ID: 1081998310

View in Genome Browser
Species Human (GRCh38)
Location 11:47378272-47378294
Sequence TCCTCCACCAGCCCAACCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 198}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081998310_1081998314 -4 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998314 11:47378291-47378313 AGGAGTCCCGGTACTCACAGGGG 0: 1
1: 0
2: 1
3: 8
4: 85
1081998310_1081998321 6 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998321 11:47378301-47378323 GTACTCACAGGGGGGACGAGGGG 0: 1
1: 0
2: 0
3: 6
4: 77
1081998310_1081998312 -6 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998312 11:47378289-47378311 GGAGGAGTCCCGGTACTCACAGG 0: 1
1: 0
2: 1
3: 17
4: 164
1081998310_1081998320 5 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998320 11:47378300-47378322 GGTACTCACAGGGGGGACGAGGG 0: 1
1: 0
2: 1
3: 4
4: 80
1081998310_1081998313 -5 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 61
1081998310_1081998316 -2 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998316 11:47378293-47378315 GAGTCCCGGTACTCACAGGGGGG 0: 1
1: 0
2: 0
3: 5
4: 65
1081998310_1081998315 -3 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998315 11:47378292-47378314 GGAGTCCCGGTACTCACAGGGGG 0: 1
1: 0
2: 0
3: 3
4: 64
1081998310_1081998319 4 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081998310 Original CRISPR TCCTCCACCAGCCCAACCCG TGG (reversed) Intronic
900304911 1:2000976-2000998 TGCTCCACCTGCCCTACCCAGGG - Intronic
900658824 1:3772904-3772926 ACCCCCACCGGCCTAACCCGCGG + Intronic
900808494 1:4783688-4783710 TCCACCACCCACCCAACCAGGGG - Exonic
901462515 1:9400154-9400176 TCCTCCGCCAGCCCAACCATGGG + Intergenic
902707012 1:18212656-18212678 TGCACCACCAGCCCAACCCAGGG + Intronic
903665090 1:25001317-25001339 TCTTCCAGCCACCCAACCCGGGG + Intergenic
903858539 1:26351664-26351686 TTCTCAACCAGCCCAACCCCTGG + Intronic
903930081 1:26856931-26856953 ACCTCCACCTGCCTAACCTGTGG + Exonic
904471731 1:30740447-30740469 TCCTCCACCAGCCACTCCCAGGG + Intronic
904481657 1:30797771-30797793 TCCTCCAGCAGCCCAGCCACAGG - Intergenic
904589402 1:31602054-31602076 CCCTCCAACATCCCAACCCCTGG + Intergenic
905793538 1:40802652-40802674 TCCTCCCCCAGCACAGCCCTCGG - Intronic
908148308 1:61271569-61271591 CCCTCCACCAGACCACCCTGGGG - Intronic
908829085 1:68162259-68162281 TCGTCCACCAGGCCACCACGGGG + Intronic
908979593 1:69939483-69939505 TCCTCCTCCAGCCCCTCCCCAGG + Intronic
910876899 1:91886252-91886274 TCCTCCGCCGGCCCCACCGGGGG + Exonic
912495561 1:110089179-110089201 TGCCCCACCAGCCCATCCCCCGG - Intergenic
912516327 1:110218783-110218805 TCCTCCACCAACCCCACCGTTGG - Intronic
912705423 1:111908390-111908412 TCCTCCTCCAGCCCAGACTGAGG + Intronic
915691740 1:157697260-157697282 ACCTGCTCCAGCCCAATCCGAGG + Exonic
916817394 1:168367215-168367237 TCCTCAGCCAGCCCACCCAGGGG - Intergenic
917646481 1:177033705-177033727 TCCTCCACCAGCCTGACTCCAGG - Intronic
920203361 1:204274481-204274503 TACTCCATCAGCTCAACCTGTGG + Intronic
920695615 1:208179525-208179547 TCCCCCACCAGACCAACCCTTGG + Intronic
920855571 1:209658514-209658536 TCCTGCACCACCCCACCCTGAGG - Intergenic
922161197 1:223080265-223080287 TCCACCCCCAGCCCAACCTCAGG - Intergenic
923026135 1:230205764-230205786 CCCACCACCAGCCCATCCCCAGG + Intronic
924322760 1:242866022-242866044 TCCTCCCCCAGCCCCACACCTGG + Intergenic
1062861226 10:811931-811953 TCCTCCACCAGCCAAAGAGGGGG + Exonic
1064178955 10:13099118-13099140 TCCTACACCACACCAACTCGAGG + Intronic
1067249747 10:44576341-44576363 TCCTCCACCAGGCCCACCCTGGG + Intergenic
1069821955 10:71233820-71233842 TCCTCCTGCAGCCCATCCCTGGG + Intronic
1070290864 10:75112221-75112243 ATCACCACCAGCCCCACCCGGGG - Intronic
1070712041 10:78689865-78689887 CTCTCCACCAGCCCAGCCCCAGG + Intergenic
1070727604 10:78803009-78803031 TCCTCCTCCAGCACAACGCCCGG - Intergenic
1071998926 10:91175343-91175365 TCCTCCCCAAGCCCAAACCTAGG + Intronic
1073735536 10:106341755-106341777 TCCTCCACCTGCACAACTCACGG - Intergenic
1074875118 10:117607619-117607641 TCCTCTCCCAGCCCAAGCAGAGG - Intergenic
1075206591 10:120454603-120454625 TCCTCCACCAACCTAACCTCGGG + Intergenic
1077261507 11:1623941-1623963 TCCCCCACCAGCCCTGCGCGAGG + Intergenic
1078094303 11:8287174-8287196 TTATCCACCAGCCCTCCCCGTGG + Intergenic
1078999351 11:16738450-16738472 TCCTCCACCAGCCGAAGGCGGGG + Exonic
1081632514 11:44699527-44699549 TCCTCCACCATCTCTACCCCAGG - Intergenic
1081794877 11:45812211-45812233 TGCTCCATCAGCCCCACCTGGGG - Exonic
1081998310 11:47378272-47378294 TCCTCCACCAGCCCAACCCGTGG - Intronic
1082787450 11:57324723-57324745 ACCACCACCACCTCAACCCGAGG + Intronic
1083659404 11:64245287-64245309 TCCTCCCCCACCCCCACCCCAGG - Exonic
1084029999 11:66475775-66475797 GCCTTCCCCAGCCCAGCCCGTGG + Exonic
1084360821 11:68667597-68667619 TCCTCCATCTGCCCACCCCAGGG + Intergenic
1084553136 11:69860876-69860898 TCCTCCAGCAGGCCAGCCCCTGG - Intergenic
1084918308 11:72448185-72448207 TCATCCACCATCCCCACCCCAGG - Intergenic
1085527802 11:77174188-77174210 CCCTCCACCAACCAAACCCCAGG + Intronic
1085621781 11:78043179-78043201 TGTTCCAGCAGCCCAACCCCTGG + Intronic
1088250574 11:107858287-107858309 TCACCCACCTGCCCAGCCCGAGG + Intronic
1090269166 11:125373954-125373976 CCATCCACCAGCCCAGCCCCAGG - Intronic
1090449627 11:126795064-126795086 TCCTCCTCCTGCCCAACCCCTGG - Intronic
1093093476 12:14946669-14946691 TCCTCCACCTCCCCATCCAGAGG + Intronic
1095949973 12:47776507-47776529 CTCTCCACCAGCCCTACCCAAGG - Intronic
1102030085 12:109735289-109735311 TGCTCCACCAACCAACCCCGTGG + Intronic
1103324109 12:120109007-120109029 CACTCCACCAGCCCACCCGGCGG - Intronic
1104775733 12:131389214-131389236 GCCACCTCCAGCCCAGCCCGGGG - Intergenic
1104891679 12:132143256-132143278 TCCTCCACCTGCCCTACCTAAGG + Intronic
1108494427 13:51009981-51010003 TCCTGCACTACCCCAACCCATGG + Intergenic
1108585482 13:51866590-51866612 TCCTCCACATGCCCTACCAGAGG - Intergenic
1114266205 14:21074106-21074128 TCCTGCACCCGCCCACCCCCAGG - Exonic
1116001522 14:39247491-39247513 TCCTCCACCAAACCAACCAGTGG - Exonic
1119866646 14:77980315-77980337 ACCTCCATCAGTCCAACCTGGGG + Intergenic
1121779123 14:96610554-96610576 TCCTCCCTGACCCCAACCCGGGG - Intergenic
1122362195 14:101174178-101174200 TCCTCCCCCATCCCCACCCTGGG + Intergenic
1122631239 14:103108715-103108737 TCCTCCATCAGCCCCACCAGGGG + Intronic
1122692083 14:103536230-103536252 TCCTGGACCACCCCAACCCCAGG - Exonic
1127475938 15:59333345-59333367 TCCTCCACCACAGCAACCCCCGG + Intronic
1127807084 15:62531394-62531416 TCCCCAACCAGCCCAACCCCTGG - Intronic
1128235584 15:66065117-66065139 TCCCCCTCCTGCCCCACCCGTGG - Intronic
1130894284 15:88158403-88158425 ACCAGCACCAGCCCAACCCTAGG - Intronic
1131042551 15:89284977-89284999 TCCTCCACATGCCAAACCCCAGG - Intronic
1132809027 16:1788846-1788868 TCCCCGACCAGCCCAGCCCCAGG + Exonic
1132862495 16:2078434-2078456 ACCTCTACCACCCCAACCCCTGG - Intronic
1134685393 16:16154856-16154878 CCCTCCACCAGCCTCACCTGGGG + Exonic
1136293114 16:29287675-29287697 TCCTCCCCCAGCCCTACCACAGG + Intergenic
1141945401 16:87305736-87305758 CCCTCCTCCAGGCCATCCCGAGG - Exonic
1142098998 16:88261682-88261704 TCCTCCCCCAGCCCTACCACAGG + Intergenic
1142268387 16:89076801-89076823 TCCACTCCCAGCCCAGCCCGTGG + Intergenic
1142291051 16:89193698-89193720 ACCTCCACCAGGGCCACCCGAGG + Intronic
1203141667 16_KI270728v1_random:1771315-1771337 TCCTCCTCCATCCCAGCCCTGGG + Intergenic
1203141713 16_KI270728v1_random:1771458-1771480 TCCTCCTCCATCCCAGCCCCAGG + Intergenic
1143223656 17:5282407-5282429 TCCTCCGCCAGCTGAGCCCGCGG + Exonic
1143978573 17:10848157-10848179 CCCTCCACCACCCCAACACTGGG - Intergenic
1144786514 17:17835389-17835411 TCCTCCCCTAGCCCAGCCCCAGG + Intronic
1146283760 17:31560745-31560767 TCCAACACCAGGCAAACCCGAGG - Intergenic
1146590762 17:34126359-34126381 TCCTCCACCACCCCAGGCTGTGG - Intronic
1147161706 17:38572610-38572632 CCCGCCCCCCGCCCAACCCGAGG + Intronic
1147217876 17:38911536-38911558 TCCCCCACCACCCCAGCCAGGGG + Intronic
1147603871 17:41762995-41763017 TGCTCAACCAGCCCAACCAGTGG - Exonic
1148355378 17:46972171-46972193 TCCTGCCCCAGCCCAGCCCCAGG - Intronic
1148846856 17:50534521-50534543 GCCTTCACCTCCCCAACCCGTGG - Intronic
1149990394 17:61379951-61379973 TACTCCACCAACCCACCCCTCGG - Intronic
1152298199 17:79480573-79480595 TCCTCCACCTGCACAGCCCCCGG + Intronic
1156886476 18:42141259-42141281 TCCTCCCCCAGCCCCACACCGGG - Intergenic
1157564095 18:48668155-48668177 GCCTCCACCTGCCCACCCCCAGG + Intronic
1158969844 18:62656209-62656231 TCCTCCACCACCACCACCCTGGG + Intergenic
1160043028 18:75362571-75362593 TCCTCCAGCAGCCCAAGCCACGG - Intergenic
1160592257 18:79951307-79951329 CCCTCCCCCACCCCATCCCGGGG - Intronic
1160755094 19:752820-752842 TCCTACACCCGCCCTCCCCGGGG + Intronic
1160819978 19:1053367-1053389 TCCTCCACCAGCCGTGCCCCGGG - Exonic
1160856837 19:1221580-1221602 GCCTCCCCCAGCCCCACCCTCGG + Intronic
1160865930 19:1255917-1255939 TCCTGCCCCACCCCCACCCGGGG + Intronic
1160901805 19:1432572-1432594 TCCTCCACCAGCCACTCCCGGGG + Exonic
1161011747 19:1962717-1962739 TCCTCCACCTGCCGCTCCCGGGG - Intronic
1161722114 19:5908927-5908949 TCCTGCAGCAGCTCAGCCCGGGG - Exonic
1163526492 19:17824651-17824673 TCCTCCACCAGCCTGCCCTGGGG + Intergenic
1165248500 19:34512391-34512413 ACCACCCCCAGCCCATCCCGTGG + Intergenic
1165395735 19:35562678-35562700 TCCTCCACATGCACACCCCGTGG + Intronic
1165419459 19:35715809-35715831 GCCTCCTCCAGCCCTACCCCAGG + Exonic
1168240416 19:55086406-55086428 TCCACCACCAGCCCCAGCCCCGG + Exonic
927141495 2:20134192-20134214 CCCTCCACCAGACACACCCGAGG - Intergenic
927146263 2:20168474-20168496 CCCTCCAGCAGCCCAGCCCTGGG + Intergenic
927510914 2:23643123-23643145 TCCCCCTCCAGCCCAAGCCCTGG + Intronic
932716184 2:74101881-74101903 ACCTCAACCAGCCCAACCACGGG + Exonic
937344066 2:121112461-121112483 TCCTCCCCAACCCCAACCCCTGG - Intergenic
937737682 2:125312474-125312496 GCTCCCACCAGCCCACCCCGGGG - Intergenic
938245463 2:129773659-129773681 TCCTCCTCCACCCCAGCCCCTGG + Intergenic
939973922 2:148694761-148694783 TCCTCCCCCCGCCCAAACCCTGG + Intronic
946311187 2:218883506-218883528 GCCTCCACCAGCCCAGCCCCAGG + Intronic
947229727 2:227872685-227872707 TCCCCCACCCCCCCAACCCCCGG + Intronic
947557076 2:231102648-231102670 TCCTCCACCAACCCAATGTGAGG - Intronic
948767886 2:240232955-240232977 GCCTCCACCAGCCCCACCCTGGG - Intergenic
949006670 2:241653380-241653402 TCCTCCATCAGCTCCACCTGGGG - Intronic
1168757197 20:325852-325874 TCCTCCCCCACCCCCAGCCGCGG + Exonic
1169501023 20:6160992-6161014 TCCTCCACCTGCCTACCCCATGG + Intergenic
1169505671 20:6208720-6208742 TCCTACATCAGCCCATCCCCAGG - Intergenic
1169550324 20:6695531-6695553 TCCCCCACCACCCCAGTCCGTGG - Intergenic
1170656187 20:18289211-18289233 TCCTCCAACGCCCGAACCCGGGG - Intronic
1172690532 20:36786443-36786465 GCCTCAACCAGCCCAGCCCCTGG - Exonic
1172941263 20:38656216-38656238 TCCTCTCCCAGCTCATCCCGTGG - Intergenic
1173804837 20:45917743-45917765 TCCTCCACCAGCCCAGGTCAAGG - Intergenic
1174398032 20:50260016-50260038 TCCTCCATCTGCCCCACCCAGGG + Intergenic
1179950965 21:44708663-44708685 TCCTCCCTCAGCCCACCCTGGGG + Intronic
1180066574 21:45415471-45415493 CCCTCCTCCTGCCCCACCCGTGG - Intronic
1180162746 21:46005646-46005668 CCCTCCTCCAGCCCAGCCCTCGG - Intergenic
1181749276 22:24977562-24977584 ACCTCCCCCAGCCCACCCTGGGG + Intronic
1182094099 22:27614603-27614625 TCCCCCACCACCCGACCCCGGGG + Intergenic
1183038465 22:35158305-35158327 TCCTCCCTCAGCCAAACCCTTGG + Intergenic
1183445377 22:37850070-37850092 TACTCAGCCAGCCTAACCCGTGG - Intronic
1183949000 22:41342363-41342385 TCCTCCACCCTCCCAGCCAGGGG - Intronic
1184144928 22:42604276-42604298 TCCTCCCCCCGCCCCACCCAGGG - Intronic
952969312 3:38640947-38640969 TCCCCCACCATCCCAACCTGTGG - Intronic
954375966 3:50194289-50194311 CCCTCCCCCAGCCCAGCGCGCGG - Intronic
954440894 3:50521443-50521465 TCCTCCTACAGCCCAAACCCTGG - Intergenic
960011754 3:112841656-112841678 TTGTCCACCAGCCCCACCCAAGG + Intronic
961103986 3:124225514-124225536 TCCTAGAACAGCCCAACCCAAGG + Intronic
961754932 3:129121870-129121892 TCCGCCCCCAGCCCAACCCTCGG + Intronic
966875949 3:184321766-184321788 TGCTCCAACTGCCCAACCTGAGG + Exonic
966917117 3:184591108-184591130 TCCTCCCCCAGCCCATCCCCAGG + Intronic
967091512 3:186138523-186138545 CCCTCCTCCAGCCTAACCCCTGG - Intronic
968236704 3:197035781-197035803 TCCTCCTCCCGCCCATCCCCAGG - Intergenic
969400410 4:6951709-6951731 TCCTCCACCATTCCACCCCCTGG - Intronic
973259522 4:48148071-48148093 CCCTTCACCAGCCCAGCCCCAGG - Intronic
974534314 4:63154775-63154797 TCCAGCACCAGCCCAACGCATGG - Intergenic
981558726 4:146023875-146023897 TCCTCCCCCAGCCCCAGCAGTGG - Intergenic
985487130 5:158195-158217 TCCTCCCCCTGCCCATCCTGGGG + Intronic
985487149 5:158236-158258 TCCTCCCCCTGCCCATCCTGGGG + Intronic
985634085 5:1027527-1027549 ACCTCCACCCTCCCAACTCGTGG + Intronic
985962851 5:3316036-3316058 TCTTCTCCCAGCCCAACCCCTGG - Intergenic
986259835 5:6134590-6134612 CCCACGACCAGCCCAAGCCGGGG - Intergenic
987871145 5:23618276-23618298 TCCTCCACCAACTCCACCCCAGG - Intergenic
995236454 5:109834231-109834253 TCCTAGACCAGCCCAAGCCTGGG + Intronic
995890726 5:116947641-116947663 TCCACCACCACCCCAGCCCCTGG - Intergenic
997286335 5:132681378-132681400 GCCTCCATCAGCCAAACCCAGGG - Intronic
999045532 5:148465056-148465078 TCCTCCCCCACCCCAACCTCTGG - Intronic
999730782 5:154475553-154475575 TCCACCCCCAGCCCAACCGAGGG - Exonic
1000370964 5:160536239-160536261 TTCTCTGCTAGCCCAACCCGGGG - Intergenic
1002068192 5:176662979-176663001 TCCTCCACCAGCCCCTTCCCAGG + Intergenic
1004439946 6:15640868-15640890 CCATCCACCACCCCAACCCCTGG + Intronic
1006679587 6:35787488-35787510 TCCTCCACCAGGAACACCCGGGG - Intronic
1007782415 6:44262169-44262191 TCCTCCTGCAGCCTAACCCCTGG - Intronic
1010657553 6:78529617-78529639 TCTTCCACTAGCCCCACCCCAGG + Intergenic
1015166421 6:130204965-130204987 TCCTCCACTTGCCCAACAAGTGG - Intronic
1015626277 6:135182818-135182840 TCCCCGCCCAGCCCAGCCCGCGG - Intronic
1017246902 6:152236857-152236879 TCCTCCACCAGACCCACGCTTGG + Exonic
1019341051 7:509152-509174 TCCTCCCCCAGCGCAACCCCAGG + Intronic
1020150615 7:5679181-5679203 ACCACCACCACCCCTACCCGAGG - Intronic
1022495422 7:30850215-30850237 TCCTTCACCAGCCCCACCCAGGG + Intronic
1024379791 7:48683330-48683352 TCCTTCACCTGCCCTACCCTGGG + Intergenic
1024474163 7:49792731-49792753 GCCTCCTCCAGCCAAGCCCGAGG - Intronic
1025927999 7:65974483-65974505 TGCTCCGCCTGCCCAGCCCGGGG - Intronic
1026837488 7:73648177-73648199 CCCTCCCCGAGCCCAGCCCGCGG - Intergenic
1029708550 7:102287522-102287544 TCCTCCCCGATCCCATCCCGTGG - Intronic
1030033521 7:105389112-105389134 GCCTCCCCCACCCCAGCCCGCGG + Intronic
1032514201 7:132494932-132494954 TCCTCCTCCAGCCCTTCCCAGGG - Intronic
1033199753 7:139359091-139359113 ACCTCCACCAGCCCTACGAGGGG + Intronic
1040568832 8:48590651-48590673 TCCTCCACCAGCACCACACGGGG + Intergenic
1041167184 8:55102036-55102058 TCCTCCACCAGCTGACTCCGAGG - Intergenic
1045148803 8:99379192-99379214 TCCTCCACCCCCCAAATCCGTGG + Intronic
1047983992 8:130213914-130213936 TCCTCCACCACCCCCATCCCTGG + Intronic
1048338627 8:133522064-133522086 TTCTCCAGCAGCCCAACTCTGGG + Intronic
1048539141 8:135326601-135326623 TCCTCCATCAGGCCAACAGGTGG - Intergenic
1049383685 8:142330351-142330373 TCCCAGACCAGCCCAACCCAGGG + Intronic
1049812750 8:144582783-144582805 TCCACCACCAGCCCATCCCCAGG - Intronic
1050293463 9:4180771-4180793 TCCACCACCATCCCAAACTGAGG + Intronic
1051924669 9:22309488-22309510 TCCTCCACAAGCTCCACCAGGGG + Intergenic
1056578599 9:87873843-87873865 CACTCCACCAACCCAACCCCAGG + Intergenic
1056858949 9:90161953-90161975 TCCTCCAGCTGCCCAAACCATGG + Intergenic
1060545686 9:124457822-124457844 TCCTCCACCACCCACTCCCGAGG - Intronic
1061803833 9:133127415-133127437 ACCTCCACCTGCCCAACAGGAGG - Intronic
1061861578 9:133471160-133471182 TCCTGCCCCAGCCCAACCTCTGG - Exonic
1061974495 9:134061499-134061521 TCCTCCAGCACCCCCACCCTTGG - Intronic
1061997194 9:134192558-134192580 TCCCCCACCAGCCCACCTCTCGG - Intergenic
1185513028 X:677330-677352 TCCTTCACTATCCCAACCCGGGG - Intergenic
1185550623 X:980658-980680 TCCTCCATCATCCCAACCCCAGG - Intergenic
1185550663 X:980789-980811 TCCTCCATCATCCCAGCCCCAGG - Intergenic
1185550696 X:980890-980912 TCCTCCTCCATCCCAGCCCCAGG - Intergenic
1185550713 X:980941-980963 TCCTCCTCCATCCCAGCCCCAGG - Intergenic
1185550744 X:981039-981061 TCCTCCATCATCCCAGCCCCAGG - Intergenic
1185550775 X:981142-981164 TCCTCCATCATCCCAGCCCCAGG - Intergenic
1185550793 X:981194-981216 TCCTCCATCATCCCAGCCCCAGG - Intergenic
1185550872 X:981448-981470 TCCTCCTCCATCCCAGCCCCAGG - Intergenic
1187547401 X:20267087-20267109 TCTTCCACTAGCCCAGCCCCTGG - Intronic
1189160811 X:38805933-38805955 GCCTCCACCGGCCCAACCGCAGG - Exonic
1192236835 X:69301523-69301545 TCCTCCACCAAGCCCACCTGTGG + Intergenic
1195107819 X:101617451-101617473 TCCTCCGCCACCCCCACCCATGG + Intronic
1199721731 X:150547409-150547431 CCCTCCCCCAGCACAACGCGAGG + Intergenic
1200065373 X:153502124-153502146 TCCTCCTCCAGGCCAATGCGTGG + Intronic