ID: 1082003700

View in Genome Browser
Species Human (GRCh38)
Location 11:47408537-47408559
Sequence CGCCGGGGGCGGCCCCGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 847
Summary {0: 1, 1: 0, 2: 9, 3: 92, 4: 745}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082003683_1082003700 30 Left 1082003683 11:47408484-47408506 CCGCGGCACGCGGCGCCTCGGGT 0: 1
1: 0
2: 0
3: 4
4: 66
Right 1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG 0: 1
1: 0
2: 9
3: 92
4: 745
1082003686_1082003700 15 Left 1082003686 11:47408499-47408521 CCTCGGGTTCCGGACAGGCCCCT 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG 0: 1
1: 0
2: 9
3: 92
4: 745
1082003687_1082003700 6 Left 1082003687 11:47408508-47408530 CCGGACAGGCCCCTTGTGACGTG 0: 1
1: 0
2: 0
3: 8
4: 77
Right 1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG 0: 1
1: 0
2: 9
3: 92
4: 745
1082003690_1082003700 -4 Left 1082003690 11:47408518-47408540 CCCTTGTGACGTGGCCGCGCGCC 0: 1
1: 0
2: 0
3: 0
4: 38
Right 1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG 0: 1
1: 0
2: 9
3: 92
4: 745
1082003689_1082003700 -3 Left 1082003689 11:47408517-47408539 CCCCTTGTGACGTGGCCGCGCGC 0: 1
1: 0
2: 0
3: 0
4: 15
Right 1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG 0: 1
1: 0
2: 9
3: 92
4: 745
1082003691_1082003700 -5 Left 1082003691 11:47408519-47408541 CCTTGTGACGTGGCCGCGCGCCG 0: 1
1: 0
2: 0
3: 3
4: 30
Right 1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG 0: 1
1: 0
2: 9
3: 92
4: 745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082003700 Original CRISPR CGCCGGGGGCGGCCCCGGGC CGG Intronic
900123760 1:1060434-1060456 CGCCGAGGGGGGCCGGGGGCAGG + Intergenic
900203155 1:1420238-1420260 CGCACTGGGCGGCCGCGGGCGGG - Exonic
900342246 1:2194691-2194713 CGCCGGAGGCCGCGCCCGGCGGG - Exonic
900382332 1:2391209-2391231 CGCGGGGGGCGACCCCCTGCAGG + Intronic
900564922 1:3327490-3327512 CAACGGCGGCGGCCCCGGGCAGG + Intronic
900629296 1:3625166-3625188 GGCGGGGGGCGGCCGGGGGCGGG + Exonic
900658777 1:3772742-3772764 CGCAGGGGCCGGGCCTGGGCAGG - Intergenic
901109905 1:6785802-6785824 CCCCGGGGGCGGGCTGGGGCCGG + Intronic
901132629 1:6971779-6971801 ACCCGGGGGCGGCCACAGGCAGG - Intronic
901433894 1:9234746-9234768 CGCCGCGCGCGCCCCCGGCCCGG + Intergenic
901602144 1:10430667-10430689 CGCGGGGGGCGCCCGGGGGCGGG - Intronic
902169582 1:14599120-14599142 CGGCGGCGGCGGCCCCGGCCCGG + Exonic
902500058 1:16904868-16904890 CGCCGGCTGCGGCACCGGGTTGG + Intronic
902896871 1:19485390-19485412 CTCCGGAGGGGCCCCCGGGCCGG + Intronic
902896954 1:19485601-19485623 CGTGGGGGGCGGGCCCGGGCCGG - Intergenic
902916750 1:19644298-19644320 CGCTGTCTGCGGCCCCGGGCGGG - Intronic
903324700 1:22563346-22563368 CGGCGGCGGTGGCCGCGGGCCGG + Intergenic
903573371 1:24322315-24322337 CGGCGGCGGCGGCCGCGGTCAGG - Intronic
903724635 1:25431329-25431351 CACCCGGGGCGGACCCCGGCGGG - Intronic
903822114 1:26111177-26111199 CGGCGGCGGCGGCGCGGGGCTGG - Intronic
904006595 1:27366328-27366350 CTGCGGGGGCGGCCGCGGCCGGG + Exonic
904049718 1:27631898-27631920 GGCCGGGGGCAGGCCAGGGCTGG + Intronic
904245093 1:29181832-29181854 CGGCGGCGGCGGCAACGGGCGGG + Exonic
904483295 1:30807393-30807415 GGCGGGCGGCGGCCCGGGGCGGG - Intergenic
904500132 1:30908544-30908566 CCCCGTGGGCGGCCCCGGCACGG + Exonic
904500204 1:30908795-30908817 CGCTGGGGGCGGCCCGGCGGCGG - Intergenic
904690827 1:32292235-32292257 CGGCGGGGGCGGGGCCAGGCCGG + Intronic
905075769 1:35269120-35269142 GGCGGGGCGCGGCCCGGGGCCGG + Intronic
905107883 1:35574814-35574836 CGCTTGGGGCGGCGACGGGCAGG - Intronic
905151449 1:35931085-35931107 CTTCCGGGGCGGCCCCGGGCAGG + Exonic
905182670 1:36176533-36176555 CGCCGGGGGCAGCCCCGCTCCGG + Exonic
905390847 1:37634583-37634605 CGACGGGGGCAGGCCCGGGAGGG + Exonic
905451591 1:38060394-38060416 CCCCCGGGGCTGCCCAGGGCAGG + Intergenic
905789842 1:40784077-40784099 GGCCATGGGCGGCGCCGGGCTGG - Exonic
905789867 1:40784132-40784154 CGCGGGGGGCGTCCCCGGGCGGG - Exonic
905876646 1:41435867-41435889 GGCAGGGGGCGGCACAGGGCAGG - Intergenic
906062534 1:42958184-42958206 CGCCGGGGCCGGGGCCGGGCCGG + Intronic
906140478 1:43531178-43531200 AGCTGGGGGCGGTCCCGGGGGGG + Intronic
906256520 1:44354974-44354996 GGGCGGGGGCGGCCCTGGGAAGG - Exonic
906805645 1:48776838-48776860 CGCCGGGGGCGGGCCCCGGTCGG + Exonic
907430090 1:54406487-54406509 ACGCGGGGGCGGGCCCGGGCCGG + Intronic
907442568 1:54488256-54488278 CGCCTGGGGCGGCGCTGGGGGGG + Intergenic
910138436 1:83999225-83999247 CGCCGGGGGCGGCGACGGTTGGG + Intergenic
911116018 1:94247509-94247531 CGGCGGTGGTGGCTCCGGGCTGG - Intronic
912381322 1:109249662-109249684 CGCCGGGGCCGGGCCGGGGTCGG + Intergenic
912413624 1:109494026-109494048 TGCCGGCGGCGTCCCCGGGGAGG + Intergenic
914815710 1:151060477-151060499 CTCCGGGGTCTGCGCCGGGCTGG - Exonic
914993094 1:152515457-152515479 CGCCGGGGTGGGCGCCGGGGCGG - Exonic
915246274 1:154558442-154558464 CCCAGGGGGGGGCCCGGGGCCGG - Exonic
915246281 1:154558454-154558476 GGCCGGGGGCGGCCCAGGGGGGG - Exonic
915348337 1:155209179-155209201 GGCGGGGGGCGGGCCCAGGCAGG + Exonic
915544924 1:156591761-156591783 CGCCGGGGCCGGGCCGGGCCGGG + Exonic
915552246 1:156642035-156642057 GGGCGGGGGCGGCCCCGGGGAGG + Exonic
915616975 1:157046174-157046196 GGCCGGGGTCGCCCGCGGGCCGG - Intergenic
916048896 1:161021176-161021198 CGCGGAGGGCGGGGCCGGGCGGG - Exonic
916106997 1:161440269-161440291 CGCTGGTGGGAGCCCCGGGCCGG - Intergenic
916108558 1:161447683-161447705 CGCTGGTGGGAGCCCCGGGCCGG - Intergenic
916110146 1:161455064-161455086 CGCTGGTGGGAGCCCCGGGCCGG - Intergenic
916111731 1:161462474-161462496 CGCTGGTGGGAGCCCCGGGCCGG - Intergenic
916113318 1:161469855-161469877 CGCTGGTGGGAGCCCCGGGCCGG - Intergenic
916694470 1:167221539-167221561 CCCCGGGAGCGGGCCCGGGCGGG + Intronic
917974281 1:180229480-180229502 CGCGGCGGGCGGCGCCGGCCCGG - Intergenic
919829620 1:201531400-201531422 TGTCGGGGGCAGGCCCGGGCAGG - Intergenic
920022656 1:202967286-202967308 GGCCGGGGGCGGGGCCGGGCAGG + Intergenic
920367817 1:205457260-205457282 CGCCGTCGGCGGCGCCGGGCTGG + Intergenic
920886847 1:209938043-209938065 TGCCAGCGGCGGCCCCGGGAAGG + Intergenic
921355563 1:214281437-214281459 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
921432798 1:215083015-215083037 CGGCGGCGGCGGCGGCGGGCAGG + Intronic
922315056 1:224434619-224434641 CGCCGGGGGGCGCCGCGGGGCGG + Intronic
922460277 1:225810242-225810264 CGCCGGGGTGGGCGGCGGGCCGG + Intronic
922526494 1:226308678-226308700 GGCCGGGGGAGGGCTCGGGCTGG - Intronic
923551795 1:234970109-234970131 CGCAGGGGGCGGACGCCGGCGGG + Intergenic
923631162 1:235650112-235650134 CGGGGGGCGCGGGCCCGGGCTGG - Intronic
924502801 1:244652995-244653017 CCCCGGGGGCGGGGCCGGCCCGG - Exonic
1063417914 10:5889249-5889271 GGCCGGGGGCTGCCCGGGGCCGG - Exonic
1064483946 10:15766169-15766191 CACCGCGCCCGGCCCCGGGCAGG + Intergenic
1065177773 10:23095689-23095711 CGGCGGGCCCGGCACCGGGCCGG + Exonic
1066464226 10:35639497-35639519 CGCGGGGGGTGGCGGCGGGCCGG - Exonic
1067806288 10:49395575-49395597 CGCCGGGTGCGCCCTAGGGCTGG - Intronic
1067946040 10:50688492-50688514 CGGCTGGGGTGGCCCCTGGCAGG + Intergenic
1069819268 10:71217530-71217552 CGGCTGAGGCGGCTCCGGGCCGG - Intronic
1070103896 10:73414061-73414083 AGCCGGGGGCGGGCCCAGGGTGG + Exonic
1070198104 10:74177195-74177217 CCCCGGGGGCGGCCCAGGGCCGG + Intronic
1070881352 10:79853492-79853514 CGGCTGGGGTGGCCCCTGGCAGG + Intergenic
1071647928 10:87369808-87369830 CGGCTGGGGTGGCCCCTGGCAGG + Intronic
1071997448 10:91162625-91162647 CCGCGGCGGCTGCCCCGGGCGGG - Intergenic
1073241962 10:102065195-102065217 CGCCGAGAGCGTGCCCGGGCGGG + Intergenic
1073266391 10:102230747-102230769 GGGCGGGGGCCCCCCCGGGCTGG - Exonic
1073297653 10:102450814-102450836 TGCCGGCGGCGGCGCAGGGCCGG + Exonic
1073491514 10:103855802-103855824 CGCGGGGAGGGGCTCCGGGCCGG + Intergenic
1073812352 10:107164655-107164677 GGGCGGAGGCGGCGCCGGGCAGG + Intergenic
1074130390 10:110568164-110568186 CCGCCGGGGCGGCCGCGGGCGGG + Intronic
1074130421 10:110568259-110568281 CCCCAGGGCCGCCCCCGGGCCGG - Intronic
1074165835 10:110872545-110872567 TTCCGGGGGCCGACCCGGGCTGG + Intronic
1074546362 10:114404615-114404637 CGCTGGGGGCGAGCCCTGGCGGG - Intronic
1074618697 10:115094217-115094239 CTCCCGGGGCGCCCCGGGGCTGG - Intronic
1074815138 10:117137164-117137186 TGGCTGGGGCGGCGCCGGGCCGG + Intronic
1075144568 10:119872493-119872515 CGCCGGGGGGCGGGCCGGGCGGG - Intronic
1075802306 10:125160796-125160818 GGCGCGGGGCGGGCCCGGGCCGG - Intronic
1076035646 10:127196613-127196635 GGGCGGGGGCGGCGCGGGGCCGG + Intronic
1076678025 10:132158088-132158110 TGCCGGGGGCGGGGCGGGGCGGG - Intronic
1076683512 10:132186870-132186892 TGCCGGGGGCGGAGCCGGGGTGG + Intergenic
1076792514 10:132784857-132784879 ATCCGGGGGCGGCCCCGGGTGGG - Exonic
1076805784 10:132858272-132858294 TGCTGGGGGCGGCCCCAGGTTGG + Intronic
1076991747 11:279323-279345 CGCGAGGCGCGGCCCCGTGCTGG - Exonic
1077040418 11:518748-518770 CGTCGTGGGCAGCCCGGGGCCGG - Intergenic
1077043640 11:535225-535247 CGTCGGGGGCTGCGGCGGGCGGG - Intronic
1077051346 11:568360-568382 AGCCGGCGACGGCCCCGCGCCGG - Intergenic
1077076908 11:706158-706180 CGGCGGGGCCGGGCCGGGGCGGG - Exonic
1077090837 11:777540-777562 GGCCGGGGGCGGAGCCGGGTGGG + Intergenic
1077227593 11:1445158-1445180 CGCAGGAGGCCTCCCCGGGCTGG + Intronic
1077269101 11:1666645-1666667 CGGATGGGGCCGCCCCGGGCTGG + Intergenic
1077271446 11:1684069-1684091 CGGATGGGGCCGCCCCGGGCTGG - Intergenic
1077332880 11:1991034-1991056 CGCGGGGAGCGGCGCGGGGCTGG - Intergenic
1077341381 11:2027893-2027915 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1077491504 11:2862926-2862948 CGGCGGGCGCGGGCCCGGGGCGG + Intergenic
1077495894 11:2886262-2886284 CGCCGGGGTCCGGACCGGGCCGG - Intergenic
1077635886 11:3841060-3841082 GGCTGGGGGCGGGCCGGGGCTGG - Intergenic
1078057556 11:8019709-8019731 GGCCGGGGTGGGCCCCTGGCGGG + Intronic
1078222699 11:9364653-9364675 CGGCGGGGGCCGCACGGGGCTGG + Intergenic
1078660059 11:13278596-13278618 GGCTGGGGTCGGCCCCGTGCCGG - Intronic
1078801159 11:14644641-14644663 CCCCGGAGGCGGCAGCGGGCAGG + Exonic
1079122514 11:17695906-17695928 GGCCGGGGCCGGGGCCGGGCCGG + Intergenic
1080584378 11:33667976-33667998 CGCCGGGGCCTGCTCCAGGCTGG - Exonic
1080836262 11:35943959-35943981 CCCCGGGCCCGGCCCCGGCCCGG - Intronic
1081488045 11:43547085-43547107 CCCCGGGGGCGGACACGTGCTGG + Intergenic
1081705610 11:45180755-45180777 CGGCCGGGGCGGGCGCGGGCGGG - Intronic
1081831910 11:46121536-46121558 CGGCGGCGGCGGCGGCGGGCCGG - Intergenic
1082003700 11:47408537-47408559 CGCCGGGGGCGGCCCCGGGCCGG + Intronic
1083457171 11:62786942-62786964 CGGCGGAGGCGGCCCCGCGTCGG + Exonic
1083560672 11:63671049-63671071 GGCCGGGGGCGGCCGCCGTCAGG - Intronic
1083572822 11:63769154-63769176 GGCGGGAGGCAGCCCCGGGCAGG - Intergenic
1083628822 11:64085567-64085589 GGCCTGGGGTGGACCCGGGCGGG - Intronic
1083656982 11:64234565-64234587 CGGCGGGGGCGGCGGGGGGCTGG - Exonic
1084000946 11:66295218-66295240 CGCTGGGCACGGCCCCCGGCGGG - Exonic
1084072393 11:66744828-66744850 CGGCGGCGGCGGCGGCGGGCGGG + Intronic
1084146171 11:67266496-67266518 AGCCGGGGCCGGGCCCGAGCCGG + Exonic
1084171222 11:67401872-67401894 GGCCGGGGGCGGACTGGGGCGGG - Intronic
1084181961 11:67451326-67451348 CGCCCGGGGCCGCCTCTGGCGGG + Exonic
1084575672 11:69986432-69986454 GGCTGGGGGCGCCGCCGGGCAGG + Intergenic
1084839266 11:71831588-71831610 CCCCGGGGGCAGCCCCCGCCCGG + Intergenic
1084946683 11:72642473-72642495 GGCGGGGGGCGGGCCGGGGCGGG - Intronic
1085332915 11:75668067-75668089 AGCCGGCGGCGGGCCCCGGCCGG - Exonic
1087014638 11:93543275-93543297 CGGCGGCGGCGCCCGCGGGCAGG - Exonic
1087117996 11:94544528-94544550 CGCCGACGGCGGCGGCGGGCGGG + Exonic
1088686744 11:112290214-112290236 GGACGCGGGCGGCTCCGGGCGGG + Intergenic
1089564560 11:119363950-119363972 CGGCGGGGGGGTCCTCGGGCAGG + Intronic
1089729449 11:120511495-120511517 CGGCGGGGGCTGCTGCGGGCAGG - Intergenic
1090788398 11:130069686-130069708 GGCCGGGGGCGGGGCCGGGCGGG + Intergenic
1091263723 11:134253933-134253955 GGCCGGAGGAGGACCCGGGCAGG - Intronic
1091276957 11:134359169-134359191 GGCTGGCGGCGGCCCTGGGCTGG + Intronic
1202815863 11_KI270721v1_random:46210-46232 CGCGGGGAGCGGCGCGGGGCTGG - Intergenic
1202824366 11_KI270721v1_random:83082-83104 TGCAGGGGGCGGCCCGGGCCAGG - Intergenic
1092230615 12:6773700-6773722 GGCCGGGGGCGGCAGCGGGCGGG - Exonic
1092861904 12:12725655-12725677 GGCGGGGAGGGGCCCCGGGCGGG - Intergenic
1094107974 12:26833316-26833338 GGCCGGGGGCGGAGCTGGGCCGG + Intergenic
1094703935 12:32896839-32896861 CGCGGGGGGCGGGCCAGGGGCGG - Intronic
1095349062 12:41188373-41188395 CCCCGGGGGTGGCCCGGGGAAGG + Intergenic
1095773633 12:45990083-45990105 AGGCGGCGGCGGCCCAGGGCCGG + Intronic
1095949276 12:47773168-47773190 CGCTGGGGGCGGGCCGGGGGCGG + Intronic
1096078486 12:48818878-48818900 CGCCGGGGGCGGGAGCGGCCCGG - Exonic
1096241286 12:49961666-49961688 GGCCGGCGGCTGCCCCGGCCGGG + Intergenic
1096260230 12:50085575-50085597 GGCCGGGGGCGGGGCCGAGCGGG + Intronic
1096475700 12:51907563-51907585 GTCCGGGCGCGGCCCCGGACCGG - Exonic
1096647699 12:53047489-53047511 CGCGGGGCGCGGCCCAGGGCTGG + Intronic
1096796757 12:54082596-54082618 GGCCGGGGCCGGGGCCGGGCTGG + Intergenic
1097107694 12:56635028-56635050 CGCCGCCGCCGGCCCAGGGCTGG - Intronic
1097981713 12:65742446-65742468 GGCCGGGGGCGCTCCCCGGCGGG + Intergenic
1097990260 12:65825591-65825613 CGCGGCGGGCGGCCCGGGGAAGG + Intronic
1097990373 12:65826013-65826035 CGCCGGAGGGAGCCCGGGGCAGG + Intronic
1098161432 12:67649953-67649975 CGCCCGGGCCGCCCGCGGGCTGG - Intronic
1098426112 12:70366680-70366702 CGCCGGGGGCGGGAGGGGGCGGG + Exonic
1101371958 12:104138335-104138357 GGCCGGGGGCGGGGCGGGGCGGG - Intergenic
1101371970 12:104138352-104138374 GGCCGGGGGCGGGGCGGGGCCGG - Intergenic
1102046606 12:109833458-109833480 GGCCGGGGGCGGCGCGCGGCTGG - Intergenic
1102197408 12:111034851-111034873 CGGCGGCGGCGGCCCCCGGGTGG - Intronic
1103074206 12:117969093-117969115 CGCCGGGGCCGGGGCCCGGCTGG - Intergenic
1103348359 12:120265778-120265800 CACAGGGGGCGGCCGGGGGCGGG - Intergenic
1103509857 12:121466999-121467021 GGCCGGGGCCGGGCCCGAGCGGG - Intronic
1103527655 12:121578769-121578791 CGCAGAGGGCGGCCCGGGGTGGG + Intronic
1103565268 12:121812133-121812155 AGCAGGGGGCGCCCGCGGGCCGG - Intronic
1103764607 12:123271479-123271501 CGCCCCGGGCATCCCCGGGCCGG + Intronic
1104376262 12:128267331-128267353 GGCCGGCGGGGGCCGCGGGCGGG + Intergenic
1104686225 12:130786911-130786933 CGCCGGGGGTGGCCTAGCGCCGG + Intergenic
1104901094 12:132189884-132189906 GGCCGGGGGAGGCGCCGGGGAGG - Intergenic
1104929212 12:132329391-132329413 CGCAGAGGGCTGCCCGGGGCTGG + Intergenic
1105472083 13:20703768-20703790 CGCGCGGGCCGGCGCCGGGCTGG + Intronic
1105512302 13:21061139-21061161 GGGCGGGGGCGGCTCCGGGCGGG + Intronic
1106269432 13:28138953-28138975 CGCCGGGAGCCGTCGCGGGCGGG + Exonic
1108518276 13:51222578-51222600 CGCCGGGCCGGGCCGCGGGCGGG + Intronic
1110558395 13:76885723-76885745 CGAGGGCGGCGGCCCCGGGCCGG + Exonic
1111396305 13:87672635-87672657 CCGCGGCGGCGGCCCCAGGCTGG + Exonic
1112216256 13:97434108-97434130 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1112344286 13:98577149-98577171 CGCGGGGGCCGGGCCGGGGCGGG - Intronic
1113312045 13:109141011-109141033 CGCGGGGGGCGGCCCGGGCGGGG - Exonic
1113517693 13:110915486-110915508 CGCCTGGGGCGGCCGGGGGCGGG + Intergenic
1113517697 13:110915496-110915518 GGCCGGGGGCGGGGCCTGGCTGG + Intergenic
1113541871 13:111115446-111115468 CGGCGGCGGGGGCCGCGGGCCGG + Exonic
1113610949 13:111644883-111644905 CGGGAGGGGCGGCCCCAGGCTGG + Intronic
1113660658 13:112104690-112104712 CGCAGGGAGCGACCCCGGGAGGG + Intergenic
1113759648 13:112838487-112838509 CGGCAGGGGCGGCTCCGGGGTGG - Intronic
1113784843 13:112997024-112997046 AGGCGAGGGCGGCCCGGGGCTGG - Intronic
1113795025 13:113051818-113051840 CAGCGGGGGCAGCCCTGGGCTGG - Intronic
1114269221 14:21091016-21091038 CTCCGGGGGTGGCCCGGGGCCGG + Exonic
1114484887 14:23056665-23056687 CACCGGGGGCAGTTCCGGGCAGG + Intronic
1114516170 14:23301628-23301650 CGGCGGGGGCGGGGCCGGACCGG + Exonic
1114674238 14:24430206-24430228 CGCGGTGGGCGGGCCCGGCCCGG + Intronic
1114736704 14:25049945-25049967 CCCGGGGGGCTGCCCCGCGCGGG + Exonic
1115120065 14:29927866-29927888 CGCCGGGCGGGGGCCGGGGCGGG + Intronic
1115556141 14:34546460-34546482 CGCCGGGGACGACCCCGGCAAGG + Intergenic
1115557767 14:34556621-34556643 CGCCGGGGACGACCCCGGCAAGG - Intergenic
1116657861 14:47674415-47674437 CGCCGGGAGGGGCCCCGGAACGG + Intronic
1116657979 14:47675013-47675035 GGCCGGCGGCGGGCGCGGGCAGG + Intergenic
1117183597 14:53217564-53217586 AGCAGGGGGCGGCGCCGGTCGGG + Intergenic
1117353548 14:54902806-54902828 AGCCGGGAGCGGCCACAGGCTGG + Exonic
1117424614 14:55580806-55580828 CTCCGGCGGCGTCCCCGGGCCGG + Intronic
1118350934 14:64972155-64972177 CGCCCGCAGCGTCCCCGGGCGGG - Exonic
1119003989 14:70907827-70907849 CGACGGCGGCGGCGCCGGGTGGG + Exonic
1119519697 14:75277096-75277118 CGACGGGAGCGGCCGCGGCCGGG + Intergenic
1119622125 14:76138967-76138989 CGCGGGGGGCGGCGCGGCGCCGG + Intergenic
1120167851 14:81220239-81220261 GGCCTGGGGCCGCCGCGGGCCGG - Intronic
1122081622 14:99271042-99271064 CGCCGGGGCCGCCCGCTGGCTGG - Intronic
1122145108 14:99684262-99684284 CGGCGGGGGCGGAGCCGAGCGGG + Intergenic
1122689177 14:103523378-103523400 CACCGCGGGTGCCCCCGGGCTGG - Intergenic
1122779906 14:104139159-104139181 CGCCGGGGCCGGCCCAGAGCAGG + Exonic
1122788626 14:104175243-104175265 GGCCGGTGGCGGCTCAGGGCAGG - Exonic
1122791225 14:104185034-104185056 AGCCGGGGGCGGCCCTGGTGGGG - Intergenic
1122797612 14:104213875-104213897 CGCCTGGGGCCACCACGGGCCGG - Intergenic
1122866125 14:104604775-104604797 CGCGGGAGGCTGCGCCGGGCGGG + Exonic
1122889009 14:104724142-104724164 GGCCGGGGGAGGGCCAGGGCGGG - Intergenic
1122941988 14:104985650-104985672 CAGCGGAGGCGGCCCGGGGCAGG + Intergenic
1122959390 14:105087555-105087577 CGGCGGGGCAGGCTCCGGGCAGG + Intergenic
1122975290 14:105168436-105168458 CGGCGGCGGCGGGGCCGGGCGGG - Exonic
1124392188 15:29269477-29269499 CGGCGGGGGCGGCCTGGGCCCGG + Exonic
1124410575 15:29433103-29433125 CGTCGGGGGCTGGCCCAGGCAGG - Intronic
1124427019 15:29570864-29570886 CGCCGGGAGCGGGCCGGGCCGGG + Intergenic
1124652357 15:31483419-31483441 CGGCCGTGGCGGCCCGGGGCCGG - Exonic
1125664132 15:41417024-41417046 CGTCGGGGGCGGGGCAGGGCGGG + Intronic
1126852663 15:52806417-52806439 GGCCGGGTGGGGCCCCGGACTGG - Intergenic
1127293672 15:57591869-57591891 GGCCGGGGGCGGGGCCGGGCCGG - Intergenic
1128841468 15:70854229-70854251 CGGCGGCGGCGGCGCGGGGCGGG - Intronic
1129144246 15:73633092-73633114 CGCCGGGGGCGGGCCGGGCGGGG - Intronic
1129330872 15:74826540-74826562 AGGTGGGGGCGGGCCCGGGCGGG + Exonic
1129387010 15:75201867-75201889 CGCCGTCTGCGGTCCCGGGCGGG - Intronic
1129675973 15:77632626-77632648 CGGCGGCGGCGGCTCCGGGCCGG - Intronic
1129845044 15:78764270-78764292 GGCCAGGGGCTGCCACGGGCTGG + Intronic
1130002549 15:80059900-80059922 CGCCGGGAGGGGCCGGGGGCGGG - Intronic
1130352920 15:83107489-83107511 CGCGGGGGACGGCTGCGGGCTGG + Exonic
1130517193 15:84634235-84634257 CGCCTCGCGCGTCCCCGGGCCGG + Intergenic
1131171933 15:90184971-90184993 CCCCAGGGGCTGCGCCGGGCCGG + Intronic
1132499876 16:280555-280577 CGCGGGGGGCGCTCCCGGCCGGG + Intronic
1132555319 16:569662-569684 TGACGGGGGCGGGACCGGGCTGG + Intronic
1132604575 16:788411-788433 GGCCGGGGGCGGGCCGGGGGGGG - Intergenic
1132604583 16:788422-788444 CGGCGGGGGCGGGCCGGGGGCGG - Intergenic
1132656689 16:1044472-1044494 CCCCCCAGGCGGCCCCGGGCGGG - Intergenic
1132675710 16:1120506-1120528 CGCCGGCTGCAGCCCCTGGCCGG - Intergenic
1132728998 16:1351551-1351573 CGGCGAGGGCGGCCCGGGCCCGG - Exonic
1132779359 16:1614322-1614344 GGCCGGGGCCGGGGCCGGGCAGG + Intronic
1132842303 16:1984091-1984113 CGCGGGGGCCGGGCCCGAGCCGG - Intronic
1132889442 16:2196630-2196652 GGCGGGGGGCGGCCCGGGGGCGG + Intergenic
1132925970 16:2429318-2429340 CGGCGGCGGCCCCCCCGGGCAGG + Intergenic
1132991588 16:2798417-2798439 CCCAGGGGGCGACCCCGGTCCGG + Intergenic
1133121564 16:3611707-3611729 CGCCGGGCGCGGGCCCGCGGCGG + Intronic
1133156447 16:3880130-3880152 CGGCGGCGGCGGCCGGGGGCGGG - Exonic
1133286669 16:4693912-4693934 CGGCGCGGGCGGGCCCGGGCGGG + Intronic
1133784372 16:8963420-8963442 CGGCGACGGCGGCCCCGGGGCGG + Exonic
1133802101 16:9092310-9092332 GGCCGGGGCCGGGCCCGGGCGGG - Intronic
1134149716 16:11796632-11796654 CGCGGGGTGCAGCCCTGGGCCGG - Intronic
1134163839 16:11915186-11915208 CGCCGCGGGCCGCCCCGCGAAGG + Intronic
1134290881 16:12902199-12902221 CTCCGGAGGCGGCCCCGGAGCGG - Exonic
1136129607 16:28211662-28211684 CGCGGGGGTCGGGCCCGGGCGGG - Exonic
1136237761 16:28925102-28925124 CGGCGGCGGCGGCCGGGGGCTGG - Exonic
1136261825 16:29082401-29082423 CGCCGGGCGCGGCGCTGGGAAGG - Intergenic
1136402282 16:30025201-30025223 GGCCGGGGGCGGCCGGGAGCGGG + Exonic
1137056590 16:35749129-35749151 CGCCGGGGGTGACCAGGGGCTGG + Intergenic
1137426375 16:48384842-48384864 CGCCGGGCGCCACCCCCGGCCGG + Intronic
1137580645 16:49631610-49631632 TGCAGAGGGGGGCCCCGGGCAGG + Intronic
1138360690 16:56425195-56425217 CGCCGGGGCCGGCCTCGGGCTGG + Exonic
1139528571 16:67530533-67530555 CGGTCGGGGCGGCCCCGGGGTGG + Intronic
1139776251 16:69318786-69318808 GGCCGGGCCCGGGCCCGGGCCGG + Intronic
1140046190 16:71441861-71441883 CTCCGCGGGCGGCCCCAGCCTGG + Intergenic
1140223113 16:73058195-73058217 CGGCGGCGGCGGCGCGGGGCCGG + Intronic
1141231438 16:82170734-82170756 CGGCGGGGGCCGCCCCAGGCAGG + Intergenic
1141638622 16:85328815-85328837 CACCGCGGGAGGCCCCGGGGCGG - Intergenic
1142150373 16:88509995-88510017 CCCAGGGGGCAGCCCTGGGCTGG + Intronic
1142163338 16:88570634-88570656 CGGCGGCGGCGGCCGCGGGAGGG + Intronic
1142231529 16:88902351-88902373 CGCTGGGCGCAGCCCCCGGCAGG + Intronic
1142240144 16:88941257-88941279 GGCCGGAGACCGCCCCGGGCGGG - Intronic
1142275526 16:89116767-89116789 CGCGGGAGCCGGCCCAGGGCAGG - Intronic
1142293018 16:89201349-89201371 CGCGGGGCGCGGGCCCGGGGCGG + Intronic
1142671972 17:1491614-1491636 CGGCGCGGGCGGGGCCGGGCTGG + Intronic
1142799711 17:2337553-2337575 CGGCGGCGGCGGCGGCGGGCCGG + Exonic
1143112186 17:4558951-4558973 AGCCGCGGGCAGCCCCAGGCCGG + Exonic
1143148332 17:4790423-4790445 CGGCGAGGGCCGCCCCCGGCAGG + Intergenic
1143376467 17:6470442-6470464 CCTCGGGTGAGGCCCCGGGCCGG - Intronic
1143479460 17:7220138-7220160 CTCCTGGGGCAGCCCCGGCCCGG + Exonic
1143513577 17:7408327-7408349 CGCCCCGGGCGGCCCCGGCCTGG + Exonic
1143747189 17:9003306-9003328 TGGCGGGGGTGGCCGCGGGCCGG + Intergenic
1143750507 17:9023419-9023441 CGGCGGGTGGGGCCGCGGGCGGG + Intronic
1143830207 17:9645388-9645410 CAGCGGGGGCGGCACCAGGCAGG + Intronic
1144854156 17:18258744-18258766 CGCTGGGGGGAGCCGCGGGCTGG + Exonic
1145243537 17:21253085-21253107 CGCCGGGGCCGCCCCCTTGCTGG - Intronic
1146022602 17:29292831-29292853 GGCGGCGCGCGGCCCCGGGCGGG - Intronic
1146492356 17:33292138-33292160 CAGCGGCGGCGGCCCCGGCCGGG + Exonic
1146492383 17:33292272-33292294 CGGCAGCGGCGGCGCCGGGCGGG - Exonic
1147123710 17:38351958-38351980 CTCCGGGGGCCGCGGCGGGCGGG + Intergenic
1147285687 17:39401408-39401430 CGGCGGGTGCGGCCCGGGCCGGG + Exonic
1147339580 17:39745622-39745644 GGCGGGGGGAGGCCCCTGGCTGG + Intronic
1147393344 17:40122861-40122883 GCCCGGGGGCCGCCCCGGCCGGG - Intronic
1147931419 17:43983839-43983861 CGCCTGGGGAGGACCCGGGGAGG - Intronic
1147966943 17:44199088-44199110 CGCCGGGGCCGGCGCCGGGCCGG + Intronic
1147971162 17:44219705-44219727 GGCCGGGGCCGGCGGCGGGCGGG - Intronic
1148079545 17:44960130-44960152 CGCCGGGGTCCCCTCCGGGCGGG - Exonic
1148603069 17:48908643-48908665 CGGCGGCGGCGGCAGCGGGCGGG + Exonic
1148782451 17:50129622-50129644 GGCCGCGGGGGGCTCCGGGCGGG + Exonic
1148852450 17:50561540-50561562 GGCCGGGGGCCGGCCGGGGCCGG + Exonic
1150284592 17:63947778-63947800 CTCTGGGGGTGGCCTCGGGCAGG + Intronic
1150311025 17:64129799-64129821 CGTAGGAGGCGGCACCGGGCCGG - Intronic
1150489015 17:65561705-65561727 CGGCGGGGGCGGGCCGGGGCGGG - Intronic
1150782733 17:68135736-68135758 CGCCGGGGCGGGCGCCGAGCTGG - Intergenic
1151357953 17:73571524-73571546 CGCCCGGGGGGCCACCGGGCTGG - Intronic
1151558697 17:74859897-74859919 CGGCGGCGGCGGCTCCGGGCGGG + Intronic
1151724944 17:75878275-75878297 CCCCGGGTCCGGCCCCGGCCCGG - Exonic
1151730912 17:75910537-75910559 AGGCAGGGGCTGCCCCGGGCTGG + Exonic
1151747865 17:76021451-76021473 CGCCGGGTGAGCCCTCGGGCAGG - Exonic
1151983102 17:77526082-77526104 CGACGGGGGCTGCCCCCTGCTGG - Intergenic
1152183527 17:78840325-78840347 GGGCGGGTGCGGCCCCGGGGCGG - Intronic
1152426295 17:80220416-80220438 CGCCGGGGACAGGCCGGGGCGGG - Exonic
1152433101 17:80260503-80260525 CGCCGCCGCCGGCCCCGCGCAGG - Intergenic
1152433105 17:80260512-80260534 GGCCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433119 17:80260542-80260564 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433132 17:80260572-80260594 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433145 17:80260602-80260624 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433158 17:80260632-80260654 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433171 17:80260662-80260684 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433184 17:80260692-80260714 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433197 17:80260722-80260744 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433210 17:80260752-80260774 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433223 17:80260782-80260804 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152433236 17:80260812-80260834 CGGCGGCGGCGGCGGCGGGCAGG + Intergenic
1152584051 17:81181345-81181367 GGCGGGGGGCCGCGCCGGGCGGG - Intergenic
1152584454 17:81182778-81182800 GGCCGGGGGCGGCCCCACGCTGG - Intergenic
1152729165 17:81961386-81961408 CGCCGGAGGCGCTCCCGGCCCGG + Intronic
1152790024 17:82273744-82273766 CTCCAGGGGCGGGGCCGGGCGGG + Intergenic
1152870833 17:82752214-82752236 GGCCGCGGGCGGCCCCGAGGAGG + Exonic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1153794495 18:8609757-8609779 GGCCGGGGGCGGCGGCGGTCTGG + Exonic
1153900463 18:9614098-9614120 GGGCGAGGGCGGCCCCAGGCGGG - Intronic
1155392722 18:25352309-25352331 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1156008626 18:32471141-32471163 CTCCGGGGACGGGCCTGGGCGGG - Intergenic
1156099604 18:33578316-33578338 GGGCGGGGGCGGCGCCGGCCGGG - Intergenic
1158954063 18:62523292-62523314 CGCCGGGGGAGGGCCGGGGCCGG - Exonic
1158954437 18:62524650-62524672 CTCCGAGAGGGGCCCCGGGCGGG - Intronic
1158976708 18:62716475-62716497 CCCCGAGGCCGGCCCCCGGCTGG + Exonic
1159045555 18:63366575-63366597 TGCGGCGCGCGGCCCCGGGCGGG - Intronic
1159586598 18:70288835-70288857 GGCCGGGGGCCGCGCGGGGCGGG - Intergenic
1160024879 18:75209094-75209116 GGCCGGGGTCGGCCCCCGCCCGG + Exonic
1160321516 18:77900316-77900338 CGCGGGAGGCGGCCACGCGCGGG + Intergenic
1160452085 18:78973271-78973293 CGCAGGGGGCGTCCCCGCGTCGG + Intergenic
1160506258 18:79428141-79428163 TGCGGGGGCCGGCCTCGGGCCGG + Intronic
1160506452 18:79429539-79429561 CGCCTGGGGCAGCCTCGGGCAGG - Intronic
1160543571 18:79638466-79638488 CGCCGGGGTCCGCGCCGGGTGGG + Intergenic
1160567857 18:79798208-79798230 GGGCGGGGGCGGCTCGGGGCCGG + Intergenic
1160719164 19:589998-590020 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1160747633 19:719461-719483 CGCCGGGGTGGGCGTCGGGCGGG + Intronic
1160766023 19:808458-808480 AGGCCGGGGCGGCCCCGGGGTGG + Intronic
1160766780 19:812392-812414 CGCCAGGTGGGGCCACGGGCGGG + Intergenic
1160789740 19:917932-917954 CAGCGCGGGCGGGCCCGGGCGGG + Intronic
1160792578 19:929443-929465 CGGCGGGGGCGGCCCCTGCGGGG - Exonic
1160792644 19:929639-929661 CGTCGGGGGCAGCCCGGGCCCGG - Exonic
1160823020 19:1067113-1067135 CGGGGGGCGCGGCCCGGGGCTGG + Intronic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1161068858 19:2250711-2250733 GGCCTGGCGCGGCTCCGGGCTGG + Exonic
1161086997 19:2339963-2339985 CTCGGTGCGCGGCCCCGGGCGGG + Exonic
1161175806 19:2841662-2841684 CGCGGGGGGCGGCCCCGGCGAGG + Intronic
1161175826 19:2841718-2841740 CGCGGGAGGCGGGGCCGGGCGGG - Intronic
1161386763 19:3998781-3998803 GGCCGGGGGCAGCCCCCGCCCGG + Intergenic
1161393989 19:4035103-4035125 CGCCTGGGGCGGCCCTGGCACGG + Intronic
1161703057 19:5805312-5805334 CGGAGGGGGCGGCCGCGGGCGGG - Intergenic
1161703071 19:5805332-5805354 TGCCCGGGGGGGGCCCGGGCCGG - Intergenic
1161802663 19:6424605-6424627 CGCCGGGGGAGGCCCTCCGCCGG - Exonic
1162471018 19:10871972-10871994 CGCCGGCCCCCGCCCCGGGCCGG - Intronic
1162489571 19:10984285-10984307 TGCTGAGGGCGGCCCTGGGCTGG - Exonic
1162552117 19:11363844-11363866 GGCCGGGGGCTGCTCCCGGCTGG + Intronic
1162909833 19:13842811-13842833 CTCCGGCCGCCGCCCCGGGCCGG + Intergenic
1162909862 19:13842873-13842895 GGCCGGCGGCCGCCCCCGGCCGG - Intergenic
1162914310 19:13865825-13865847 CGCGCGGGGAGGCCACGGGCCGG + Intronic
1162935360 19:13979109-13979131 CAACGGGGGCGGCCGCGGGCGGG + Intronic
1162948544 19:14057559-14057581 CGGCGGGGGTGGCCCAGCGCGGG + Intronic
1162954713 19:14091370-14091392 CGGCGGGGGCGGCCCTGGCAGGG - Intergenic
1162962498 19:14136299-14136321 GGCCGGGGTCGGCCCGGGGGTGG + Intronic
1163103282 19:15109897-15109919 CAGCGTGGGGGGCCCCGGGCCGG + Exonic
1163158020 19:15449640-15449662 GGCCGGGGGCGGGGCCGTGCAGG - Intronic
1163158068 19:15449724-15449746 GGGCGGGGGAGGCCCCGGGCCGG - Intronic
1163282311 19:16325319-16325341 CGGCGGCGGCGGCTCCGGGGCGG - Exonic
1163440435 19:17320037-17320059 CGACAGGGGCGGGCCCGGGGTGG + Exonic
1163455466 19:17403650-17403672 AGGAGGGGGCGGCCCCGGGAGGG - Intronic
1163666667 19:18606838-18606860 GGCCGGGGGCGGGGCCGGGCGGG - Exonic
1164159670 19:22618086-22618108 GGCCGGAGGCGGGGCCGGGCCGG + Intergenic
1164713479 19:30375446-30375468 GGCCGGGGGCGCGCCCGGGTCGG - Intronic
1164977025 19:32581133-32581155 CGCGGGGCGTGGCTCCGGGCTGG + Exonic
1164977130 19:32581522-32581544 CGGCGGGGGCCGCCACGTGCGGG + Intronic
1165242895 19:34481830-34481852 GGGCGGGGCCGGCGCCGGGCCGG - Exonic
1165445968 19:35856856-35856878 CCCGGGGGGCGGACCCGGGCGGG + Intronic
1165924883 19:39320793-39320815 GGCCCGGGGCCCCCCCGGGCTGG - Intergenic
1165928585 19:39342374-39342396 CGACGGGGGCCGCCGCGCGCCGG - Intronic
1165928699 19:39342688-39342710 CGCGGGCGGCGGCGGCGGGCGGG + Intronic
1166105970 19:40598215-40598237 CGGCGGGGGCGGGGCCGGGAAGG + Intronic
1166245356 19:41522020-41522042 CACCGCGGCCGGCGCCGGGCCGG - Intergenic
1166721812 19:45001442-45001464 CGCGGGGCGCGGGGCCGGGCCGG - Exonic
1166723681 19:45012282-45012304 CCCGGCGAGCGGCCCCGGGCGGG + Intronic
1167331608 19:48859635-48859657 CGCCGGGGCCCTCCCCGGGCTGG + Exonic
1167441907 19:49513514-49513536 GGCGGGAGGCGGCCCCAGGCAGG + Intronic
1167454466 19:49591286-49591308 CGTCCCGGGCGGCCCCGGGGTGG - Intergenic
1167454548 19:49591485-49591507 GGCCCGGGAAGGCCCCGGGCGGG - Intergenic
1167463857 19:49640049-49640071 GGGCGGGGGCGGCCCCGGGGCGG - Exonic
1167557062 19:50203349-50203371 CGCGGGGGGCGGCCGGGGGCGGG - Intronic
1168153538 19:54461324-54461346 CGCCGCAGGCGGGCACGGGCTGG - Exonic
1168654695 19:58118473-58118495 GGCCGGGGCCGGCCCGGGGCGGG + Intergenic
1168663214 19:58183468-58183490 CGTCGGGGGCTGCGCTGGGCGGG + Intronic
924962533 2:46776-46798 GGGCGGGGACGGCACCGGGCAGG - Intronic
925068907 2:951014-951036 CGCGGGAGGCGGCCGGGGGCGGG - Exonic
925097767 2:1220846-1220868 TGGAGGGGGCGGCCCAGGGCTGG - Intronic
925984735 2:9206736-9206758 GGCCGGGGGCGGCGGCCGGCCGG - Intergenic
927667394 2:25042151-25042173 CGCGGGGGCCGGCCGCGGGCAGG - Exonic
927679836 2:25132065-25132087 CACCGGGGGCGGCCCGGGGATGG + Intronic
928022522 2:27715770-27715792 AGGCCGGGGCGGCCCGGGGCGGG + Intergenic
929452710 2:42047889-42047911 CGCCGAGGACGGGCTCGGGCCGG + Intergenic
930177445 2:48314982-48315004 CGCCGGGGACACCCCCGCGCCGG - Intronic
931052301 2:58428473-58428495 CGCCGGCCGCGGGCCCGGGGCGG + Intergenic
932496599 2:72148663-72148685 CGGCGGCGGCGGCAGCGGGCGGG + Intergenic
932713897 2:74087866-74087888 TGCCTGGTGCGGCACCGGGCAGG + Exonic
932780123 2:74554332-74554354 GGCTGGGGGCGGGCCCGGCCAGG + Exonic
933666670 2:84970716-84970738 CGCCTGGGGCGGGCCTAGGCCGG - Intergenic
933908023 2:86914183-86914205 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908034 2:86914211-86914233 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908069 2:86914307-86914329 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
933908143 2:86914518-86914540 CGGCGGCGGCGGCCTCGGCCTGG + Intronic
934011428 2:87824733-87824755 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934011459 2:87824816-87824838 CGGCGGCGGCGGCCTCGGCCTGG - Intronic
934933127 2:98444836-98444858 CGCCGGGCGCAGCCCCGCCCTGG - Exonic
934993265 2:98936147-98936169 CGCCGGGCGCAGGGCCGGGCCGG - Exonic
935032700 2:99337651-99337673 CGCCGGGCGCGGCGTCGGACCGG + Intronic
935112457 2:100105238-100105260 CGCGGGCGGCGGACCCGGGTGGG + Intronic
935592469 2:104855358-104855380 GGCCGGCGGGGGCCCGGGGCGGG + Intergenic
936122657 2:109760349-109760371 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936122690 2:109760418-109760440 CGGCGGCGGCGGCGCAGGGCCGG + Intergenic
936147079 2:109987282-109987304 TGCCGGGGGCTGCCTCGGGCTGG + Intergenic
936174254 2:110205071-110205093 CGCCCGGGCCGGTCCCGGGAAGG + Intergenic
936197613 2:110384201-110384223 TGCCGGGGGCTGCCTCGGGCTGG - Intergenic
936222003 2:110611055-110611077 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936222036 2:110611124-110611146 CGGCGGCGGCGGCGCAGGGCCGG - Intergenic
936412921 2:112276080-112276102 CGGCGGGAGCGGGCCGGGGCCGG + Intronic
937221451 2:120345101-120345123 CGGCGGCGGCGTCCCCGCGCCGG - Intergenic
937221580 2:120345579-120345601 CGCCGGCGGCGGAGACGGGCAGG - Intergenic
938073187 2:128318915-128318937 GGCCAGGGGCGGACCGGGGCGGG - Intergenic
938258302 2:129877638-129877660 GGGCGGGGGCGGGGCCGGGCCGG + Intergenic
938639766 2:133266468-133266490 CGCAGGGGGCGCGCCTGGGCGGG + Intronic
939990916 2:148876009-148876031 CGCCGGGTGGGGGCCCGGGTGGG + Intronic
940214392 2:151289536-151289558 CGCCGCTGGCAGTCCCGGGCTGG - Intronic
941110365 2:161414607-161414629 CTCCGGGAGCTGCCCCGGCCCGG + Intergenic
941111609 2:161423522-161423544 CGCGGGCGCGGGCCCCGGGCCGG + Exonic
941384944 2:164841396-164841418 CGGCGGCGGCGCCCGCGGGCTGG - Exonic
941666422 2:168247540-168247562 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
941992886 2:171574285-171574307 CGCCCGTGGAGGCCCCGGGCTGG - Intergenic
942241233 2:173965080-173965102 CGGCGGCAGCGGCCCCGGGCTGG + Intronic
942449592 2:176100528-176100550 CGTGGGGGGCGGCCCCGGGGAGG + Exonic
942450914 2:176107619-176107641 CAGCGGGGGCGGCCCCGGCGGGG + Exonic
942454804 2:176130336-176130358 CAGCGGCGGCGGCCCCGGGCGGG - Exonic
942681413 2:178480819-178480841 CACCGCGGCCGGCGCCGGGCCGG + Exonic
942890263 2:180980280-180980302 CCCCGGAGGCGGGCCCAGGCCGG + Intronic
945431707 2:209772184-209772206 CACCGCGGGCCGCCCTGGGCTGG + Intronic
946747482 2:222860883-222860905 CGGCGCTGGCGGCCCGGGGCGGG - Intergenic
947518781 2:230828605-230828627 AGCCCGGGGCGGTCGCGGGCCGG - Intergenic
947669036 2:231925349-231925371 GGCGGCGGGCGGTCCCGGGCCGG + Intronic
948386903 2:237586109-237586131 GGCTGGGGGCAGCCCTGGGCTGG + Exonic
948393334 2:237627566-237627588 GGCCGGGGCCGGGGCCGGGCCGG + Intronic
948479341 2:238240239-238240261 CCGCGGGGGCGGCACCGGGGCGG + Intronic
948479602 2:238241157-238241179 CGCCGGGGCAGGAGCCGGGCAGG - Intergenic
948801566 2:240435650-240435672 CGGCGGGGGAGGCGCCGAGCCGG + Exonic
948945737 2:241218046-241218068 CGGCGGGGGCGGGCAGGGGCGGG + Intronic
948991736 2:241559085-241559107 GGAGGTGGGCGGCCCCGGGCCGG + Intronic
1168769790 20:408009-408031 GGCCGGGGGCGGGGCCGGGGGGG - Intronic
1169048661 20:2558550-2558572 CGCCGGGGGCAGCCCAAGCCCGG + Exonic
1169088361 20:2840921-2840943 CGCTGGGGTCCGCCCCGCGCCGG + Intronic
1170524777 20:17226868-17226890 GGGCGGGGGCGGGCCCGGGGCGG + Intronic
1170524781 20:17226879-17226901 GGCCCGGGGCGGCCCAGGGCGGG + Intronic
1170847601 20:19975222-19975244 CCCCCGGGGCGGCCTCAGGCGGG - Exonic
1170999393 20:21397271-21397293 CCCCAGGGGCGCCCCCAGGCCGG + Exonic
1171376110 20:24695052-24695074 CGCCGGCGCCGGCTCCGGACAGG + Intergenic
1171848203 20:30290585-30290607 GGCCGGGGGCGGGGCCGGCCTGG + Intergenic
1172118435 20:32584540-32584562 CGCGCGCGGCGGCCGCGGGCGGG - Intronic
1172146612 20:32762307-32762329 CGGCGGGGGCACCCCCGGGCGGG + Intergenic
1172421905 20:34825300-34825322 CGGGCGGGGCGGCTCCGGGCCGG + Intronic
1172474488 20:35226764-35226786 CGGCGGCGGCGGCCCCGGCGCGG - Exonic
1172474500 20:35226794-35226816 CGCCGGGCCAGGCCCCGCGCTGG + Exonic
1172474591 20:35227046-35227068 CACCGGGGACGGGCCTGGGCCGG + Intronic
1172656460 20:36541422-36541444 CGCGGGGCGGGGCCGCGGGCGGG - Intergenic
1173221858 20:41137875-41137897 CGCGCGGGGCGGGCCCAGGCAGG - Intronic
1173548137 20:43914781-43914803 CGCGGGGGGCGGGCCGGGGGCGG - Intergenic
1173658989 20:44720070-44720092 CACCGGGTCCTGCCCCGGGCTGG - Exonic
1173734299 20:45348470-45348492 GGGCGGGGGCGGGCCGGGGCGGG - Intergenic
1173792089 20:45834245-45834267 GGCCGGCGACGGCCCCGGGGAGG + Exonic
1173813581 20:45971266-45971288 CGCCGCGGCCGCCCCGGGGCAGG - Exonic
1173849722 20:46210276-46210298 AGCAGGCGTCGGCCCCGGGCGGG + Intronic
1174390375 20:50215180-50215202 TCCCGGGGGCTGCCCAGGGCTGG - Intergenic
1175215811 20:57391311-57391333 CGCCCGGGGCGGGGCGGGGCCGG + Intergenic
1175465988 20:59191643-59191665 CGCCGGGGGCGGCCTCCTGGAGG + Exonic
1175873727 20:62220030-62220052 GGCCGGGAGGGGCCCCGGCCCGG + Exonic
1176135774 20:63521406-63521428 CGCCAGTGCCGGCCCCGTGCAGG + Intronic
1176146265 20:63566811-63566833 GGTCGGGGGCTGTCCCGGGCTGG + Intronic
1176178570 20:63739604-63739626 CGGAGGGGGCGGGCCCGGGGCGG + Intronic
1176178662 20:63739846-63739868 CTCAGGACGCGGCCCCGGGCCGG - Exonic
1176550183 21:8217407-8217429 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176569111 21:8400445-8400467 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1176577025 21:8444677-8444699 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1178334673 21:31732290-31732312 CGGCGGCCGCGGCCGCGGGCCGG + Intergenic
1178488008 21:33030973-33030995 CGCCGAGGGTGGCCCTGGACTGG + Intergenic
1178951571 21:36990095-36990117 CGCCGGGGGCGTGCTGGGGCCGG - Intronic
1179511956 21:41879199-41879221 CAGCGGGTGCGGCCCGGGGCCGG + Intronic
1179674902 21:42974734-42974756 GGCGGGCGGCGGCCGCGGGCCGG - Intronic
1179783868 21:43719058-43719080 GGCCGGGGGCGGACCGGGGCGGG - Intergenic
1179783874 21:43719069-43719091 CGCCGGGGGCTGGCCGGGGGCGG - Intergenic
1179810374 21:43865680-43865702 CGCCCGGGAGGGGCCCGGGCCGG + Intronic
1179882645 21:44299991-44300013 CGCCGGGGGCGGGCCCGGGGCGG + Intergenic
1180014968 21:45075499-45075521 CGCCGCGGGCGGCCCGGGCCAGG + Intronic
1180066615 21:45415609-45415631 GGCCGGGGCAGGCCCCGGACGGG + Intronic
1180157047 21:45982883-45982905 CGCCGGGAGGGGCCCCGGTCAGG - Intronic
1180195371 21:46190680-46190702 GGCTGGGGTCGGCCCTGGGCAGG - Exonic
1180559299 22:16602246-16602268 AGCCAGCGGCGGCGCCGGGCCGG + Intergenic
1180614762 22:17120215-17120237 CGCGGGGGGCGGCCTGGGGGCGG - Exonic
1180650221 22:17370317-17370339 CGCGGGGGGGGGGCCCGCGCGGG + Intronic
1180699696 22:17774523-17774545 CGCCGGGGGCGGGCCGGGGCGGG - Intronic
1180791610 22:18578066-18578088 CCTCGGGGGCGGGGCCGGGCCGG + Intergenic
1180843632 22:18970426-18970448 CGCGGGAGGCGGCGGCGGGCGGG - Intergenic
1181230130 22:21417244-21417266 CTGCGGGGGCGGGGCCGGGCCGG - Intergenic
1181248519 22:21517622-21517644 CTGCGGGGGCGGGGCCGGGCCGG + Intergenic
1181299114 22:21867160-21867182 GCTCGGGCGCGGCCCCGGGCCGG - Intronic
1181514344 22:23402617-23402639 GGCCGGGGGCGGACCCGGGCTGG + Intergenic
1183228146 22:36564285-36564307 CCCCGGGGGCGGGGCGGGGCGGG - Exonic
1183524904 22:38317192-38317214 CTCGGGGGGCTGCCGCGGGCGGG + Exonic
1183577528 22:38701214-38701236 CGCTCGGCGCGGCCCCTGGCGGG + Intronic
1183665141 22:39242557-39242579 CGCGGGGGGCGGCCGCGGAAGGG + Intronic
1183736594 22:39648084-39648106 CGCCGTGGACGGCCACGTGCTGG - Intronic
1183939519 22:41285566-41285588 CGCCCGCGGGGGCCCCGGGCTGG - Intronic
1184105791 22:42366929-42366951 TGCCAGGGGAGGCCCAGGGCAGG - Intergenic
1184412164 22:44331697-44331719 CGCCGGGCGCGGCGCGGAGCTGG + Intergenic
1184620401 22:45672192-45672214 GCCGGGGGGCTGCCCCGGGCAGG + Intronic
1184620417 22:45672230-45672252 CTCCCGCGGCGGCCCCGGCCTGG + Intronic
1184680700 22:46071081-46071103 CGGCGGGGGCGGGCCGGGCCGGG + Intronic
1184698032 22:46150588-46150610 CGAAGGAGGCGGCGCCGGGCAGG - Intronic
1184759762 22:46537661-46537683 GGCCGGGGGCGGGGCGGGGCCGG - Intergenic
1184766809 22:46576636-46576658 CGCCGGACGCGGCCCCACGCCGG - Intronic
1185055619 22:48576994-48577016 CGCCAGGGTGGGCGCCGGGCTGG + Intronic
1185162000 22:49235668-49235690 CGCCGGAGGCAGCCCCGCGGGGG + Intergenic
1185259631 22:49854145-49854167 GGTCCGGGGCGGCGCCGGGCGGG - Intronic
1185315531 22:50177491-50177513 CGCTGGGCGCGTCCCCGGACGGG + Exonic
1185351745 22:50343245-50343267 GGCCGGGGGCGGGGCCGCGCGGG - Intergenic
1185381042 22:50507721-50507743 GGCCTGGGGCTGCCGCGGGCGGG - Intergenic
1185381115 22:50507901-50507923 GGCCTGGGGCAGCCGCGGGCGGG - Intergenic
1185395009 22:50582433-50582455 CGCCTGGGGCGGGGCGGGGCCGG - Intronic
1185409518 22:50674605-50674627 CGGCGCGAGCGGCCCCGGCCCGG + Intergenic
1203255078 22_KI270733v1_random:133745-133767 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203263134 22_KI270733v1_random:178824-178846 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
950282364 3:11719374-11719396 CGGCGGGGCGGGACCCGGGCTGG - Intronic
950650212 3:14402540-14402562 GGCCGGGGGCGGGGCCGGGGCGG - Intergenic
952334307 3:32391820-32391842 GGCCGGGGGCGGGCGGGGGCGGG - Exonic
952788263 3:37176618-37176640 GGCCGGAGGCGGCCTTGGGCGGG + Intronic
953027506 3:39153481-39153503 CGCAGGGGGCGTCCCCGGCCGGG - Exonic
953385292 3:42502698-42502720 CGCGGCGGGCGGCCCCGCGCGGG - Exonic
953447360 3:42979559-42979581 CGCCGGGGGCGGCCAAGGGGAGG + Exonic
953464356 3:43105910-43105932 CGCTGGGGGCGGCGGCGGGGTGG - Exonic
953705155 3:45225535-45225557 CGCTGGGGGCGGCGGCGGGCCGG + Exonic
954004024 3:47578325-47578347 GGCCGGGGGCGGGGCCGGGGCGG - Intronic
954277954 3:49554656-49554678 CGGCGGCGCCGGCCCCGGCCCGG + Exonic
954581789 3:51706991-51707013 GGCTGGGGGCGGGCCGGGGCCGG + Intergenic
954581801 3:51707008-51707030 GGCCGGGGGCGGGGCGGGGCGGG + Intergenic
954717990 3:52536385-52536407 GGCAGGGGGCGGGGCCGGGCCGG + Intronic
954812406 3:53256136-53256158 GGCAGGAGGCGGCCCCAGGCGGG - Intergenic
954838905 3:53494545-53494567 GGCCGTGGGCGGCTCGGGGCGGG + Intergenic
954912637 3:54122210-54122232 CTCTGGGGCTGGCCCCGGGCCGG - Intergenic
956179069 3:66500865-66500887 CGGCGCGGCCGGCCCCGCGCTGG + Exonic
956678127 3:71754003-71754025 GGCAGGGGACGGCCCCGGGGCGG + Intronic
958900097 3:99876084-99876106 CGCCGGGGCCGGGCGGGGGCCGG + Intronic
961202521 3:125055960-125055982 CGGCGGGGGCCGCGCGGGGCCGG + Intergenic
961574457 3:127823231-127823253 CGGCGGGGGCGGCCCGAGGTGGG + Intronic
961754913 3:129121825-129121847 AGCCGGGGGCGGGCGGGGGCGGG - Intronic
962277869 3:134029661-134029683 CGCCAGGCGCGGCTCCGGCCCGG + Intronic
966181907 3:177196567-177196589 CCCCGGGCGCGTCCCCGGCCCGG - Intronic
966743208 3:183253225-183253247 GGATGGGGGCGGGCCCGGGCGGG - Exonic
966860987 3:184230693-184230715 CGGCGGGGGGTGCGCCGGGCAGG + Intronic
966874442 3:184314511-184314533 CGCAGGGGGCGGAGCCGCGCCGG - Intronic
966911415 3:184562246-184562268 CGACGGCGGCGGCGGCGGGCGGG - Exonic
967055443 3:185825454-185825476 AGCGGGTCGCGGCCCCGGGCTGG + Intergenic
967272631 3:187743793-187743815 CGGCGGCGGCGGCCCGGGGAGGG - Intronic
968092982 3:195909614-195909636 ACTCGGGGGCGGCCCGGGGCGGG - Intronic
968178117 3:196568816-196568838 CGCGGCGGACGCCCCCGGGCAGG + Exonic
968235909 3:197029883-197029905 CGCCGGGGCCGCCCAGGGGCGGG - Intergenic
968323459 3:197791582-197791604 CGCCGGGAGCCGCCCCGGCCGGG + Intronic
968434030 4:575912-575934 CGCCGGCGGCGGCCCCCAGGCGG + Intergenic
968479249 4:826360-826382 GGCGGGGGGCGGACCCGGGGCGG + Intergenic
968514199 4:1009622-1009644 GGCCTGGGCCGGCCGCGGGCTGG + Intergenic
968562212 4:1290045-1290067 CGCGAGGGGCCGCCCCGGGAGGG + Intronic
968571968 4:1346802-1346824 CGCCGGGGGCGGGGCCGGCCGGG - Intergenic
968582902 4:1403162-1403184 CGGCGGGGGCGGACCGGGACCGG - Exonic
968674681 4:1871231-1871253 CGCCGGGGCCGCGCACGGGCGGG - Intergenic
968831352 4:2934322-2934344 CGCGGGGCGCGGGCCGGGGCTGG - Exonic
968879947 4:3293432-3293454 CCGCGGGGGCGGCGCCGGGCAGG + Intronic
968914985 4:3493425-3493447 AGCCGGGGGTGGCCCCGCGTGGG - Exonic
969053262 4:4387071-4387093 CGCCGCGCGCGGACCCGGGAAGG - Exonic
969240380 4:5893120-5893142 CGCCGGGGCGGGGCCGGGGCGGG + Intergenic
969330752 4:6472382-6472404 GGGCGGGGGCGGCCGGGGGCGGG + Intronic
969366035 4:6694696-6694718 CGCCCGGGGCAGCCTCCGGCTGG + Intronic
969506893 4:7593661-7593683 GGGTGGGGGCGGCCCCAGGCGGG + Intronic
969559809 4:7939760-7939782 CGGCGGCGGCGGCCCCGCCCCGG - Exonic
970194631 4:13542427-13542449 CGGCGGGGGCGGCAGCGGGCCGG - Exonic
970421074 4:15906106-15906128 GGCGGCGGGCGGGCCCGGGCGGG + Intergenic
972960704 4:44448646-44448668 CGACCGGGGCGGCCCCGCTCAGG + Exonic
973907347 4:55545990-55546012 CGCCGTTGCCGGCCGCGGGCTGG - Intronic
975616397 4:76251756-76251778 CGCAGGCGGCGGCTCCGGCCGGG + Exonic
975683275 4:76897003-76897025 CGCGGGGAGCGGGGCCGGGCAGG + Exonic
975778802 4:77819030-77819052 TGTCGGGGGTGGCCCGGGGCCGG - Intronic
976398574 4:84583157-84583179 CTCCGGCGGAGGTCCCGGGCAGG - Exonic
977536536 4:98261310-98261332 CGGCGGGCGCGGCTCCGAGCGGG - Intergenic
977932184 4:102761036-102761058 CTCCGGGCGCAGCCGCGGGCGGG + Intergenic
978795696 4:112705835-112705857 CGCCGGGCGCGGCGCTGGGAAGG + Intergenic
979547230 4:121951789-121951811 GGCCCCGGGCGGCCCAGGGCGGG + Intergenic
981782448 4:148443983-148444005 CGCCGGGGGCAGCTCCAAGCTGG - Intronic
984668070 4:182449099-182449121 CGGCGGCGGCGGCCTGGGGCGGG + Intronic
985550023 5:528266-528288 GGCCGGGGGCTGCGCCGGGAGGG + Intergenic
985611630 5:892663-892685 CGCCGGCGGCGGGCCCGAGGCGG + Exonic
985762951 5:1761018-1761040 CGCCGGGCCAGGCCCCGGGGCGG + Intergenic
985895623 5:2748792-2748814 CGCGGGGCGCGGCCTCGGGCGGG + Exonic
986297111 5:6448793-6448815 CGCCGGGCCCGGCCCCGCCCTGG - Exonic
986330579 5:6713838-6713860 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
988577768 5:32444031-32444053 CGCCGCGGGCCGGGCCGGGCCGG + Intronic
989523107 5:42423849-42423871 CGGCGGCGGGGACCCCGGGCTGG + Intronic
991488197 5:67159673-67159695 GGCCGAGGGGGGCCCAGGGCAGG - Intronic
991676563 5:69094297-69094319 CGGCGGCGGCGGCCTTGGGCCGG + Exonic
992105791 5:73448224-73448246 CGGCGGTGGCGGGCCCCGGCTGG - Exonic
992563244 5:77972899-77972921 CCCCGGGGGCCGCGCCGCGCCGG - Intergenic
995724673 5:115170235-115170257 TGCCGAGGGCGGCGCCGGGGCGG + Intronic
996185255 5:120465564-120465586 CTCAGGCGGCGGCTCCGGGCGGG + Intronic
996785058 5:127229348-127229370 CGGCTGCGGCGGGCCCGGGCGGG - Intergenic
997129606 5:131263904-131263926 CGGCGGGGGCGGGGCCTGGCGGG + Intronic
997303429 5:132822841-132822863 CCCTGGGGGCCGCGCCGGGCTGG + Exonic
997463447 5:134071259-134071281 CAGCGGGGGCGGCGCCGTGCGGG + Intergenic
997521608 5:134527155-134527177 TGCCGGGGGCGGGGCGGGGCCGG - Intronic
997732659 5:136192482-136192504 CGCCACGGGCGGCCCCGAGGCGG - Intergenic
997975437 5:138439181-138439203 GGCCGGGCGCGGCGCGGGGCGGG - Exonic
998228875 5:140346660-140346682 GGGAGGGGGCGGCGCCGGGCGGG - Intergenic
999079066 5:148826449-148826471 CTCCTGGGGCTGGCCCGGGCGGG - Exonic
1000071405 5:157743957-157743979 CGGCGGGCGCGGGCGCGGGCGGG + Exonic
1000618818 5:163460063-163460085 CGCCTGGTGCGGCCGCGGCCGGG - Exonic
1001065110 5:168529675-168529697 CGGCGGGGGCGGCCGGGGCCGGG + Exonic
1001506354 5:172283657-172283679 CGCCGGGGGCCCCCATGGGCGGG - Exonic
1002046227 5:176543177-176543199 GGTAGGGGGCGGCCGCGGGCCGG - Intronic
1002176443 5:177403825-177403847 CCCCTGGGGCGGCTCTGGGCGGG + Intronic
1002180043 5:177426650-177426672 CGCCGGGGTGGCCCCCGGGAGGG + Intronic
1002185959 5:177454931-177454953 GGCCGGGGGCTGCCCGTGGCAGG - Exonic
1002186135 5:177455639-177455661 GGGCGCGGGCGGCCCCTGGCCGG + Intronic
1002424513 5:179167310-179167332 CGCCGGGTGCGTCCCCGGCCCGG - Intronic
1002487679 5:179550733-179550755 GGCCGCGGGCGGCCGAGGGCTGG + Exonic
1002712701 5:181204768-181204790 CTCCCGGGGCAGCCGCGGGCAGG + Exonic
1002897857 6:1389746-1389768 CGGCGGCGGCGGCGGCGGGCGGG - Intergenic
1002897906 6:1389900-1389922 CGCGAGGGCGGGCCCCGGGCGGG - Exonic
1003097999 6:3157313-3157335 AGGCCGCGGCGGCCCCGGGCTGG - Intronic
1003175643 6:3751059-3751081 CGCCGGGGGCGCCCCCAGGCTGG + Intronic
1003290840 6:4776823-4776845 GGCGGGGGGCGGCCCGAGGCCGG - Intronic
1004262127 6:14117692-14117714 CGCCGGGGAATCCCCCGGGCTGG + Exonic
1004690346 6:17987691-17987713 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1004864587 6:19839063-19839085 CGCCTGGCCCGGCCGCGGGCGGG + Intronic
1005611550 6:27530028-27530050 GGTCGGGGGCAGCCCCCGGCCGG - Intergenic
1005826312 6:29633247-29633269 CGCTGTGGGCGGTCCAGGGCGGG - Intronic
1005958178 6:30679140-30679162 AGCAGGGGGCGCCCTCGGGCCGG + Intronic
1006313517 6:33277553-33277575 GGCCAGGGGCGGCCCCGGTGAGG - Exonic
1006472294 6:34235868-34235890 CGCCCGAGAAGGCCCCGGGCCGG + Intergenic
1006589075 6:35141169-35141191 AGCCGGAGGCGGGCCTGGGCCGG - Intronic
1010209884 6:73354329-73354351 GGCCGGGGGCGGGGCCTGGCCGG - Intergenic
1011416270 6:87122827-87122849 CGCCAGGGCCCGCCCCGCGCCGG + Intergenic
1015440407 6:133241192-133241214 CGCGGGGGGCGGCGGCGCGCGGG - Intronic
1016590196 6:145735444-145735466 CGCCGTGGCCGGCGCCCGGCCGG - Exonic
1017021286 6:150142673-150142695 CACCTGGCGCGGCCCCGGGCAGG - Intergenic
1017324710 6:153131431-153131453 GGCCGGGGGCCGCCCGGGGAGGG - Intergenic
1017793854 6:157823750-157823772 CGCCGGGAGGGGCCGCGGGACGG + Intronic
1017962116 6:159232335-159232357 CGAGGGGGGCGCCCCTGGGCGGG - Exonic
1018686476 6:166307950-166307972 GGCCCGGCGCGGCCCCGGCCTGG - Exonic
1018947274 6:168356630-168356652 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947339 6:168356850-168356872 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947372 6:168356960-168356982 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947388 6:168357015-168357037 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947404 6:168357070-168357092 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947420 6:168357125-168357147 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947438 6:168357180-168357202 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947455 6:168357235-168357257 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947471 6:168357290-168357312 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947504 6:168357400-168357422 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947520 6:168357455-168357477 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947538 6:168357510-168357532 CGGCAGGGGTGGCCCCAGGCAGG + Intergenic
1018947570 6:168357620-168357642 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947588 6:168357674-168357696 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947604 6:168357729-168357751 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947636 6:168357839-168357861 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947652 6:168357894-168357916 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947669 6:168357949-168357971 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947689 6:168358004-168358026 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947707 6:168358059-168358081 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947727 6:168358114-168358136 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947760 6:168358224-168358246 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947778 6:168358278-168358300 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947794 6:168358333-168358355 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947827 6:168358443-168358465 TGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947843 6:168358498-168358520 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947858 6:168358553-168358575 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947878 6:168358608-168358630 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947896 6:168358663-168358685 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947916 6:168358718-168358740 CAGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947965 6:168358883-168358905 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1018947983 6:168358937-168358959 CGGCAGGGGCGGCCCCAGGCAGG + Intergenic
1019279298 7:192232-192254 TGGCGGCGGCGGCCCCGGGCGGG + Intergenic
1019381590 7:726984-727006 CGCCGAGGGCTGCCGCGCGCTGG + Exonic
1019436944 7:1027440-1027462 GGCAGGTGGCGGCCCCGTGCTGG - Intronic
1019524095 7:1472974-1472996 CGCCTCGGACGGCCCAGGGCTGG + Intronic
1019663873 7:2241859-2241881 CGCCGGGGGCGAGCCCGGGGCGG - Intronic
1019689650 7:2403567-2403589 CGCCGGGGGCGGGGCCGGCGAGG + Exonic
1019712405 7:2523683-2523705 GGCAGGGGGCGGCCGCGTGCTGG + Intronic
1020113634 7:5462481-5462503 GGCAGAGGGAGGCCCCGGGCTGG + Intronic
1020278313 7:6637526-6637548 CGGCGGCGGCGGGGCCGGGCTGG + Intronic
1022528342 7:31052411-31052433 CGCTGCGCTCGGCCCCGGGCAGG + Intergenic
1023243822 7:38178732-38178754 CGGTGGGGTCGGCCCCGGGCTGG + Intronic
1023743648 7:43302601-43302623 CTCCCGGGGCGGCCCCGTACCGG - Intronic
1023937177 7:44748558-44748580 CGCCGGGAGCGGGGCGGGGCCGG - Intergenic
1023939196 7:44759345-44759367 GGCAGGGGGCTGCCCAGGGCTGG - Exonic
1023955808 7:44885629-44885651 CGTCAGGGGCCGCGCCGGGCGGG + Intergenic
1024043820 7:45574460-45574482 CGCGGGCGGCGGCGCCGGGGCGG - Intronic
1025097293 7:56106280-56106302 CGCAGAGGGAGGCCGCGGGCGGG - Intronic
1026765055 7:73155088-73155110 CGCGGGGGGCGGCGGCGGCCGGG - Intergenic
1027041528 7:74964843-74964865 CGCGGGGGGCGGCGGCGGCCGGG - Exonic
1027082114 7:75237526-75237548 CGCGGGGGGCGGCGGCGGCCGGG + Intergenic
1027421212 7:78019661-78019683 GGCCAGGGGCGGCCCGAGGCCGG - Exonic
1029238742 7:99143836-99143858 CGGCGGCGGCGGGGCCGGGCCGG - Exonic
1029372453 7:100158301-100158323 CACCGGGGGCGGCCCGGGCTTGG - Exonic
1029490080 7:100866190-100866212 CGCCTGGGGCGGCCGAGGGGCGG + Exonic
1029640316 7:101816153-101816175 CTCCGCCGGGGGCCCCGGGCTGG + Intronic
1030033284 7:105388390-105388412 GGCCGGTGGCGACCCGGGGCGGG + Intronic
1030354350 7:108526167-108526189 CGCTGGGGGCGGAGCGGGGCGGG - Exonic
1031629669 7:124032295-124032317 CGCCGGGGGAGCCCCCAGCCAGG - Exonic
1032194132 7:129780037-129780059 TGCCGGGGAAGGCCCCGGCCCGG + Intergenic
1034227856 7:149497268-149497290 GGCGTGGGGCGGCCCGGGGCGGG + Intronic
1034243026 7:149624314-149624336 GGCGTGGGGCGGCCCGGGGCGGG + Intergenic
1034430575 7:151039276-151039298 AGCCGGGGGAGGCACCAGGCAGG - Intronic
1034445985 7:151114694-151114716 CCCCGGCCGCGGCCCCGGCCCGG + Intronic
1034469718 7:151248750-151248772 CGGCGGCGGCGGCGGCGGGCGGG - Exonic
1034469849 7:151249219-151249241 CACCGCCGCCGGCCCCGGGCAGG - Intronic
1034522620 7:151632312-151632334 CGGCGGCGGCGGCCTCGGGCGGG - Intronic
1034617946 7:152435573-152435595 AGCCAGCGGCGGCGCCGGGCCGG - Intronic
1034963066 7:155374284-155374306 CGGCGGGGGCTGGGCCGGGCGGG + Intergenic
1035231366 7:157468037-157468059 AGCCGTGGGCGGCCCCAGGCGGG - Intergenic
1035404258 7:158587835-158587857 CGCCGGGGGCGGGGCCGGGGCGG - Intergenic
1035478086 7:159157926-159157948 CGCCGTGGCCAGCCCCAGGCTGG - Intergenic
1035580698 8:737834-737856 CGCCGGGGGCTGCCGGGAGCCGG + Intronic
1036723546 8:11200438-11200460 CGCCAGGGGCGGCGCGCGGCCGG + Intronic
1036774001 8:11597643-11597665 GGCAGGGGGAGGCCCCGGGATGG - Intergenic
1037529244 8:19757403-19757425 CGGCGGGGGCGGCCAAGGCCGGG + Intronic
1037589975 8:20304005-20304027 GGGCGGGGCCGGCCCGGGGCGGG + Intergenic
1037807537 8:22066909-22066931 CGCCCTCGGCGGCCCCGGCCCGG - Intronic
1037825191 8:22156506-22156528 GGCCAGGGGGGGCCCGGGGCCGG - Exonic
1038041448 8:23727129-23727151 GGCGGGCGGCGGCCCCGGGCGGG + Intergenic
1039874992 8:41577991-41578013 TGCCGGGGGCGGGGCGGGGCAGG - Intronic
1040312043 8:46241811-46241833 CCCCGAGGGCTGTCCCGGGCGGG + Intergenic
1042218890 8:66453790-66453812 CGCCGGGGGAGGCAACGCGCTGG - Intronic
1042235914 8:66613157-66613179 CGCCTGTGGCGGAGCCGGGCTGG - Exonic
1042246430 8:66712873-66712895 CTCCGACGGCGGCCCGGGGCGGG + Intronic
1043413816 8:80028649-80028671 CGGGGGGGGCGGGGCCGGGCGGG + Intronic
1044591512 8:93917503-93917525 CCCCTGGGGCGGGGCCGGGCCGG + Intronic
1044698969 8:94949418-94949440 GGCCTGGCGCGGCCCGGGGCGGG - Intronic
1045098842 8:98825715-98825737 GGCCGGGGGCGGGGCGGGGCGGG - Intronic
1045305386 8:100952621-100952643 CCCCAGGGCCGTCCCCGGGCAGG + Intronic
1049404008 8:142443559-142443581 AGCCGGGGGCGGGCCTGGGTGGG + Intergenic
1049419659 8:142511092-142511114 CGGCGGGAGGGGCGCCGGGCAGG + Intronic
1049431864 8:142569080-142569102 GGCCGGGAGCGGCCCCAGGTGGG - Intergenic
1049565278 8:143334909-143334931 CGCTGGGGGCGGGGCGGGGCTGG - Intronic
1049661221 8:143820477-143820499 CCCCAGGGGCGGTCCCGGGTGGG + Intronic
1049684594 8:143934229-143934251 CGCCGGGGGCGGGGCGGGGAGGG + Intronic
1049688724 8:143949639-143949661 GGCTGGGGACGGCCCTGGGCGGG - Intronic
1049762273 8:144336902-144336924 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1051936247 9:22446723-22446745 AGCCGGGGGAGGGCCCGGGGCGG - Intergenic
1052362228 9:27573488-27573510 GCCCGGGGGCGGGCCCGGGGCGG - Intronic
1053129053 9:35605233-35605255 TGCCGGGGGCGGGGCTGGGCCGG - Intergenic
1053364787 9:37515052-37515074 AGCAGGGGGTGGCCACGGGCAGG + Intronic
1055454351 9:76459156-76459178 CTCTGGGGGCGGCCCCGGGGCGG + Intronic
1055611592 9:78030963-78030985 GGCCGGGGGCGCGCCCGGGAGGG + Intronic
1056475175 9:86946299-86946321 CGGCGCGGGCGGCCCCGGCGCGG - Exonic
1056773895 9:89497932-89497954 GGCCGGGAGCCGCCGCGGGCAGG - Intronic
1056992420 9:91423951-91423973 CGGCAGGGGCGGGCCGGGGCGGG + Intergenic
1057199882 9:93134292-93134314 GGCCGGGGGCGGGCCGGGGGCGG - Intergenic
1057352899 9:94315536-94315558 CAGTTGGGGCGGCCCCGGGCAGG - Intergenic
1057654848 9:96942055-96942077 CAGTTGGGGCGGCCCCGGGCAGG + Intronic
1059061415 9:111038297-111038319 CGCAGGGGGCGGCCCCGCTCTGG - Intronic
1059102442 9:111483674-111483696 CGCAGGCGGCGGCGGCGGGCGGG - Intronic
1059455671 9:114398560-114398582 AGCAGGGGGCGGCCCGGGGGGGG + Intergenic
1059769718 9:117414388-117414410 CACTCGGGGCAGCCCCGGGCAGG + Intronic
1060106712 9:120877218-120877240 CGGCGGGGGCGGGGCGGGGCGGG + Exonic
1060192048 9:121599549-121599571 CGCCGGGGGAGGCGCGGAGCCGG + Intronic
1060389843 9:123268384-123268406 CGCGGCGGGCCGTCCCGGGCGGG - Intronic
1060406052 9:123373618-123373640 CGCCAGGGGCCGCGCCGGGCCGG - Exonic
1060796162 9:126514323-126514345 CGCAGGGCGGGGTCCCGGGCGGG - Intergenic
1060855868 9:126914855-126914877 CGCCTGGCCCGGCCCCGGCCCGG + Exonic
1060856036 9:126915269-126915291 CGCGGGGGGCGGGGCCGGGGGGG + Intronic
1061541084 9:131278045-131278067 CGGCGGCGGCGGCGGCGGGCGGG + Intergenic
1061609876 9:131739539-131739561 CGCCAGGGGCCGGGCCGGGCGGG - Intronic
1061926385 9:133808041-133808063 CCCGGGTGGCGGCCCCAGGCTGG + Intronic
1061961875 9:133992705-133992727 CGACGCGGGCGGCCCAGGCCCGG - Intergenic
1061975880 9:134067880-134067902 CGGCGCGGGCGGCGGCGGGCCGG - Intronic
1062435791 9:136546091-136546113 CGGCGGGGGTGGGGCCGGGCGGG - Intergenic
1062461882 9:136665727-136665749 GGCCGGGGGCGGGGCGGGGCGGG + Intronic
1062554946 9:137109706-137109728 AGCCGGTGGCGGCACAGGGCAGG + Intergenic
1062584218 9:137241691-137241713 GGACGCGGGCGGGCCCGGGCGGG - Intronic
1062596502 9:137302160-137302182 CGCGGGGGCCGGGCCCGGCCGGG + Exonic
1062621113 9:137423049-137423071 CGCCGGGGGCAGAGCGGGGCCGG - Intronic
1062637859 9:137500922-137500944 CGCCGCGAGTGGCCGCGGGCAGG + Intronic
1062646827 9:137552003-137552025 CGCCGCGCGCGGCCAGGGGCGGG + Intronic
1062696223 9:137877664-137877686 GGGCGGGGGCGGCCGCGGGGCGG + Intergenic
1203471476 Un_GL000220v1:116882-116904 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1203479297 Un_GL000220v1:160854-160876 CCCCGGGGGCGGACCCGGCGGGG - Intergenic
1185641393 X:1590645-1590667 CACCGGGCCCGGCCCCAGGCTGG + Intergenic
1185747275 X:2583582-2583604 CACCGGTGGCGGCCACAGGCGGG + Intergenic
1185747407 X:2583981-2584003 CGCTGGGGGCGCCCCCCGCCTGG + Intergenic
1186426126 X:9465292-9465314 GGGCGGGGGCGGCCCGGGGGCGG + Exonic
1186760321 X:12716292-12716314 CACAGGGGGCCTCCCCGGGCTGG - Exonic
1187533520 X:20116849-20116871 CGGCGGCGGCGGCTCCGGGACGG - Exonic
1190008122 X:46759154-46759176 CCCCGGGCGCAGCCCCGGCCCGG - Intronic
1190024665 X:46912540-46912562 CGCGGGGGGCGGCCCCGGCGGGG + Exonic
1190385633 X:49879957-49879979 CGCCGGGGCCGGGGCCGGGGCGG - Exonic
1190567291 X:51743691-51743713 CCCCGGGGTCGGCCCCGAGCGGG + Exonic
1192260701 X:69504636-69504658 CGCCGGGGCCAGTCCCTGGCGGG - Intergenic
1192584066 X:72306443-72306465 CGCCGGGCTGGGCGCCGGGCTGG - Intronic
1195625108 X:106999568-106999590 CGCGCGGGGCGGGCCGGGGCTGG - Intronic
1197745972 X:129932407-129932429 CGCGGGGCGCGGCCGCGGGGCGG - Intergenic
1198276140 X:135097720-135097742 GGCTGGGGGCGGCCCCGGGAAGG - Intergenic
1198800132 X:140439716-140439738 GGCCGGGGGCGGGCCCGGGCTGG + Intergenic
1199772465 X:150983659-150983681 CCCCTGGGGCCGCCACGGGCGGG - Intronic
1199772596 X:150984039-150984061 CGGCGGCGGCGGCGCCGGGCGGG - Intronic
1200163287 X:154019858-154019880 CGGCGGGCGCGGGCCTGGGCCGG + Exonic
1200277843 X:154751120-154751142 CGCTCGGGGCGGCGCTGGGCGGG - Intronic
1200787545 Y:7273745-7273767 CGCCCGGGGCGCCCCCGGGGTGG - Intergenic
1201904586 Y:19076640-19076662 TGCCGAGGGGGGCCCTGGGCAGG - Intergenic