ID: 1082003657

View in Genome Browser
Species Human (GRCh38)
Location 11:47408427-47408449
Sequence CCTCGCGGCGGTGGGGGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082003657_1082003671 17 Left 1082003657 11:47408427-47408449 CCGGGTCCCCCACCGCCGCGAGG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1082003671 11:47408467-47408489 CGCCACTCCCCCCGACCCCGCGG 0: 1
1: 0
2: 0
3: 16
4: 217
1082003657_1082003674 24 Left 1082003657 11:47408427-47408449 CCGGGTCCCCCACCGCCGCGAGG 0: 1
1: 0
2: 1
3: 11
4: 136
Right 1082003674 11:47408474-47408496 CCCCCCGACCCCGCGGCACGCGG 0: 1
1: 0
2: 1
3: 16
4: 156

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082003657 Original CRISPR CCTCGCGGCGGTGGGGGACC CGG (reversed) Intronic
900511306 1:3062337-3062359 ACTGGCGGCGGCGGGGGAGCAGG + Intergenic
901870709 1:12137745-12137767 GCTCCAGGAGGTGGGGGACCTGG + Intronic
902768300 1:18631231-18631253 CCCCGCGGCGGAGGGGGGCCGGG - Exonic
902773686 1:18660822-18660844 ACTCACGGGGGTGGGGGACCTGG + Intronic
903698948 1:25232160-25232182 CCTCGCTGCGGCGGCGGAGCTGG - Exonic
916101807 1:161399501-161399523 CCTGGCGGCTGTGGGCGACTGGG - Intergenic
916174186 1:162023954-162023976 CCGCGCGGAGGAGGAGGACCTGG + Intergenic
917968902 1:180194991-180195013 CCTCCCGGGGGGGGGAGACCAGG + Intronic
918348994 1:183635181-183635203 CCTCGCGGCGCTGGGGAAGGCGG - Intronic
920646388 1:207807166-207807188 CCTGGGGGAGGTGGGGGAGCTGG - Intergenic
921523913 1:216193777-216193799 CCTAGAGCCTGTGGGGGACCTGG + Intronic
923126503 1:231039314-231039336 CTTCGCGGGGCTGAGGGACCCGG + Intronic
1064022851 10:11823521-11823543 CCTGGCGGCGGTGGCGGCGCTGG + Intronic
1064764762 10:18659564-18659586 CCGCGCCGCGGTGGGGGACCCGG + Exonic
1066464203 10:35639454-35639476 CCCGGCGGCGGCGGGGGGCCGGG - Exonic
1067015279 10:42753602-42753624 CCTGGCGGGTGTCGGGGACCTGG - Intergenic
1069069825 10:63981840-63981862 CCCATCGGGGGTGGGGGACCAGG - Intergenic
1069724573 10:70569006-70569028 CCTAGGGGCGGTGGGGGCTCTGG - Intergenic
1072555913 10:96513606-96513628 CCTCGCGGCGCCGGGGGACTCGG - Exonic
1073509564 10:104034707-104034729 CCTCGAGGCCCTGGGGGACCAGG + Exonic
1074890682 10:117734805-117734827 CTTGGCTGGGGTGGGGGACCCGG - Intergenic
1075654457 10:124152109-124152131 CCGCTGGGCGGTGGGGGTCCTGG + Intergenic
1076183675 10:128430472-128430494 CGTCGCGTGGATGGGGGACCCGG + Intergenic
1076380381 10:130021211-130021233 CCGCGGGACGGTGGGGGACCAGG - Intergenic
1077506250 11:2931177-2931199 CCTCTGGGCAGTGGGAGACCAGG + Intergenic
1079111992 11:17610264-17610286 TCCCGAGGAGGTGGGGGACCTGG - Exonic
1082003657 11:47408427-47408449 CCTCGCGGCGGTGGGGGACCCGG - Intronic
1084150266 11:67284938-67284960 ACTCGAGGCGGTTGGGGAACAGG - Exonic
1084557075 11:69881653-69881675 CCTAGAGGTGGTGTGGGACCTGG - Intergenic
1085474837 11:76783284-76783306 CCTGGCTGCGGGCGGGGACCGGG + Intronic
1092042355 12:5395813-5395835 GCTCTCGGGAGTGGGGGACCGGG + Intergenic
1096417331 12:51425184-51425206 GCTCCGGGCGGTTGGGGACCAGG + Intronic
1097245413 12:57605081-57605103 CCACCCGGCGGTGGGGATCCGGG + Intronic
1097584171 12:61495288-61495310 CCTGTCGGGGGTGGGGGACTAGG - Intergenic
1098275661 12:68808712-68808734 TCTCGCGGCGGTGGGGGTGGGGG + Intronic
1103953972 12:124566718-124566740 GCCCGCGGGGGAGGGGGACCAGG + Intronic
1105034268 12:132907645-132907667 CCTGTCGGGGGTGGGGGGCCAGG - Intronic
1106516955 13:30464706-30464728 CCTCGCGGCGGCGGCGGCGCAGG - Intronic
1107849927 13:44561053-44561075 CCCCGGGGCGTCGGGGGACCAGG + Intronic
1110727074 13:78838211-78838233 CCTGTCGGGGGTGGGGGACAAGG - Intergenic
1113992024 14:16035419-16035441 CATCGCGGCGGTGGGAGCCTTGG - Intergenic
1118729543 14:68656710-68656732 CCTCTCAGGGGTGGGGGACCTGG - Intronic
1124363295 15:29054322-29054344 CCTCGTGGCCGTGGGGGTGCGGG - Exonic
1124424892 15:29555645-29555667 CCTGGCGCAGGTGGGGGATCTGG - Intronic
1124612066 15:31215747-31215769 GCTCGGGGCGGCGGGGGCCCGGG - Intergenic
1127041081 15:54977532-54977554 CACCGGGGCGGTGGGGGACAAGG - Intergenic
1127736020 15:61840076-61840098 GATGGTGGCGGTGGGGGACCTGG - Intergenic
1131269159 15:90935832-90935854 CCTCAGGGTGGTGGGGGATCGGG + Intronic
1131787765 15:95931589-95931611 TCTCCCGGCCGTGGGGGTCCAGG + Intergenic
1132804928 16:1771018-1771040 TCACGCGGGGGTGGGGGTCCCGG + Intronic
1132839849 16:1973711-1973733 CCTGCCGGCGGTGGGTGGCCAGG - Intronic
1132904135 16:2273566-2273588 CCTCGCGGTGGGGCGGGCCCAGG - Intergenic
1134452489 16:14372120-14372142 CTTCCCAACGGTGGGGGACCAGG + Intergenic
1136399795 16:30011068-30011090 CGGCGCGGCGGCGGGGGACGGGG + Exonic
1136539947 16:30923638-30923660 CAGCGCGGGGCTGGGGGACCAGG + Intronic
1137462751 16:48680266-48680288 CCTGTCGGGGGTGGGGGGCCAGG + Intergenic
1137500190 16:49004984-49005006 CCTCAAGGTGGTGGGGGACCAGG + Intergenic
1140926954 16:79592323-79592345 CCTAGCGGGGGTAGGGGACAGGG - Intronic
1141687318 16:85577770-85577792 CCCTGCTGGGGTGGGGGACCCGG - Intergenic
1142026964 16:87819621-87819643 CCTGGCGGCGGTGGGGGGGGGGG + Intergenic
1142335885 16:89489820-89489842 CCTGGGGGCCGTGGGGGCCCGGG - Intronic
1143013454 17:3879144-3879166 CCTGGCGTGGGTTGGGGACCAGG - Intronic
1144258734 17:13496682-13496704 CATCGTGGTGGTGCGGGACCCGG - Exonic
1144345418 17:14345142-14345164 CATCGTGGTGGTGCGGGACCCGG + Exonic
1146183100 17:30709532-30709554 CCTCGCGGCGGCGGAGGCTCGGG - Intergenic
1147400543 17:40177961-40177983 CCTGGAGGGGGTGGGGGACCCGG + Intronic
1148489371 17:48013221-48013243 CCTCGGGGCCTTGGGGTACCTGG + Intergenic
1148849833 17:50549196-50549218 CCTCCGGGAGTTGGGGGACCAGG + Intronic
1151304745 17:73256109-73256131 TCTGGGGGCGGAGGGGGACCTGG + Intronic
1152644529 17:81462725-81462747 CCACGCCGCTGTGGGGGACATGG - Exonic
1158241223 18:55380416-55380438 CCTGTCAGCGGTGGGGGACGAGG - Intronic
1160719084 19:589812-589834 CCTCGCGGCGGGGGAGGGGCGGG - Intergenic
1160768777 19:821356-821378 CCTCGGGGCGGGGCAGGACCGGG - Intronic
1160874272 19:1290000-1290022 CCTGGAGGCCGTGGGGTACCTGG + Intronic
1161421755 19:4179768-4179790 CCCCGTGGAGGTGGGGGCCCTGG + Intronic
1161475634 19:4483347-4483369 CCTCCCGGCGCGGGAGGACCAGG + Intronic
1162744167 19:12789794-12789816 CCAGGCGGCCGTGGGGGCCCCGG + Intronic
1162975694 19:14206236-14206258 CCTCGCGGCGGCGGAGGCTCGGG + Intergenic
1163389711 19:17022900-17022922 TCTCACGGTGGTGGGGGACGGGG - Intronic
1164452694 19:28380654-28380676 CCAGGTGGCGGTGGGGGACAGGG + Intergenic
1165822321 19:38684430-38684452 CCTGCAGGGGGTGGGGGACCAGG - Intronic
1166812424 19:45522399-45522421 CCTGGGGGTGGGGGGGGACCTGG - Exonic
1166914301 19:46184416-46184438 CCTGTCGGGGGTGGGGGACTGGG - Intergenic
1166986083 19:46660721-46660743 CCGGGCGGGGGTTGGGGACCCGG - Intronic
1167239342 19:48333958-48333980 CCTCGCGGGGGTGTGGCCCCTGG + Intronic
1167474062 19:49690118-49690140 GCCCGCGGTGCTGGGGGACCTGG - Exonic
1167819229 19:51910748-51910770 CCTGTCGGGGGTGGGGGACTAGG + Intronic
929787161 2:45001289-45001311 GGTCGCGGTGGTCGGGGACCAGG - Intergenic
932567185 2:72917527-72917549 CCTCGCAGCGCTGGGCGGCCGGG + Exonic
934566971 2:95346583-95346605 CGGCGCGGCGGCGGGGGTCCCGG - Intronic
937784238 2:125876657-125876679 CCTCTCGGGGGTGGGGGGCTAGG - Intergenic
938909901 2:135876338-135876360 CCTCGCGGCGGCAGCGGAGCCGG - Exonic
944165762 2:196718598-196718620 CCTCGAGGCTGTGGAGGACAGGG + Exonic
947765388 2:232634162-232634184 TCTCGGCGCGGTGGGGGACGGGG + Intronic
1171191853 20:23164517-23164539 TGTGGCGGCCGTGGGGGACCTGG + Intergenic
1172273410 20:33667137-33667159 CATCGCGGTGGTGGTGGACCAGG + Exonic
1172873080 20:38147858-38147880 GCTAGGCGCGGTGGGGGACCCGG - Intronic
1175539157 20:59737295-59737317 CCTCGCGTCTGTGGGGATCCTGG + Intronic
1175825456 20:61934228-61934250 CCTCTCGGCAGTGGGGGGCCCGG + Intronic
1179529749 21:42010458-42010480 CCTCGCGGCGCAGGGGGACGGGG + Intergenic
1182664129 22:31944902-31944924 CCTCCCGGCCATGGGCGACCCGG + Intronic
1184173617 22:42773350-42773372 CCTGGCAGCGGCGGGGAACCAGG + Intergenic
1184620469 22:45672388-45672410 ACTGGCTGCGGTGGGGGAGCGGG - Intronic
1185331384 22:50253480-50253502 CCTGGCGGGGGTGGGGGGGCGGG + Exonic
951522455 3:23622028-23622050 CCTCAAGGCAGTGGGGGATCTGG + Intergenic
951611274 3:24494897-24494919 CCTCCCGGCGGCGGGGTCCCGGG + Intronic
951939866 3:28065740-28065762 CCTCTCGGGGGTGGGGGGCTAGG + Intergenic
961700787 3:128743116-128743138 GCTGGCGGTGCTGGGGGACCCGG + Intronic
962694560 3:137935160-137935182 CCTGTCGGGGGTGGGGGACAAGG - Intergenic
967846201 3:194045148-194045170 CCTCCCGGGGGTGGGGGGCTGGG - Intergenic
968642780 4:1722619-1722641 CCTGGTGGTGGAGGGGGACCTGG - Intronic
968727064 4:2252674-2252696 CCTCCTGGGGGTGGGGGACGGGG - Intronic
971257882 4:25030719-25030741 CGGCGCGGCGGTGGGGGTCGGGG - Exonic
975476612 4:74830783-74830805 CCTGTCGGGGGTGGGGGGCCAGG + Intergenic
977573390 4:98653253-98653275 CCTTGGGGCGGTGGGGGAGGGGG - Intronic
984715107 4:182917617-182917639 CCTCGGGGCGGTCTGGCACCCGG - Intronic
985750000 5:1668204-1668226 TCTCGCGGCCGTGGGTGATCCGG + Intergenic
989269108 5:39511000-39511022 CCTGACGGGGGTGGAGGACCAGG + Intergenic
991026115 5:62031822-62031844 CCTGTCGGGGGTGGGGGACTAGG - Intergenic
994072771 5:95620614-95620636 CCGCGCGGCCACGGGGGACCTGG + Exonic
999362050 5:150993446-150993468 ACCTGCGGAGGTGGGGGACCAGG + Intergenic
1001257166 5:170192934-170192956 CCACCAGGCGGTGGGGGAGCCGG - Intergenic
1001438689 5:171721075-171721097 ACTCGCGGCTGTGGGGGAGGTGG - Intergenic
1006770301 6:36547422-36547444 CGTCTCCGCGGCGGGGGACCGGG - Exonic
1013366190 6:109440353-109440375 CCTCGAGGCGGCGGGGGTCGAGG - Intronic
1015162620 6:130170195-130170217 CCTGTTGGCGGTGGGGGACAAGG - Intronic
1018859432 6:167699840-167699862 CCTCGCGGTGGAGGGGACCCTGG + Intergenic
1019436489 7:1024937-1024959 CCCCGGGGCGCTGGGGGAGCAGG + Intronic
1020756648 7:12211451-12211473 CCTCGCTCCGGAAGGGGACCTGG - Intronic
1027103237 7:75389233-75389255 CCTTGCGGGGGTGGGGGAATTGG - Intergenic
1029712488 7:102307296-102307318 CCTGGCAGCGGTGTGGGGCCTGG - Intronic
1030632264 7:111908696-111908718 CCTGGGGGCGGTGGGGGGCAAGG - Intronic
1035313449 7:157983969-157983991 GCTCGCGGCGCTGGGTGAGCCGG - Intronic
1035827812 8:2663307-2663329 CCTGTTGGCGGTGGGGGACAAGG - Intergenic
1036897659 8:12648888-12648910 CCTGTCGGGGGTGGGGGACAAGG + Intergenic
1038568757 8:28641723-28641745 CCACGCGGCGGAGGGGGTCGGGG - Intronic
1039542526 8:38383055-38383077 CCCCGCGGCTGGGGGGCACCCGG - Intergenic
1045583412 8:103501519-103501541 CCCCGCGGAGGCGTGGGACCAGG - Intronic
1047736903 8:127773740-127773762 CCTGTCGGGGGTGGGGGACAAGG + Intergenic
1047739335 8:127794385-127794407 CCGGGCGGCGGGCGGGGACCTGG + Intergenic
1049647000 8:143739966-143739988 CCGCGCCGCTGTGGGTGACCGGG + Intergenic
1058105542 9:100967075-100967097 CCTGTCGGGGGTGGGGGACTAGG - Intergenic
1062357164 9:136170471-136170493 CCGCCCAGCGATGGGGGACCCGG + Intergenic
1062591705 9:137277434-137277456 CCTGGGGGAGGTGGGGGCCCTGG + Intergenic
1190114804 X:47619570-47619592 CCTCTCGGCAGTGGCGGTCCCGG + Exonic
1190633484 X:52411691-52411713 CCTTGCTGTGGTGGGGGGCCTGG - Intergenic
1192963698 X:76155446-76155468 CCTGTCGGGGGTGGGGGACAAGG + Intergenic
1198806952 X:140502873-140502895 CCTAGGGGCGGGGTGGGACCTGG - Intergenic
1200117052 X:153774026-153774048 CCTCGCGGCTGAGGGGTGCCAGG - Exonic