ID: 1082003948

View in Genome Browser
Species Human (GRCh38)
Location 11:47409571-47409593
Sequence CCCAGGGCACTGAGGGCAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 339
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 308}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082003948_1082003956 -1 Left 1082003948 11:47409571-47409593 CCTGTTGCCCTCAGTGCCCTGGG 0: 1
1: 0
2: 0
3: 30
4: 308
Right 1082003956 11:47409593-47409615 GGACATTGGTCTCATGTCCTAGG 0: 1
1: 0
2: 0
3: 12
4: 133
1082003948_1082003958 14 Left 1082003948 11:47409571-47409593 CCTGTTGCCCTCAGTGCCCTGGG 0: 1
1: 0
2: 0
3: 30
4: 308
Right 1082003958 11:47409608-47409630 GTCCTAGGAAGAAGCGTGGATGG 0: 1
1: 0
2: 0
3: 11
4: 161
1082003948_1082003960 25 Left 1082003948 11:47409571-47409593 CCTGTTGCCCTCAGTGCCCTGGG 0: 1
1: 0
2: 0
3: 30
4: 308
Right 1082003960 11:47409619-47409641 AAGCGTGGATGGTCTTGCCCTGG 0: 1
1: 0
2: 0
3: 6
4: 71
1082003948_1082003957 10 Left 1082003948 11:47409571-47409593 CCTGTTGCCCTCAGTGCCCTGGG 0: 1
1: 0
2: 0
3: 30
4: 308
Right 1082003957 11:47409604-47409626 TCATGTCCTAGGAAGAAGCGTGG 0: 1
1: 0
2: 1
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082003948 Original CRISPR CCCAGGGCACTGAGGGCAAC AGG (reversed) Intronic
900467858 1:2834563-2834585 CCCAGTGCCCTGAGGTCACCCGG + Intergenic
900562123 1:3312392-3312414 CACAGGGCCCCGAGGGCAGCAGG + Intronic
900780374 1:4614030-4614052 CGGAGGGCCCTGAGGGCAGCTGG + Intergenic
900872300 1:5312739-5312761 GCCAGAGCAGTGAGGACAACAGG + Intergenic
903272135 1:22196221-22196243 CCCAGATCAGTGAGGGCAAGTGG - Intergenic
903469436 1:23575592-23575614 CCCAGGGCTGTGAAGGAAACTGG - Intergenic
905201941 1:36321732-36321754 CCCAGGGCACTGTGGGGACAGGG + Intronic
905402795 1:37715771-37715793 CCCAGGGTACCGAGGGGAACTGG - Intronic
906111069 1:43322477-43322499 CCCAGGGCAGTGAAGGCATCAGG - Intronic
907290109 1:53408182-53408204 CCCAGGCTACTGAGTGCCACTGG - Intergenic
907334496 1:53691413-53691435 CCCAGGATTCTGAGGGCAACAGG - Intronic
907359910 1:53906179-53906201 CACAGGGCACTGGGGGCTCCTGG - Exonic
907712521 1:56897512-56897534 GGCTGGGGACTGAGGGCAACAGG + Intronic
908112275 1:60909229-60909251 CCTAGGGCACAGAGTGCAAAAGG + Intronic
909131100 1:71738409-71738431 CCCAGAGAACTTTGGGCAACTGG + Intronic
910107499 1:83647238-83647260 CACATGGCACTGTGGGCAATGGG + Intergenic
912657244 1:111497913-111497935 ACCAGGAGACTGAGGGCAGCAGG + Intronic
912971959 1:114292096-114292118 CCCAGGAAACTGAGGGAGACAGG - Intergenic
913216780 1:116627573-116627595 CCCAGGGCCCTGCTGACAACAGG + Intronic
914958128 1:152183068-152183090 CCCAGGGGACTCAGGGCTCCAGG - Intergenic
915597688 1:156904790-156904812 CGCAGGGCTCTGAGGGGAGCAGG - Exonic
916206377 1:162319665-162319687 CCCTGGGCACTGAGGACAGTGGG - Intronic
916434827 1:164768366-164768388 CCCAGGACACAGAGGGGCACAGG + Intronic
917487431 1:175467692-175467714 CACAGGGCACAGAGGGCATGAGG + Intronic
918004637 1:180530201-180530223 CCCAGAGGACTGAGGGAGACTGG + Intergenic
920300604 1:204986382-204986404 CCGAGGGCACGGCGGGCACCTGG + Intronic
920376411 1:205510708-205510730 CCGAGGCCACTGAGGGTGACAGG - Intronic
921100486 1:211924502-211924524 GACAGGGCACAGAGGGCAACTGG + Intergenic
921490839 1:215773698-215773720 CCCAGGCAAGTGAGGGCAAAAGG - Intronic
922937840 1:229434762-229434784 CCCACCGCACAGAGGGCCACCGG + Intergenic
923050442 1:230387958-230387980 CCCAGGCCAGTGAGAGCAATGGG + Intronic
923085866 1:230703377-230703399 CCCAGGGTGCTGAGGGCTAGAGG + Intronic
923147847 1:231210272-231210294 CCCAGAGCACTGAGAGCCTCCGG - Intronic
923224118 1:231923400-231923422 GGGAGGGCACTGAGGGCAACTGG - Intronic
923627695 1:235627699-235627721 CCCAGGACACTGTTGGAAACTGG + Intronic
924523797 1:244828784-244828806 CCCAGGGGACTGACAGCCACCGG + Intergenic
1065878732 10:30021124-30021146 GCCAGGGGACTGTGGGCAGCAGG - Intronic
1067581573 10:47449850-47449872 CCCAGGGCACTGAGCTCTGCGGG + Intergenic
1067655491 10:48188505-48188527 TCCAAGGCACTGAGGGTAAAGGG + Intronic
1068928517 10:62564778-62564800 CCCATGACACTGAGGCCAAAGGG + Intronic
1069543255 10:69311465-69311487 CCCAGGAAACTCAGGGTAACTGG + Intronic
1069754033 10:70762294-70762316 CCCAGGGAGGGGAGGGCAACAGG - Exonic
1069815284 10:71190085-71190107 CCCAGGGCAGGAAGGGCCACAGG - Intergenic
1072455150 10:95568838-95568860 CCAAAGGGAGTGAGGGCAACTGG + Intergenic
1072634566 10:97169588-97169610 CCCAGGGCAGCCAGGGCAGCCGG + Intronic
1073332266 10:102678106-102678128 CCAAGTGCACTGACAGCAACTGG - Intronic
1073456668 10:103640902-103640924 CCCAGGGCCCTGGGGGCTACAGG + Intronic
1075072326 10:119327371-119327393 CCCAGGGCACAGAGGGGAGAAGG - Intronic
1075211298 10:120493567-120493589 CCCAGGGCATGGAAGGCAGCGGG - Intronic
1075598651 10:123750814-123750836 GCCAGGCCAATGAGGGCATCAGG - Intronic
1075686699 10:124369337-124369359 CCCAGGGCAGTGAGGGGGATTGG + Intergenic
1075734282 10:124654578-124654600 CCCTGGGCAGGGAGGGCCACGGG - Intronic
1076104693 10:127812152-127812174 CCCATTGCACTGAGGGCACAGGG - Intergenic
1076700435 10:132270074-132270096 GGCAGGGGACTGAGGGCAGCAGG + Intronic
1082003948 11:47409571-47409593 CCCAGGGCACTGAGGGCAACAGG - Intronic
1083857489 11:65400363-65400385 CCCAGGACACAGATGGCAGCAGG - Intronic
1085446838 11:76606419-76606441 CCCACGACGCTGAGGGCCACGGG - Intergenic
1085522550 11:77146878-77146900 CCCAGGGCCCTGAGGAAACCAGG + Intronic
1086491454 11:87360984-87361006 CCAAAGGCACTGAGGGGCACAGG - Intergenic
1088735199 11:112723050-112723072 GCCTGGGCTCTGAGGGCACCTGG - Intergenic
1091589525 12:1835037-1835059 CCCAGGGCAGGAAGGGCGACAGG - Exonic
1091750074 12:3016901-3016923 CCCTGGGCACTGTAGGCACCTGG - Intronic
1091779420 12:3204582-3204604 CCCAGTGCACTGTGGGAATCTGG + Intronic
1095821145 12:46479748-46479770 CAGAGTGCACTGAGAGCAACCGG - Intergenic
1096647982 12:53048520-53048542 CCCCGGCCAGTGTGGGCAACCGG - Intronic
1096791166 12:54046159-54046181 CCCTGGGCACCGAGAACAACTGG - Intronic
1097053679 12:56238042-56238064 CCCAGGGTGCCGAGGGCAGCAGG - Exonic
1097573057 12:61356724-61356746 CCCACCCCACTGAGGGCACCGGG - Intergenic
1098625921 12:72667576-72667598 ACCAAGGGAATGAGGGCAACAGG + Exonic
1100442158 12:94627246-94627268 GCCAGGGCTTTGGGGGCAACAGG - Intronic
1101269273 12:103126019-103126041 TCCAGGGCAGTGAGTGCAATTGG + Intergenic
1101560972 12:105857709-105857731 CCACGGGCACAGAGGGCACCAGG + Intergenic
1102097130 12:110249750-110249772 CGAAGGGCACTGATGGCAACTGG - Intergenic
1103444161 12:120983109-120983131 CCCAGGGGCCAGAGGGCAAGAGG + Intronic
1105706661 13:22971578-22971600 CTCAGGGCTCTGAGGGGGACTGG - Intergenic
1105892137 13:24689444-24689466 CACAGGGCCCTGAGGGCTACGGG + Intronic
1106186262 13:27412549-27412571 CCAAGGGCACCAAGGGCCACAGG + Intergenic
1106589921 13:31090277-31090299 CCCAGGGCACAGAGGAGAACTGG + Intergenic
1108048321 13:46404357-46404379 CCCAGGGCAGAAAGGGCATCTGG + Intronic
1113606278 13:111609846-111609868 CACTGGGCACAGAGGGCAGCAGG - Intronic
1113797249 13:113065802-113065824 TACAGGGCACTCAGGGCAACGGG - Intronic
1113980132 13:114267915-114267937 CCTTGGTAACTGAGGGCAACTGG - Intronic
1118319027 14:64742578-64742600 CCCTGGGCACTAAGGGCACAGGG + Intronic
1119199233 14:72740763-72740785 CCCAGGGCACAGAGATGAACTGG - Intronic
1119509358 14:75198872-75198894 CCAAGGGGACTGAGGGAACCCGG - Intergenic
1119651524 14:76387299-76387321 CCCGGGGCTGTGAGGGCATCAGG - Intronic
1120979395 14:90277188-90277210 CCCAGGGCACGGTGGGAAACTGG - Exonic
1121257098 14:92539053-92539075 CCCAGGTCACCAAGAGCAACGGG - Intronic
1121437036 14:93927078-93927100 ACCAGGGAACTGAGGTCAAGGGG + Intronic
1121468063 14:94128633-94128655 CCCATGGCACTGAGCACCACGGG + Exonic
1121698932 14:95937067-95937089 GCCAGTGCACTGAAGGCAATTGG + Intergenic
1122606518 14:102950309-102950331 TCCTGGGCACTGAGGCCATCAGG - Intronic
1122636147 14:103130562-103130584 GCCAGGGCACTGAGAGCCTCAGG + Intronic
1122720865 14:103721530-103721552 CACAGGGCACAGAGGGCTCCTGG + Intronic
1122807047 14:104264993-104265015 CCCAGGGAACTGAGCCCACCAGG + Intergenic
1122985299 14:105209024-105209046 CCCAGCGCAGTGTGGGCACCGGG - Intergenic
1123056410 14:105572668-105572690 CCCACGGCACTGAGTTCACCCGG + Intergenic
1125724313 15:41860610-41860632 CCCAGGGCACTCTGGGCCTCGGG + Exonic
1125766940 15:42142381-42142403 CCCAGGGAGCAGAGGGCCACAGG + Intronic
1126703372 15:51386500-51386522 GCAGGGCCACTGAGGGCAACAGG + Intronic
1129519441 15:76176625-76176647 CCCTGGGCACAGAGAGCCACAGG - Intronic
1130169550 15:81497478-81497500 CCCAGGGCACTGCTGCCAGCTGG - Intergenic
1130891528 15:88137619-88137641 CCCAGGGCTATGAGGACAAGGGG + Intronic
1130987527 15:88854562-88854584 CCCATGGCCCTGTGGGCACCTGG + Intronic
1131068700 15:89450471-89450493 TCCAGGGCACTACGGCCAACTGG - Intergenic
1131844902 15:96479908-96479930 TCCAGGGTACTGAGGGCCTCAGG + Intergenic
1131867594 15:96728622-96728644 GCCAGGGCAGAGTGGGCAACAGG + Intergenic
1132405466 15:101539638-101539660 CCCAGCGCCCGGAGGGCAGCAGG - Intergenic
1132500576 16:282996-283018 CCCAGGGCACCGAGAGAGACAGG - Exonic
1132556569 16:575292-575314 CCAAGGGCCCTGAGGGGCACGGG + Intronic
1132731839 16:1366656-1366678 GCCAGGCCCCTGAGGGCAGCTGG + Intronic
1133055551 16:3143941-3143963 CCCAGGGCACTGAGAGCCCAGGG + Intergenic
1133225058 16:4337081-4337103 GCCAGGGCACTGAGGTCAAGGGG - Exonic
1133239442 16:4405593-4405615 TCCCGGGCAGTGAGGGCACCAGG + Intronic
1135201659 16:20442690-20442712 CTCAGGGGACTGAGGGTATCAGG + Intergenic
1135217445 16:20585176-20585198 CTCAGGGGACTGAGGGTATCAGG - Intergenic
1135402909 16:22178485-22178507 CACATGGGAGTGAGGGCAACAGG - Intronic
1136355942 16:29744867-29744889 CACAGGGCAGTGAGGGCCATGGG + Exonic
1141176150 16:81720580-81720602 CCGTGAGCACTGAGGGCAGCTGG - Intergenic
1141187273 16:81796926-81796948 AACAGGGGCCTGAGGGCAACGGG + Intronic
1141581592 16:85003181-85003203 CTCAGGGCACTGAGGGCCCGAGG + Intronic
1141659033 16:85431732-85431754 CCCAGGGCCCAGAGGGTATCTGG + Intergenic
1141743818 16:85912817-85912839 TCCAGGGCGTTGAGGGCAATTGG + Intronic
1141920276 16:87131056-87131078 CCCAGGGCACAGGGGGCTCCAGG - Intronic
1142014236 16:87735459-87735481 CCCAGCGCAGTTAGGGCAGCGGG - Intronic
1142233895 16:88912414-88912436 GCCAAGGCCCTGAGGCCAACGGG - Intronic
1142288173 16:89179954-89179976 ACCAGGGCCCTGAGGACACCAGG + Intronic
1142561427 17:811634-811656 CCCAGGGCACCGAAGGAAGCCGG + Intronic
1142646314 17:1315944-1315966 CCCAGGGCACTGAGGTCTCAGGG + Intergenic
1143102582 17:4512553-4512575 CCCAGGGTACAGAGGGAAGCAGG - Intronic
1143543185 17:7581527-7581549 CCCAGGGCACTGAGGGGGTTGGG + Exonic
1143609868 17:8012089-8012111 CCCAGGGCAATGTGGGGAAGGGG - Intronic
1143651115 17:8264806-8264828 CCCAAGGCACTCAGGGCAGTGGG - Intronic
1144077517 17:11732792-11732814 CACAGGGCATGGAGGGGAACAGG - Intronic
1144684864 17:17219341-17219363 CCCAGGGCTCCCAGAGCAACAGG - Intronic
1145020153 17:19423857-19423879 TCCAGAGGACTGAGGGTAACAGG + Intergenic
1145995983 17:29105283-29105305 CCATGGGCAGTGAGGGCAGCAGG + Intronic
1146062314 17:29613767-29613789 GCCAGGGCCCTGGAGGCAACTGG + Exonic
1146650380 17:34602690-34602712 CCCAGGGCAGTGGGGTCAAAAGG + Intronic
1146781455 17:35677198-35677220 CCCAGGACATTGAGACCAACTGG - Intronic
1147363227 17:39944320-39944342 CCACGGGCACTGAGGCCAGCTGG - Exonic
1148064637 17:44860059-44860081 CACAAAGGACTGAGGGCAACTGG + Intronic
1150493095 17:65587756-65587778 AGCAGAGCACTGAGGGCATCTGG + Intronic
1151367374 17:73626313-73626335 GCCAGGGCCCTGAAGACAACTGG - Intronic
1151560196 17:74865896-74865918 CCCAGGGCACAGTGGGGACCAGG - Intronic
1152235349 17:79135593-79135615 CCCAGCGCAGTGGGGGCATCGGG + Intronic
1152930400 17:83106422-83106444 GCCAAGGCAGTGAGAGCAACGGG + Intergenic
1153310531 18:3673352-3673374 GACAGGTCGCTGAGGGCAACAGG - Intronic
1153810863 18:8750449-8750471 CCCAGGGCACAGAGAGCAGCAGG - Intronic
1154092778 18:11380745-11380767 GCCAGGGCACTGAGAGCAGCTGG - Intergenic
1156204764 18:34873525-34873547 CCCAGGGCACTCAGAGCCCCTGG + Intronic
1157901170 18:51519486-51519508 ACCCGGGCACTGAGGGCTAATGG - Intergenic
1160557608 18:79736255-79736277 TCCAGGGCTCTGAGTGCAGCAGG - Intronic
1160762376 19:791987-792009 CCCTGGGCCCTCAGGCCAACAGG - Intergenic
1161686323 19:5704411-5704433 CCCAGGGCCCTGAGAGGCACTGG - Intronic
1161849746 19:6732199-6732221 CACAGGGCAGTGGGGGCAAAGGG - Intronic
1162323853 19:9986741-9986763 TCCAGGGCACTTCAGGCAACCGG - Exonic
1162552624 19:11366016-11366038 GCCAGGGCACAGAGGGCACAAGG + Intergenic
1163325912 19:16603143-16603165 CACAGGCCACTGAGGCAAACGGG + Intronic
1163371564 19:16903991-16904013 CCCATGGCACTGGGGGCCTCAGG + Intronic
1163602487 19:18257447-18257469 GCCAGGGCACTGAGGGCCCCGGG - Exonic
1163753439 19:19092331-19092353 GACAGAGCACTGAGGGCAGCTGG - Intronic
1165451609 19:35887158-35887180 CCCAGACCACTGTGGGGAACTGG + Intergenic
1165900592 19:39167572-39167594 CCCAGGGCAAGCAGGGAAACTGG + Intronic
1166821586 19:45583849-45583871 CCCAGGGACCTGAGGCCAGCAGG - Intronic
1166835338 19:45664218-45664240 CCCAGGACCCGGAGGGCACCAGG + Intergenic
1167517333 19:49930814-49930836 TGCTGGGCACTGATGGCAACAGG - Exonic
1167712465 19:51120788-51120810 CCCAGGGCCCTGAGAACAATGGG + Intergenic
926694727 2:15763305-15763327 ACCAGGGCACTGAGGGAAATAGG + Intergenic
927081694 2:19636692-19636714 CTCAGGTAACTGAGAGCAACAGG - Intergenic
927402557 2:22729980-22730002 ATCTGGGCACTGAGAGCAACTGG - Intergenic
927872355 2:26631697-26631719 CCCAGGGCACAGAGTGCAGTGGG - Intronic
928097305 2:28412526-28412548 TCCAGGGCCGTGAGGGCAAGAGG + Exonic
928427389 2:31190421-31190443 CCCATGGCAAAGAGGGCAATTGG - Intronic
932336236 2:70932898-70932920 CCCTGGGCACAGAGAGCAGCCGG - Exonic
932625309 2:73292251-73292273 CCCAGGGAACTGTGGGTCACAGG - Exonic
933274835 2:80272534-80272556 CCCAGGGAAAAGAGGGAAACAGG + Intronic
933648963 2:84833758-84833780 CCCTGGGCACTTCGGGCATCAGG + Intronic
934732151 2:96666167-96666189 CCCAGGGCACTGCAGAAAACTGG + Intergenic
935742143 2:106159144-106159166 ACCAAGGCACTGAGAACAACAGG - Intronic
936530988 2:113277178-113277200 CCCAGGTCTCTGAGGGGAATGGG + Intronic
938079145 2:128360048-128360070 TCCAGGGCACTGATGCCAATGGG + Intergenic
938163590 2:129007900-129007922 GCCAGGGCATTGAGGGCTGCAGG + Intergenic
938255655 2:129858189-129858211 AGCTGGGCAGTGAGGGCAACAGG + Intergenic
938406294 2:131035015-131035037 CCCCGGGCGCTGCGGGCCACCGG + Intronic
940309756 2:152265440-152265462 CACAGGGTACTGAGGGCAGCAGG + Intergenic
942734850 2:179097612-179097634 CCCAGGGCACAGAAGGCACAAGG + Intergenic
943692127 2:190880423-190880445 CCGAGGGCAGTGAGGTCAGCAGG - Intergenic
946612354 2:221472993-221473015 CCCAGAGCACTGTGGGAATCTGG - Intronic
947710808 2:232314434-232314456 CCCAGGGCCCTGAGGCCTCCGGG - Intronic
947877818 2:233479719-233479741 CCCAGGTCTCTGAGGGCACCAGG + Intronic
948229798 2:236341633-236341655 CCCAGGGCTCAGAGGGCCGCAGG + Intronic
948253617 2:236550611-236550633 CCCAGGTGACTGAGGGAGACTGG - Intergenic
948716691 2:239869802-239869824 CCAAGGGACCTGAGGGCACCGGG + Intergenic
948885082 2:240878335-240878357 CCCAGCCCACTGAGGTCACCAGG + Intronic
1168834454 20:868821-868843 CCCAGAGCACTCTGGGCATCTGG - Intergenic
1169906451 20:10609551-10609573 CCCTGGGCACTGATGGGAAAAGG - Intronic
1170889907 20:20368191-20368213 CCGGGGGCACTGAGGGCCGCCGG + Exonic
1171278231 20:23876412-23876434 TCCAGGGCACTGAGCCCAACTGG + Intronic
1172485185 20:35293690-35293712 CCCAGTGCACTGTGGGCAGTGGG + Intergenic
1172895340 20:38296073-38296095 CCCAGAGCTCTCAGGGCACCTGG - Intronic
1173916306 20:46710731-46710753 GGCAGGGCACTGAGGTCAAAGGG + Intronic
1174182994 20:48686752-48686774 CCAAGGCCCTTGAGGGCAACAGG + Intronic
1175138329 20:56841569-56841591 CCCTGGGAAGTGAGGGCAGCAGG - Intergenic
1175314419 20:58037707-58037729 CCCAGGGGCCTTAGGCCAACAGG - Intergenic
1175632664 20:60555386-60555408 ACCATGGCACTGATGACAACTGG - Intergenic
1175734564 20:61376350-61376372 CCCAGGGGAAGGAGGGCAAGAGG + Intronic
1175764393 20:61582567-61582589 CTCAGGGCACTGGGTGCAACTGG - Intronic
1175998091 20:62820272-62820294 CCCAGGGCCCTGGGGGCTTCAGG - Intronic
1178413708 21:32386952-32386974 GCCAGTGCACTCAGAGCAACAGG - Intronic
1179052212 21:37897545-37897567 CACAGGGCACGGAGAGCACCAGG - Intronic
1179096069 21:38315360-38315382 CCAAGGGCAATCAGGGCTACTGG + Intergenic
1179544312 21:42104282-42104304 CCCAGGACACTGAGTGAAATGGG + Intronic
1179659629 21:42865942-42865964 AACAGGGCACTGAGGACACCAGG + Intronic
1179847493 21:44119542-44119564 CCCCAGGCACAGAGGCCAACGGG - Intronic
1180199485 21:46215873-46215895 CCCAGGGCCCTGAGGGCGGATGG - Intronic
1180219014 21:46346258-46346280 CACAGGGCACAGTGGGCATCCGG + Intronic
1181108453 22:20588093-20588115 CCCAGGCCAGTGTGGGGAACAGG + Intergenic
1181689491 22:24550647-24550669 CACAGGGAAGTGAGGGGAACTGG - Intronic
1182697657 22:32207394-32207416 ACCAGTGGACTGAGGGCAACAGG + Intergenic
1183737200 22:39650675-39650697 CCCATGGCGCTGAGGGCGAGTGG + Intronic
1183744982 22:39686887-39686909 CTCAGGCCTCTGAGGGCACCAGG + Exonic
1183935582 22:41260294-41260316 CCCAGTGCACTGAGGACAGCAGG + Intronic
1184233639 22:43171596-43171618 CCCACGGCACAGAGGGCCACTGG - Intronic
1184454416 22:44601010-44601032 CCCAAGGCAATGGGGGCAATGGG + Intergenic
1184643998 22:45886332-45886354 CCCAGGGCACTGATGAGCACTGG + Intergenic
1184655793 22:45941557-45941579 CCCAATGCAGTGAGGGCAGCTGG + Intronic
952043676 3:29291436-29291458 CCTTTGGCACTGAGAGCAACTGG + Intronic
953462741 3:43094658-43094680 CCCAGGGCACTGGCGACAAAGGG + Intronic
954660341 3:52223720-52223742 CCCAGGCCAAGGAGGGCACCCGG + Exonic
959637633 3:108592667-108592689 GCCTGGGCAATGTGGGCAACAGG + Intronic
961198464 3:125024334-125024356 ACCAGGGCACAAAGGGAAACCGG - Intronic
961373012 3:126443001-126443023 CCCAGGGCACTGCGGAAGACAGG - Intronic
961453290 3:127012204-127012226 CCCAGGGCCGTGAGGATAACCGG - Intronic
961748084 3:129078702-129078724 CGCAGCTCACTGAGGGCATCTGG - Intergenic
962751003 3:138434823-138434845 CCCAGGGCGCTGGGGGCCCCGGG - Exonic
966689221 3:182726131-182726153 CCCAGCACTCTGAGGGCACCGGG + Intergenic
967521573 3:190438809-190438831 CACAGGGCATAGAGGGAAACAGG - Intronic
968291496 3:197542971-197542993 ACCAGGGCGCTGAGGACAGCAGG - Intronic
968922028 4:3527272-3527294 TCCAGGGCACAGAGGGGCACGGG - Intronic
969251436 4:5971028-5971050 CTCAGGACACTGTGAGCAACAGG + Intronic
969393757 4:6907832-6907854 GTCTGGGCGCTGAGGGCAACAGG + Intergenic
969533247 4:7740929-7740951 CCCTGGGCACTCAGGGAAAGGGG - Exonic
972205580 4:36768317-36768339 CCCAGGTCACTGGGGTCACCTGG - Intergenic
974087117 4:57273296-57273318 CACAGGGCACTGAGGGCTGAGGG + Intergenic
981348170 4:143699595-143699617 ACCAGGGCACCCGGGGCAACAGG - Exonic
985505175 5:275247-275269 CCCAGGGCAATTCAGGCAACAGG - Intronic
985558977 5:572198-572220 CCGAGGGCTCTGAGGTCAGCAGG + Intergenic
985672887 5:1215138-1215160 CCCTGGGCACTGCAGGCAGCTGG + Intronic
987038524 5:14040655-14040677 CCCAGGGAACAGAGGGCACTTGG + Intergenic
989149098 5:38280621-38280643 CCCAGGGCCAAGAGTGCAACTGG - Intronic
991945127 5:71892205-71892227 CCCAGGCCACTGAGAGTCACAGG - Intergenic
993465287 5:88237947-88237969 CCCAGGTATCTGAGGGAAACTGG + Intronic
993562312 5:89425353-89425375 CCCATGGCAATGAGTCCAACAGG + Intergenic
995201026 5:109425410-109425432 ACCAGGGCACTGAGGGAAGCAGG - Intergenic
996353685 5:122573829-122573851 CCCAGGACTTTGAGGGCAGCTGG + Intergenic
997294980 5:132763514-132763536 CCCAGAGCATTGGGGGCCACTGG + Intronic
997680424 5:135746332-135746354 CCCTGGGCACTGAGGGCCCCTGG + Intergenic
998230218 5:140357089-140357111 CCCAGGGCACTCAGGCCCAGAGG + Intergenic
1000028736 5:157383210-157383232 CTCAGGGAACACAGGGCAACTGG - Intronic
1001115657 5:168937192-168937214 CCCAGAGCACAGAGGCCAAGGGG + Intronic
1003022485 6:2522924-2522946 CCCAGCGCCCTGAGTTCAACTGG - Intergenic
1003328781 6:5112393-5112415 CCCAATGCACTGAGAGCAAATGG + Intronic
1005709514 6:28489968-28489990 CCCAGGGCACCCAGGGCAGGCGG + Intergenic
1005969322 6:30749054-30749076 CCTAGGGCTCTGAGGGTAGCAGG - Intergenic
1006463899 6:34179509-34179531 CCCAGGGCCCTGAGAGCACAGGG + Intergenic
1006836679 6:37003039-37003061 CCCAGGCCAGGGAGGGCATCGGG + Intergenic
1007376496 6:41460322-41460344 CCCAGGGCTCTGAGGAGGACAGG + Intergenic
1011094804 6:83649265-83649287 CCCAGACCACTGAGGGCTACAGG - Intronic
1012169580 6:96002094-96002116 CCCAGGCCACTCAGGCCAAGGGG + Intergenic
1013284071 6:108665175-108665197 CACAGGCCAGTGAGGACAACTGG - Intronic
1016627480 6:146189263-146189285 GCCAGGTCACTGAGGAAAACAGG - Intronic
1016814021 6:148287087-148287109 CCCAGGTCTCTGATGGCATCAGG + Intronic
1017713438 6:157190402-157190424 CTGAGGGCACTGAGGCCAGCCGG - Intronic
1017945855 6:159095776-159095798 CCCAGGGCCCTGAGACCACCAGG - Intergenic
1017971374 6:159315293-159315315 CCCAGGGCATTGAGCCCACCGGG + Intergenic
1018009129 6:159653464-159653486 CCCAGGGCTCTGAGGAGAAATGG + Intergenic
1018568952 6:165186685-165186707 CCCAGGGCACTGGAGGCCAGTGG - Intergenic
1019058743 6:169241074-169241096 CCCAGGGCAGGGAGGGCGGCAGG - Intronic
1019716750 7:2542701-2542723 CCCTGGGCCCTGTGGGCAGCAGG + Intronic
1020278580 7:6638382-6638404 CGAAGGGCTCTGAGGGCAGCGGG + Intronic
1022207681 7:28180010-28180032 CCCGAGGCGCTGAGGGCAGCGGG - Intronic
1026979810 7:74519635-74519657 CCCAGGTCGCTGGGGGCAAGGGG - Exonic
1028991838 7:97057100-97057122 GACAGGGCATTGGGGGCAACAGG + Intergenic
1029747730 7:102525687-102525709 TCCTGGGCACTGTGGGTAACTGG + Intergenic
1029765681 7:102624777-102624799 TCCTGGGCACTGTGGGTAACTGG + Intronic
1031412459 7:121456587-121456609 CCTAGGGCACTGATGGCCATGGG - Intergenic
1032525916 7:132577891-132577913 CCGAGGACACTGAGGGCACAAGG + Intronic
1034224746 7:149473869-149473891 CCCTGGGCAGTGAGGGCCATTGG - Exonic
1034273089 7:149812600-149812622 GCGAGGGCACGGAGGGCCACAGG - Intergenic
1034836261 7:154354036-154354058 CCCAGGGGATTAAGAGCAACAGG + Intronic
1035269291 7:157710558-157710580 CCCTGTGCAGTGAGGGCCACAGG + Intronic
1035333863 7:158113338-158113360 CCCAGGGTTCTGGGGGCAAGAGG + Intronic
1036482438 8:9150852-9150874 CTCAGGCCACCGAGGGCGACGGG - Intronic
1037500517 8:19481236-19481258 CCCAGGGCACAGAGGTCGATGGG - Intronic
1038182552 8:25242782-25242804 CCCAGGGCACCCTGGGCAACTGG - Intronic
1040395241 8:46992526-46992548 CCCAGGGCACTCAGTGCAGAAGG + Intergenic
1040673514 8:49721215-49721237 CTCAGAGCACTGAGGCCAATGGG - Intergenic
1044819391 8:96145399-96145421 CCCAGGGCGCTGAGGGCGCCTGG + Exonic
1048349268 8:133603037-133603059 CCCAGGGCACACAAGGCAGCCGG + Intergenic
1049177998 8:141206006-141206028 CCCAGGGCGCGGAGGGCGGCGGG - Intergenic
1049220020 8:141424875-141424897 CCCAGGGGACTGAGGGGACAGGG + Intronic
1049435158 8:142583165-142583187 CCCAGGGCTCTGAAGAGAACTGG + Intergenic
1049551881 8:143263836-143263858 CTCAGGGCACTGCGGGGCACAGG - Intronic
1049631569 8:143661405-143661427 CACAGTGCCCCGAGGGCAACAGG - Intergenic
1049707012 8:144047683-144047705 CACAGTGCACTGAGGGCAGATGG + Intergenic
1049814764 8:144593078-144593100 CCCAGGGGACTCAGGGTACCCGG + Intronic
1049823005 8:144647512-144647534 CACAGGGCAGTGTGGGCAGCAGG - Intergenic
1050509992 9:6384443-6384465 CCCAAGGCACTGGGGGTAGCTGG - Intergenic
1051179561 9:14395995-14396017 CACAGTGCACTGCCGGCAACAGG - Intronic
1053182828 9:35988664-35988686 CACAGAGCTCTGAGGGAAACGGG - Intergenic
1055737476 9:79347152-79347174 TCCATAGTACTGAGGGCAACAGG - Intergenic
1055973017 9:81930465-81930487 CCCAGGGGACTGCAGGAAACAGG - Intergenic
1055974770 9:81945557-81945579 CCCAGGGGACTGCAGGAAACAGG - Intergenic
1056333334 9:85540305-85540327 GCCAAGGCACTGAGAGAAACTGG - Intergenic
1057264150 9:93603066-93603088 CCCAGGGCCCTGAGAGGAAAGGG - Intronic
1057312475 9:93951002-93951024 CTCTGGGCAGTGAGGGCACCTGG - Intergenic
1057730721 9:97605831-97605853 CCCAGGGTCCTCAGGGGAACTGG + Intronic
1059217691 9:112581536-112581558 CCCTGGGCACTGAGGGCTTGGGG - Intronic
1059803668 9:117775580-117775602 CCCAGGGGCTTGAGGGCAATGGG + Intergenic
1060879157 9:127105598-127105620 CCCAGGGCACTTAGCACACCAGG + Intronic
1060886853 9:127160599-127160621 CCCAGGACACTGCTGGCAGCTGG - Intronic
1061407529 9:130400722-130400744 CACAGGGCACTCACGGCCACAGG - Intronic
1061901457 9:133674287-133674309 AGCAGGGCACTGAGGCCAAGTGG - Intronic
1061950291 9:133932246-133932268 CACAGGGCACAGAGGAAAACAGG + Intronic
1062446860 9:136598820-136598842 CCCGGGGCAGTGTGGGCAGCGGG + Intergenic
1062627106 9:137448321-137448343 GCCAGGGGTCTGAGGGCACCTGG - Exonic
1062690096 9:137837222-137837244 CCCAGGGCACGGAGCAGAACAGG - Intronic
1187008997 X:15260851-15260873 TCCAGGGCACTGATGGCTTCAGG - Intronic
1189742807 X:44138248-44138270 GCCAGGGGGCTGAGGGCAAGAGG + Intergenic
1190356972 X:49614741-49614763 CTCAGGTCAATGAGGGCTACAGG + Intergenic
1192231078 X:69265451-69265473 CCCAGAGCACTGGGGGCTGCAGG + Intergenic
1195377351 X:104240806-104240828 CTCAGGAAACTGAGGGCAAGAGG + Intergenic
1195561203 X:106286168-106286190 CCAAGGACACTTAGGGCACCAGG + Intergenic
1195974826 X:110515292-110515314 CACAGGGCACTGAGGCCTACAGG - Intergenic
1197157978 X:123291057-123291079 CACAAGGCCCTGAGGGAAACAGG + Intronic
1200120294 X:153787006-153787028 CCCAGGGCACTCAGGGCAGGGGG + Intronic
1200213211 X:154356070-154356092 CCCAGGGCAGCGTGGGCAGCCGG - Intronic
1202026104 Y:20525669-20525691 CCCAAGGCACCCAGGGCATCTGG - Intergenic