ID: 1081998319

View in Genome Browser
Species Human (GRCh38)
Location 11:47378299-47378321
Sequence CGGTACTCACAGGGGGGACG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 61}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1081998306_1081998319 11 Left 1081998306 11:47378265-47378287 CCGAGGGCCACGGGTTGGGCTGG 0: 1
1: 0
2: 3
3: 27
4: 286
Right 1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG 0: 1
1: 0
2: 0
3: 4
4: 61
1081998310_1081998319 4 Left 1081998310 11:47378272-47378294 CCACGGGTTGGGCTGGTGGAGGA 0: 1
1: 0
2: 0
3: 24
4: 198
Right 1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG 0: 1
1: 0
2: 0
3: 4
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1081998319 Original CRISPR CGGTACTCACAGGGGGGACG AGG Exonic
900623317 1:3597060-3597082 CGGTCCTCACAGGGGCTGCGGGG - Intronic
908649023 1:66311875-66311897 CGGTGCTCAGAGCGGGGAAGTGG - Intronic
915562149 1:156693635-156693657 CGGTCCTCAAAGGAGGGATGCGG - Intergenic
918118157 1:181514703-181514725 CGGTGCTGACAGGAGGGAAGTGG + Intronic
1067010274 10:42705143-42705165 AGGCACTCACTGGGGGGACTTGG - Intergenic
1071875438 10:89838175-89838197 CGCTATTCACAGAGGGGGCGGGG + Intergenic
1072612857 10:97030747-97030769 GGGTACTCACAGGTGAGACAGGG + Exonic
1073890069 10:108091025-108091047 CAGTACTCACAGTGGGCACGGGG + Intergenic
1073951087 10:108810703-108810725 TGGTACTCAAAGGGGTGACATGG + Intergenic
1077292504 11:1804359-1804381 CTGTGCTCACAGGGCGGACTTGG + Intergenic
1078413957 11:11150062-11150084 CTGTTCTCACAGAGGGGACATGG + Intergenic
1079402264 11:20115223-20115245 AGGGACTCACAGAGGGGAGGAGG + Intronic
1081998319 11:47378299-47378321 CGGTACTCACAGGGGGGACGAGG + Exonic
1101883645 12:108642629-108642651 CGGTTCCCACAGGAGGGATGAGG + Intergenic
1101904495 12:108814691-108814713 CGGTGCCCACAGGTGGGCCGTGG + Intronic
1102483817 12:113242763-113242785 AGGTATTCACAGGGTGGATGGGG - Intronic
1102962340 12:117100714-117100736 CGGTGCCCACAGAGGGGACTCGG + Intergenic
1103446157 12:120996558-120996580 GGGTGCTGACAGGGGGGAGGGGG - Exonic
1108884489 13:55163630-55163652 GGGTACTCACAGCAGGGAAGAGG + Intergenic
1110721382 13:78766182-78766204 AGGTACTCTCAGAGGGGAGGAGG + Intergenic
1113271420 13:108678962-108678984 AGGTACTCACAGGGTGGAAAGGG + Intronic
1113907845 13:113828537-113828559 CAGTACTCACAGGCTGCACGAGG + Exonic
1114602587 14:23968855-23968877 CGGTCCTCAGAGGCGGGACGGGG - Exonic
1114606956 14:24005984-24006006 CGGTCCTCAGAGGCGGGACGGGG - Exonic
1114612265 14:24050952-24050974 GGGTCCTCAGAGGCGGGACGGGG - Intergenic
1115708170 14:36019569-36019591 TGGTACTCAGAGGGAGGATGGGG + Intergenic
1125514038 15:40308046-40308068 CGCTGCTCACAGCGGAGACGTGG + Intergenic
1128874881 15:71193831-71193853 CTGTAGTCCCAGGGGGGACTAGG - Intronic
1131160556 15:90102266-90102288 CGGCACTCACAGTGGCGCCGCGG + Exonic
1132208406 15:100002487-100002509 CAGGACACACTGGGGGGACGAGG + Intronic
1132978312 16:2721277-2721299 CGGTACTCGCGGGCGGGGCGGGG + Intergenic
1143211477 17:5191507-5191529 CGGTACCCACAGGAGGGAACTGG + Intronic
1149600340 17:57889297-57889319 CTGCCCTCACAGGGGGGATGGGG + Intronic
1150852269 17:68714971-68714993 CAGTAGTCACAGGGGGGACACGG - Intergenic
1151426723 17:74035497-74035519 TGGTACTCACAGGGGCCACACGG + Intergenic
1155033237 18:22002180-22002202 CATTACTCAAAGGGAGGACGTGG + Intergenic
1164227870 19:23261792-23261814 CTGTACTCACAGGGGGTATTGGG - Intergenic
930884833 2:56313818-56313840 AGGTACTCACAGGGAGGGCAGGG + Intronic
931802647 2:65773552-65773574 CAGTACACACAGGGGCGAGGTGG + Intergenic
932725772 2:74178678-74178700 CGGTCCTCAGAGGGGAGGCGAGG + Exonic
933598152 2:84303348-84303370 AGGTACTCACAGGGTTGAAGGGG + Intergenic
936690856 2:114886806-114886828 CTGTACTCACAGGGGCTACCTGG + Intronic
938188555 2:129254676-129254698 AGGGACTCAGAGGGGGGGCGGGG + Intergenic
1172528879 20:35617313-35617335 CGATACTCAAACGGGGGCCGGGG - Intronic
1175710523 20:61216912-61216934 GGGTGCTCCCAGGGAGGACGTGG - Intergenic
1175816961 20:61888185-61888207 CGGTACACACAGATGGGACATGG + Intronic
951334848 3:21408190-21408212 GGGTACTTACAGGGGGAAAGGGG - Intergenic
954150750 3:48655970-48655992 CGGGACCGACCGGGGGGACGCGG + Intronic
964494118 3:157270145-157270167 AGGTACTCACGGGGGTGAAGGGG + Intronic
984893449 4:184514260-184514282 CTGAGCTCACAGGGGGGACCTGG - Intergenic
985716358 5:1464222-1464244 CGGGTCTCCCAGGGTGGACGAGG - Intronic
1002622038 5:180494706-180494728 CTGCACTCACAGGGAGGAGGAGG + Exonic
1006295028 6:33166503-33166525 CAGTACTCACGGGGAGGCCGGGG + Exonic
1021123782 7:16826628-16826650 CAGTACTCACAGTGGGCATGGGG + Intronic
1030507636 7:110444951-110444973 CGTTACACACATGGGGGACTCGG - Intergenic
1031987356 7:128171722-128171744 CGGTGCTGACAGTGGGGAGGGGG + Intergenic
1035553551 8:546363-546385 CGGGACGCACAGGGAGGGCGGGG + Intergenic
1038623436 8:29167337-29167359 CTGGACTCACAGGGCGCACGCGG + Intronic
1040610310 8:48977067-48977089 CGGTATTCCTAGGGGAGACGGGG - Intergenic
1049221173 8:141429613-141429635 TGGTCCTTACAGCGGGGACGTGG - Intronic
1049221275 8:141429969-141429991 TGGTCCTTACAGCGGGGACGTGG - Intronic
1049221396 8:141430386-141430408 TGGTCCTTACAGCGGGGACGTGG - Intronic
1049379453 8:142304821-142304843 CGTTCCTCCCAGGGGGGACATGG + Intronic
1050560980 9:6834382-6834404 CTGTGCTCACGGGGCGGACGTGG - Intronic
1058641372 9:107088831-107088853 CGTTACTAACAGGTGGGAGGTGG - Intergenic
1060757271 9:126222998-126223020 AGGAACCCACAGGGGAGACGGGG - Intergenic