ID: 1081998313

View in Genome Browser
Species Human (GRCh38)
Location 11:47378290-47378312
Sequence GAGGAGTCCCGGTACTCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081998310_1081998313 -5 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 61
1081998306_1081998313 2 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081998313 Original CRISPR GAGGAGTCCCGGTACTCACA GGG Exonic
901399677 1:9007291-9007313 GAGGCGTGCAGGTACTCACTGGG + Exonic
922125099 1:222713458-222713480 GAGGACTCCCGCTCCTAACAAGG - Intronic
923325709 1:232878411-232878433 GAGGAGTCCGGGTAGGCACTGGG - Intergenic
923621326 1:235581860-235581882 GAAGACACCCGGTCCTCACAGGG + Intronic
1070865510 10:79706151-79706173 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1070879304 10:79844282-79844304 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1071632410 10:87228372-87228394 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1071645863 10:87360590-87360612 GAGGAGCCCCTGCAGTCACAAGG - Exonic
1074696391 10:116053519-116053541 GAGCAGTCCTGGCACTCAGATGG + Intergenic
1076055941 10:127372949-127372971 CCGGAGTCCCAGTACTCAGATGG + Intronic
1080330740 11:31134387-31134409 GAGGAGTCCTGTGACTCTCAGGG - Intronic
1081447255 11:43142591-43142613 GAGGATTCCCAGTGCTCACAGGG + Intergenic
1081702627 11:45161630-45161652 GAGCCGTCCCGGGACTCTCAGGG - Intronic
1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG + Exonic
1093907432 12:24709685-24709707 GATTAGTGCCGGTACTTACAAGG - Intergenic
1095885394 12:47183751-47183773 GATGAGTCCCTGTCCTCACGTGG - Intronic
1097079800 12:56421726-56421748 GAGGAATTCCGGGACTCAGATGG - Exonic
1105940198 13:25141022-25141044 GAGGAGTGAGGGTCCTCACAGGG - Intergenic
1110242508 13:73284615-73284637 AAGGAGTCAGGGTATTCACAGGG + Intergenic
1119831538 14:77707438-77707460 GAGGAATCCCAGAACTGACAGGG - Intronic
1125606846 15:40944315-40944337 GAGAAGTCAAGGTGCTCACAAGG - Intergenic
1129747793 15:78037174-78037196 GAGGAGGCCAGGGACTCCCAGGG - Intronic
1130960282 15:88654463-88654485 GAGGACTTCCTGTTCTCACAGGG - Intronic
1136147580 16:28324435-28324457 GAGGAATCCTGGTACACAAAAGG - Intergenic
1138947752 16:61872743-61872765 GAGGAGGGCAGGTACTCAGATGG + Intronic
1144124440 17:12189546-12189568 GAGGAGTGCTGTTCCTCACATGG + Intergenic
1148063308 17:44851259-44851281 CAGGAGTCCACGCACTCACATGG + Exonic
1160244461 18:77145843-77145865 CAGGAGGCCCGGCCCTCACACGG - Intergenic
1162070607 19:8149873-8149895 GAGAAGTCCCGGGACTCACCTGG + Intronic
1165824239 19:38696629-38696651 GAGGAGAGCCTGCACTCACAAGG - Intronic
1165952270 19:39481030-39481052 GAGGCGTCCCGGAACCCCCAAGG - Intronic
1167234813 19:48307876-48307898 GAGGAGTCCCGGTTCTTTCTAGG - Intronic
1168309288 19:55452483-55452505 CAGGAGTTCCGGGACCCACATGG - Intergenic
926266593 2:11327972-11327994 GAGCAATCCAGGTACACACAAGG + Intronic
927662038 2:25001418-25001440 CAGGTGTCCCGGTTCTCACACGG - Intergenic
933726314 2:85429609-85429631 GAGGAGTCCCAGTACTCACCGGG - Intronic
937912177 2:127081066-127081088 CAGGACTCCCTGTACCCACAGGG - Intronic
943228169 2:185208444-185208466 GAGGAATCCTGCTACTAACAGGG - Intergenic
944583219 2:201150951-201150973 GAGGAGTCCTGGAACCCAGAGGG + Intronic
1172397117 20:34616054-34616076 GAGGAGTCCTGGGACAAACAAGG + Exonic
1175592036 20:60200798-60200820 GAGGTGTCCAGGTTCTCACTGGG - Intergenic
1175944757 20:62553523-62553545 GAGGAGTCCAGGTTCCCAGAGGG - Exonic
1182779518 22:32856490-32856512 GAGGAGTCTCAGTACCCAGAAGG - Intronic
1183293798 22:37018614-37018636 GACGCGTCCTGGTACTCACCAGG - Exonic
1184776691 22:46626958-46626980 GACGAGGACAGGTACTCACAGGG - Exonic
950487379 3:13281638-13281660 CAGGAGTCCCAGTACTGTCATGG - Intergenic
951718565 3:25674292-25674314 GAGGCATCCCTGTACTCTCAGGG - Intergenic
952455238 3:33466379-33466401 GAGAAGCCCCTGTACTCGCAGGG + Intergenic
962895454 3:139709888-139709910 CAGGAGTCCCGCAACTCTCATGG + Intergenic
980801927 4:137762843-137762865 GATGAGTCCTGGTACTCAGCAGG - Intergenic
990446749 5:55900187-55900209 GAGCAGTCCCTGTGCTCTCAAGG + Intronic
1003115174 6:3278896-3278918 GAGGACTCCCCTTACTCACACGG + Intronic
1016715118 6:147216885-147216907 GACGAGTCCTAGAACTCACATGG + Intronic
1017986051 6:159444078-159444100 GAAGAGACCCAGTACCCACAGGG - Intergenic
1034466957 7:151235436-151235458 GAGCAGGCCCGGTACTGTCATGG + Exonic
1035598177 8:878090-878112 GAGGACTCCCAGTACTCTCAAGG - Intergenic
1042118605 8:65459688-65459710 CAGGAGCCCCGATATTCACAGGG - Intergenic
1049009268 8:139876402-139876424 AAGGAGTCCCGGTACGCATGAGG - Intronic
1049344555 8:142131598-142131620 GAGGAATCCCGGCAGTGACAGGG + Intergenic
1049673300 8:143879040-143879062 GAGGGGACCAGGTACTCCCAGGG - Intergenic
1049862727 8:144911086-144911108 GAGGAGTCCCTGGGCACACAGGG + Intergenic
1056815288 9:89796679-89796701 GAGGAGGCCAAGTGCTCACAGGG + Intergenic
1057207884 9:93184382-93184404 GGGGAGGCTCGGCACTCACAGGG - Intergenic
1061415232 9:130443999-130444021 GAGGACTCCCGGTCCTCAGCCGG - Intergenic
1062379154 9:136278471-136278493 GAGGAGTCAGGGCACTCACTGGG - Intergenic
1185699688 X:2221282-2221304 CAGGAGTCTCAGGACTCACATGG + Intronic
1201640381 Y:16171105-16171127 GAAGAGTCCCAGTACTAACCAGG - Intergenic
1201662433 Y:16414220-16414242 GAAGAGTCCCAGTACTAACCAGG + Intergenic