ID: 1082001354

View in Genome Browser
Species Human (GRCh38)
Location 11:47395162-47395184
Sequence GGCCAAAGTAGGCCTGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082001354_1082001363 4 Left 1082001354 11:47395162-47395184 CCAGGGCCAGGCCTACTTTGGCC No data
Right 1082001363 11:47395189-47395211 TTAAATCAGAATGTGGGGTCAGG No data
1082001354_1082001357 -3 Left 1082001354 11:47395162-47395184 CCAGGGCCAGGCCTACTTTGGCC No data
Right 1082001357 11:47395182-47395204 GCCACCCTTAAATCAGAATGTGG No data
1082001354_1082001364 5 Left 1082001354 11:47395162-47395184 CCAGGGCCAGGCCTACTTTGGCC No data
Right 1082001364 11:47395190-47395212 TAAATCAGAATGTGGGGTCAGGG No data
1082001354_1082001360 -1 Left 1082001354 11:47395162-47395184 CCAGGGCCAGGCCTACTTTGGCC No data
Right 1082001360 11:47395184-47395206 CACCCTTAAATCAGAATGTGGGG No data
1082001354_1082001365 6 Left 1082001354 11:47395162-47395184 CCAGGGCCAGGCCTACTTTGGCC No data
Right 1082001365 11:47395191-47395213 AAATCAGAATGTGGGGTCAGGGG No data
1082001354_1082001359 -2 Left 1082001354 11:47395162-47395184 CCAGGGCCAGGCCTACTTTGGCC No data
Right 1082001359 11:47395183-47395205 CCACCCTTAAATCAGAATGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082001354 Original CRISPR GGCCAAAGTAGGCCTGGCCC TGG (reversed) Intergenic
No off target data available for this crispr