ID: 1081998313

View in Genome Browser
Species Human (GRCh38)
Location 11:47378290-47378312
Sequence GAGGAGTCCCGGTACTCACA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081998306_1081998313 2 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 61
1081998310_1081998313 -5 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998313 11:47378290-47378312 GAGGAGTCCCGGTACTCACAGGG 0: 1
1: 0
2: 1
3: 5
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081998313 Original CRISPR GAGGAGTCCCGGTACTCACA GGG Exonic