
1049592697 8:143469761-143469783 CCTGCCCACCCCGTGATCCTGGG - Intronic
1051198722 9:14593733-14593755 CCAGCCCAACCTCTGCCACTGGG + Intergenic
1051748560 9:20318330-20318352 CCAGCCCACCATGTGCCCCTTGG + Intergenic
1052784219 9:32813784-32813806 ACAGCCAAACCTGTGGCCCAAGG + Intergenic
1053164752 9:35836525-35836547 CCAGCCCAGGCCTAGGCCCTAGG - Intronic
1056729576 9:89154069-89154091 CTAGTCCAACCCTTGGCCATGGG + Intronic
1058194024 9:101952309-101952331 CAAGCCCAACCAGTGCCACTAGG + Intergenic
1058844828 9:108946413-108946435 CCAGCCCTACCCCTGCACCTCGG + Intronic
1059332237 9:113542884-113542906 CCAGCCCAGTCCCTGGCCCTCGG - Intronic
1059519358 9:114925383-114925405 CCAGCCCATCCCGTGGAACATGG - Intronic
1060216978 9:121744250-121744272 CCACCCCACCCAGTGGGCCTGGG - Intronic
1061322475 9:129839832-129839854 CCAGCACAGCCTGTGGTCCTAGG - Intronic
1061403773 9:130382675-130382697 CCAGCCCCACCTGTGATCCTGGG + Intronic
1061801503 9:133115567-133115589 TCTGCCCAGCCCCTGGCCCTCGG + Intronic
1061963702 9:134001402-134001424 TCTGCCCCACCCGTGGCCATAGG + Intergenic
1062179921 9:135185786-135185808 CCAGCCTTACCAGTGGCCTTAGG - Intergenic
1062247233 9:135575408-135575430 CCTCCCCAAACCCTGGCCCTGGG - Intergenic
1062735800 9:138136764-138136786 CCAGCCCATCCCCTGTCCCTGGG - Intergenic
1062754554 9:138280161-138280183 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
1203792185 EBV:157606-157628 CCAGCCCCATCCGCGGCCCGCGG - Intergenic
1203578457 Un_KI270745v1:24321-24343 CCAGCCCAGCTCATGGCTCTTGG + Intergenic
1186344197 X:8674689-8674711 CGTGTCCAACCCATGGCCCTTGG - Intronic
1186593282 X:10953512-10953534 CCAGTCCAGCCTGTGGGCCTTGG + Intergenic
1188716864 X:33469379-33469401 CTTGCCCAACCCTTGGCCCAGGG + Intergenic
1189124013 X:38426264-38426286 CTTGTCCAACCCGTGGCCCATGG - Intronic
1189173066 X:38927703-38927725 CCACTCCAATCCCTGGCCCTAGG + Intergenic
1193815198 X:86096553-86096575 CTTGTCCAACCCATGGCCCTTGG - Intergenic
1194537114 X:95119232-95119254 CCTGTCCAACCTGTGGGCCTTGG - Intergenic
1194649655 X:96499777-96499799 CTTGTCCAACCCGTGGCCCATGG - Intergenic
1195107824 X:101617458-101617480 CCACCCCCACCCATGGTCCTGGG + Intronic
1198251226 X:134880782-134880804 AGACCCAAACCCGTGGCCCTTGG - Intergenic
1200951830 Y:8905202-8905224 CCACCCCACCACGTGGCCCTCGG - Intergenic
1202122574 Y:21535906-21535928 CCGGCCCACCACGTGCCCCTCGG - Intronic
1202381095 Y:24276947-24276969 CCAGCCCAGCTCATGGCTCTCGG + Intergenic
1202489690 Y:25393179-25393201 CCAGCCCAGCTCATGGCTCTCGG - Intergenic