ID: 1082002289

View in Genome Browser
Species Human (GRCh38)
Location 11:47399992-47400014
Sequence CAGTTATCTCAGCTGGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082002289_1082002297 22 Left 1082002289 11:47399992-47400014 CCATTTTCCAGCTGAGATAACTG No data
Right 1082002297 11:47400037-47400059 TCGTCGCTGAGGCTGTGAGCAGG No data
1082002289_1082002294 11 Left 1082002289 11:47399992-47400014 CCATTTTCCAGCTGAGATAACTG No data
Right 1082002294 11:47400026-47400048 CCCGCTGCCGCTCGTCGCTGAGG No data
1082002289_1082002298 26 Left 1082002289 11:47399992-47400014 CCATTTTCCAGCTGAGATAACTG No data
Right 1082002298 11:47400041-47400063 CGCTGAGGCTGTGAGCAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082002289 Original CRISPR CAGTTATCTCAGCTGGAAAA TGG (reversed) Intergenic
No off target data available for this crispr