ID: 1082005004

View in Genome Browser
Species Human (GRCh38)
Location 11:47414532-47414554
Sequence GCATGGGTGTGGAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 371
Summary {0: 1, 1: 0, 2: 5, 3: 37, 4: 328}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082004993_1082005004 3 Left 1082004993 11:47414506-47414528 CCAGGCCCCCACAGTGCCCATGA 0: 1
1: 0
2: 3
3: 20
4: 266
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004995_1082005004 -3 Left 1082004995 11:47414512-47414534 CCCCACAGTGCCCATGATCAGCA 0: 1
1: 0
2: 1
3: 19
4: 190
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004992_1082005004 4 Left 1082004992 11:47414505-47414527 CCCAGGCCCCCACAGTGCCCATG 0: 1
1: 0
2: 4
3: 31
4: 322
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004989_1082005004 13 Left 1082004989 11:47414496-47414518 CCCCAGGGGCCCAGGCCCCCACA 0: 1
1: 1
2: 9
3: 70
4: 513
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004991_1082005004 11 Left 1082004991 11:47414498-47414520 CCAGGGGCCCAGGCCCCCACAGT 0: 1
1: 0
2: 4
3: 41
4: 465
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004996_1082005004 -4 Left 1082004996 11:47414513-47414535 CCCACAGTGCCCATGATCAGCAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004994_1082005004 -2 Left 1082004994 11:47414511-47414533 CCCCCACAGTGCCCATGATCAGC 0: 1
1: 0
2: 0
3: 25
4: 161
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004997_1082005004 -5 Left 1082004997 11:47414514-47414536 CCACAGTGCCCATGATCAGCATG 0: 1
1: 0
2: 0
3: 12
4: 216
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004988_1082005004 14 Left 1082004988 11:47414495-47414517 CCCCCAGGGGCCCAGGCCCCCAC 0: 1
1: 2
2: 10
3: 77
4: 638
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328
1082004990_1082005004 12 Left 1082004990 11:47414497-47414519 CCCAGGGGCCCAGGCCCCCACAG 0: 1
1: 0
2: 3
3: 66
4: 507
Right 1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG 0: 1
1: 0
2: 5
3: 37
4: 328

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082005004 Original CRISPR GCATGGGTGTGGAGCTCAGG AGG Intronic
900078119 1:834374-834396 AGCTGGGTGTGGAGATCAGGGGG + Intergenic
900141811 1:1141838-1141860 GCATGGTTGTGGATCCCTGGGGG + Intergenic
900750833 1:4396249-4396271 AGAGGAGTGTGGAGCTCAGGAGG + Intergenic
902360038 1:15937370-15937392 ACCTGGGTGTGAGGCTCAGGTGG - Exonic
902604101 1:17559307-17559329 GCTTCGGTGTGGAGCTTTGGAGG + Intronic
903222369 1:21875973-21875995 GCAGGGGTGTGGAGCCCGGCTGG + Exonic
903797514 1:25940902-25940924 GCATTGGGGTGGAGCTCAGAAGG + Intergenic
904169198 1:28579682-28579704 GGATGCGTGTGAAGCTCTGGAGG - Intergenic
904605520 1:31695812-31695834 GAATGGGCAGGGAGCTCAGGGGG + Intronic
905076568 1:35276931-35276953 GCATGGGAAAGGAGCACAGGGGG - Intronic
905796914 1:40820995-40821017 GCTTGGGTTTGGGGCTCAGAGGG - Intronic
906139821 1:43527389-43527411 ACATGGATGAGAAGCTCAGGTGG - Intronic
908729902 1:67215337-67215359 GCATGTGTTTGCAGCTCAGCTGG + Intronic
908740131 1:67318771-67318793 GGATGAGACTGGAGCTCAGGGGG + Intronic
910112994 1:83701878-83701900 GCAGGGGTGGTGAGTTCAGGAGG - Intergenic
911590873 1:99746151-99746173 GCTTTGGTGTTGAGCTCATGGGG - Intronic
912075717 1:105873132-105873154 GCCTGGGTGTGGAGCAAAGAAGG + Intergenic
913211982 1:116589674-116589696 GGAAGGGTATGGAGCCCAGGGGG - Intronic
915599320 1:156912701-156912723 GCATGGGAGAGGTGCTCAGGAGG - Intronic
915925987 1:160020091-160020113 GCAGGGCAGTGCAGCTCAGGTGG + Intergenic
916899140 1:169201776-169201798 ACATGGATCTGGTGCTCAGGAGG + Intronic
917567627 1:176229499-176229521 CCATTGGTGTGGAGCACAGAGGG + Intergenic
917793357 1:178513921-178513943 GCATGGTTGTGGGGGGCAGGGGG + Intronic
918242213 1:182630516-182630538 CCATGGATATGGGGCTCAGGAGG + Intergenic
920037328 1:203074843-203074865 GCATGGGTGAGGGGGGCAGGTGG + Intronic
920983175 1:210857450-210857472 GCATGGGGGTGGGGGTGAGGGGG + Intronic
921440644 1:215182201-215182223 GCCTGGGTGTGGAGCAGAGAGGG + Intronic
922068853 1:222170839-222170861 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
922475465 1:225904441-225904463 GCATGGGCCTGGGGCTCAGAGGG - Intronic
922746361 1:228046286-228046308 GCATGTGTGTGGTGCACATGTGG + Intronic
1062768211 10:81068-81090 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1062834043 10:624434-624456 GCCTGGATGTGGAGCTGAGCGGG - Intronic
1063342634 10:5282512-5282534 GCTTTGGTCTGGAGCTCAGGGGG - Intergenic
1064991402 10:21259834-21259856 GCAGGGGGGTGGATCTAAGGTGG + Intergenic
1065488209 10:26255045-26255067 GTATGGGCCTGGAGCTCAGGAGG + Intronic
1065833276 10:29634026-29634048 GTATGGGGGTGGAGTTCAGAAGG - Intronic
1066065813 10:31760114-31760136 GCTTCGGGGTGGAGCTGAGGGGG + Intergenic
1067164045 10:43851203-43851225 GACAGGGGGTGGAGCTCAGGTGG + Intergenic
1067205450 10:44208406-44208428 ATATGGGTCAGGAGCTCAGGAGG - Intergenic
1067295174 10:44971553-44971575 GCATGGGGGTCGGGCTGAGGAGG - Intronic
1067716893 10:48697008-48697030 GCCTGGCCTTGGAGCTCAGGAGG + Intronic
1068218094 10:54009804-54009826 GCACCGGTGGGGAGCTCATGGGG - Intronic
1069948042 10:72000885-72000907 GCAGGGGTGTGGGCCTCAGCGGG + Intronic
1070375698 10:75829208-75829230 GCTTTGGTGTGGAGCTGAAGAGG - Intronic
1072030591 10:91518275-91518297 GCATGTCTGTTGAGCTCATGTGG + Intergenic
1072374850 10:94804012-94804034 GCCTGGGTGTGGAGCACAGAGGG + Intronic
1075495560 10:122915955-122915977 GCTGGGATGTGGTGCTCAGGAGG - Intergenic
1075795294 10:125115921-125115943 GCAGGGGTGTGGAGTATAGGGGG - Intronic
1076024457 10:127100519-127100541 GTGTGGGTGTTGGGCTCAGGAGG + Intronic
1076702240 10:132279881-132279903 GCATGGTCATGGAGCACAGGTGG - Intronic
1077334290 11:1996622-1996644 GCAGGGGTGAGGAGCGCAGCGGG - Intergenic
1078953448 11:16162451-16162473 TCATGGGTGTGGATCCCACGTGG + Intronic
1081757465 11:45554734-45554756 TCATGGGTGTGGTGCTGAGACGG - Intergenic
1082005004 11:47414532-47414554 GCATGGGTGTGGAGCTCAGGAGG + Intronic
1082758674 11:57104475-57104497 GGCTGGCTGTGGTGCTCAGGAGG - Intergenic
1083306565 11:61764841-61764863 GCAGAGGAGTGGAGCTCTGGCGG + Intronic
1083847670 11:65345434-65345456 CCATGGGGTTGGAGTTCAGGAGG + Intronic
1085125652 11:74000460-74000482 GCATGGGGGTGGGGCTCCTGTGG + Exonic
1086428013 11:86705972-86705994 GCATGGATGAGAAGATCAGGGGG + Intergenic
1086428977 11:86716943-86716965 GCATGGGTGGGTAACTTAGGGGG + Intergenic
1086494064 11:87384612-87384634 GCCTGGGGGTGGAGCACAGAGGG - Intergenic
1086902925 11:92387782-92387804 GAATGGGAGTGGTGCTGAGGAGG + Intronic
1087343792 11:96943031-96943053 GCCAGGAGGTGGAGCTCAGGTGG + Intergenic
1088908308 11:114171351-114171373 GGATGGGGGTGGAGTTCAGTGGG - Intronic
1089079182 11:115761740-115761762 AGATGGGACTGGAGCTCAGGGGG - Intergenic
1089227260 11:116935915-116935937 ACAGGAGTTTGGAGCTCAGGAGG - Intronic
1090423682 11:126592689-126592711 GCCAGGGTGGGGAGCCCAGGAGG + Intronic
1090483274 11:127086620-127086642 GCCTGGATGTGGAGCACAGAGGG - Intergenic
1090640686 11:128726554-128726576 CCATTGGTATGGAGCTTAGGCGG - Intronic
1202817273 11_KI270721v1_random:51804-51826 GCAGGGGTGAGGAGCGCAGCGGG - Intergenic
1091497178 12:982776-982798 GCGGGGGTGTGGGGCTGAGGTGG - Intronic
1091713620 12:2760495-2760517 GGGAGGGTCTGGAGCTCAGGAGG + Intergenic
1091897199 12:4115185-4115207 GACAGGGGGTGGAGCTCAGGTGG - Intergenic
1092223138 12:6729133-6729155 GAATGGGAGTGGAGGGCAGGTGG + Intronic
1092513565 12:9184391-9184413 GCATGGGGGTGGGGCACTGGTGG - Intronic
1092728591 12:11507939-11507961 GGAAGGGTGTGGACATCAGGAGG - Intergenic
1095095318 12:38144682-38144704 GGATGGGAGTGGATTTCAGGAGG - Intergenic
1095153907 12:38829281-38829303 GCATGGTTGTGGAGCAAAAGTGG - Intronic
1095323851 12:40863638-40863660 GACAGGGGGTGGAGCTCAGGTGG - Intronic
1095718912 12:45378763-45378785 TTATGGGGGTGGAGATCAGGAGG + Intronic
1096314700 12:50554232-50554254 GCATGGGTGGGTAGCTAAGGTGG - Intronic
1097078617 12:56413210-56413232 GCATGGGAGAGGGGCTGAGGGGG - Intergenic
1097837215 12:64285095-64285117 AGCTGAGTGTGGAGCTCAGGAGG + Intronic
1099306726 12:80966210-80966232 GACAGGGGGTGGAGCTCAGGTGG - Intronic
1102580055 12:113880681-113880703 GCCTGGGAGTGTAGCTCAGTGGG - Intronic
1102870104 12:116407468-116407490 GCCTAGGAGTGGAACTCAGGTGG - Intergenic
1102982586 12:117253798-117253820 TCAAGGGTGTTGACCTCAGGAGG - Intronic
1103860022 12:124004721-124004743 GAAAGGAGGTGGAGCTCAGGAGG - Intronic
1103865353 12:124047422-124047444 GCCAGGAGGTGGAGCTCAGGTGG - Intronic
1104754156 12:131258457-131258479 GCGGGGGGGTGGAGCTCGGGCGG + Intergenic
1104962670 12:132495613-132495635 GCAGGGGTGCGGAGCTGAGCCGG + Intronic
1105215228 13:18280300-18280322 GGAAGGGTATGGAGCCCAGGGGG - Intergenic
1106405622 13:29470521-29470543 GAATGTGTTTGGAGCCCAGGTGG - Intronic
1106600670 13:31183774-31183796 GCAGTGGTGTGGAGTGCAGGTGG - Intergenic
1108093669 13:46878282-46878304 GCTTGCATGTGGAGCTTAGGAGG + Intronic
1110291602 13:73814186-73814208 GTGTGGGTGTGTAGCTCATGTGG - Intronic
1113534069 13:111050287-111050309 GGAGGGGTGTGGAGCTGGGGCGG + Intergenic
1113752074 13:112783462-112783484 TCATGGGTGAGAAGCTCAGCGGG + Intronic
1115021002 14:28681869-28681891 GCCAGGAGGTGGAGCTCAGGTGG + Intergenic
1115767140 14:36634685-36634707 AGATGGGGGTGGACCTCAGGAGG - Intergenic
1118142080 14:63095012-63095034 GCATGGAGGCAGAGCTCAGGTGG + Intronic
1118457812 14:65960668-65960690 GAATAAGTCTGGAGCTCAGGAGG - Intronic
1121351127 14:93173976-93173998 ACATGGGTGTGGATTCCAGGAGG - Intergenic
1121365878 14:93309490-93309512 GCAGGGGTGTGGAGGTTGGGGGG - Intronic
1122062568 14:99146440-99146462 GCAAGGGAGTGGGGGTCAGGAGG - Intergenic
1122386635 14:101352814-101352836 GGATGGCTCTGGAGCACAGGTGG - Intergenic
1122606239 14:102948677-102948699 GGGTGGGTGTGGAGGTGAGGGGG + Intronic
1124629430 15:31328132-31328154 GCCTGGGTGTGGACCGCAGGCGG + Intronic
1125573993 15:40742684-40742706 CCATGGGTGCTAAGCTCAGGAGG + Intronic
1125591528 15:40857335-40857357 GCATGGAAGAGGAGCTCGGGAGG - Exonic
1125715508 15:41817675-41817697 ACATGGATGTGGAGCCCAGCTGG + Exonic
1125719542 15:41838760-41838782 GAGTGGGTGTGGAGCTTAGGTGG + Exonic
1127578144 15:60312615-60312637 GGTTGGGTGTGGAGGTGAGGAGG + Intergenic
1129060106 15:72853937-72853959 ACGTGGATCTGGAGCTCAGGGGG - Intergenic
1129180394 15:73870720-73870742 GCATGGCCCTGGAGCGCAGGAGG - Intergenic
1130048669 15:80465413-80465435 AGAGGGGTGTGGACCTCAGGAGG + Intronic
1131092525 15:89633265-89633287 TCCTGGGTGAGGAGCTCAGTGGG + Exonic
1131399717 15:92114566-92114588 GCATGGGTGTGAATCCAAGGTGG - Intronic
1132457111 16:30044-30066 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1132463448 16:66838-66860 GCATGGGTGAGGGGCCCTGGAGG - Intronic
1132486854 16:197696-197718 GCAGGGCTGTGCACCTCAGGAGG - Intronic
1132699759 16:1217403-1217425 GCCTGGGTGGGGGCCTCAGGAGG - Intronic
1133381124 16:5331412-5331434 TCATGTGTCTGGAGGTCAGGTGG + Intergenic
1135804927 16:25534190-25534212 GAAGGGAGGTGGAGCTCAGGAGG + Intergenic
1135965128 16:27029179-27029201 GCATGGGTGTGGGGATCAATAGG + Intergenic
1136006924 16:27337155-27337177 GCATGGGTGCTGGGCCCAGGTGG + Intronic
1137667637 16:50261109-50261131 GAATGGGTGTGAGACTCAGGTGG - Intronic
1140149597 16:72348811-72348833 GACAGGATGTGGAGCTCAGGTGG + Intergenic
1140370277 16:74409648-74409670 GCCAGGGTGTGGTGGTCAGGAGG + Intronic
1140775779 16:78247787-78247809 GCTTGGGTGAGGAGCACAGGTGG - Intronic
1141424562 16:83936545-83936567 CCGAGGGTGTGGAGCTCTGGGGG - Intronic
1141472786 16:84251024-84251046 GCATGATTGTGGAGCCCAAGGGG + Intergenic
1141816937 16:86417296-86417318 GAATGGGTGTAGAGCTCTGCTGG + Intergenic
1142140009 16:88468686-88468708 CCATGGGGGTGGGGCTCTGGGGG - Intronic
1142431673 16:90031891-90031913 GCATGTGTGTGCAGGTGAGGAGG + Intronic
1142643886 17:1299974-1299996 GCAGGGGTGCAGGGCTCAGGGGG + Exonic
1142977889 17:3656251-3656273 GCAGGGGTGAGGACCCCAGGGGG - Intronic
1143561288 17:7696784-7696806 GCACTGGTGTGGAGTCCAGGAGG + Intronic
1144781306 17:17809868-17809890 GCCTGGGTCTGGGGCTTAGGCGG + Intronic
1146485833 17:33241791-33241813 GCTTGGTTGTGAAGCCCAGGAGG - Intronic
1147550351 17:41437475-41437497 GCTTGGGCGAGGAGCACAGGGGG + Exonic
1147882889 17:43665352-43665374 GGGTGGGTGGGGAGGTCAGGAGG + Intergenic
1148225644 17:45896366-45896388 GGATGGGTGGGGAGCCCTGGCGG + Intronic
1148490814 17:48023367-48023389 GCCTGGGTGTGGGGTGCAGGGGG - Intergenic
1149256897 17:54837017-54837039 GCATGGGAGGGAAGCTGAGGTGG - Intergenic
1150141595 17:62734336-62734358 GGGTGGGTGAGGGGCTCAGGAGG + Intronic
1151758313 17:76087218-76087240 CCCTGGGACTGGAGCTCAGGGGG - Intronic
1152143998 17:78556657-78556679 GCGTGGCTGTGGGGCTCAGCGGG - Intronic
1152163976 17:78689492-78689514 GACAGGATGTGGAGCTCAGGAGG + Intronic
1152716208 17:81902014-81902036 GCATGGGTGGGGAGCTTGAGGGG + Intronic
1152863197 17:82708004-82708026 GCATGGTTGTGGGGCTTGGGGGG + Intergenic
1152961100 18:80565-80587 CTCTGGGTGTGGACCTCAGGAGG - Intergenic
1153716522 18:7855318-7855340 GCATGGGCCTGTGGCTCAGGGGG + Intronic
1154121368 18:11655118-11655140 GTCTGGGAGTGGAGCTCAGGAGG - Intergenic
1155785811 18:29898348-29898370 GCATGGATGGGGAGCCCAGCAGG + Intergenic
1158696363 18:59707564-59707586 GCATGGGTGTGGCTTACAGGAGG + Intergenic
1158787999 18:60739687-60739709 GCATGGGAGGGAAGCTGAGGGGG + Intergenic
1159723155 18:71919197-71919219 GCCTGGGTGTGGAGCAGAGTGGG - Intergenic
1159844215 18:73439645-73439667 GTATGGGTGGGAAGCTCAGCAGG + Intergenic
1161875285 19:6903775-6903797 GAATGGGTGTGGAGCCAAGTTGG - Intronic
1161979674 19:7624021-7624043 GGCTGGGGGTGGGGCTCAGGTGG - Intronic
1162175412 19:8826561-8826583 GCCAGGAGGTGGAGCTCAGGTGG + Intronic
1163267457 19:16229495-16229517 GCATGGCTCTGGAGCTGAGCCGG + Intronic
1163366802 19:16880025-16880047 GCGGGGGTGGGGAGCCCAGGAGG - Exonic
1164725210 19:30461509-30461531 GCCTAAGTGTGGGGCTCAGGGGG - Intronic
1165462823 19:35954101-35954123 GCCTGGATGTGGAGGTCTGGAGG - Intergenic
1166368013 19:42286948-42286970 GCAAGGGTGTGGGGTCCAGGTGG + Intronic
1168405158 19:56106852-56106874 GGAGGTGTGTGGTGCTCAGGTGG - Intronic
925025740 2:605954-605976 GCGTGTGTGTGGGGCTCTGGGGG - Intergenic
925026522 2:611784-611806 GCAAGAGAGTGGGGCTCAGGGGG + Intergenic
925206663 2:2013216-2013238 GCAGGAGTGAGTAGCTCAGGAGG - Intronic
925388613 2:3480867-3480889 GCATGGGGGTGGGGCTTGGGAGG - Intronic
925955004 2:8954859-8954881 GCCTGGGAGTGGAGCAGAGGCGG + Intronic
926401217 2:12499035-12499057 ACATGGGTATGGATTTCAGGAGG + Intergenic
926819409 2:16836073-16836095 GCATTGGAGTAGAGCTAAGGAGG + Intergenic
927190209 2:20512181-20512203 GCATGTGTGTGAGGCTCAGCTGG + Intergenic
927492969 2:23532693-23532715 GCATGGGGGTGGGTGTCAGGTGG + Intronic
928428811 2:31201066-31201088 ACATGCATGTGGAGGTCAGGGGG - Intronic
930534023 2:52624926-52624948 CCATGCATGTGCAGCTCAGGGGG - Intergenic
931834308 2:66082721-66082743 GCATGGCTGTGGGGACCAGGAGG + Intergenic
931868897 2:66439247-66439269 GAATGTGCGTGGAGCTGAGGAGG + Intronic
932038424 2:68272349-68272371 ACATGGGGGTGTAGTTCAGGAGG - Intergenic
932090718 2:68803867-68803889 GAATGGGTGGGGAGCTCAACAGG + Intronic
933647690 2:84825783-84825805 GAGAGGATGTGGAGCTCAGGTGG - Intronic
934299092 2:91766437-91766459 GGAAGGGTATGGAGCCCAGGGGG + Intergenic
935518802 2:104078500-104078522 GCATGGGAGGGAAGCTGAGGGGG - Intergenic
936543902 2:113373891-113373913 GCAGGGGTGGGGACCTCATGGGG - Intergenic
936820225 2:116510980-116511002 GCCTGGGTGTGGAGCATAGGAGG + Intergenic
940404375 2:153283929-153283951 GCCTGGGTGTGGAGCTGAGAGGG + Intergenic
941018115 2:160379917-160379939 GGCTGGGTGTGGAGATCAGTGGG + Intronic
942810037 2:179988100-179988122 GCCAGGAGGTGGAGCTCAGGCGG + Intronic
943912297 2:193584295-193584317 GCCTGGGTGTGGAGCAGAGATGG - Intergenic
945836947 2:214845166-214845188 GCATGAGTCTAGTGCTCAGGAGG - Intergenic
946043761 2:216804047-216804069 GAGTGGGGGTGGAGCTCATGGGG + Intergenic
946305367 2:218854000-218854022 AAATGGGTCTGGAGCTCAGAGGG - Intergenic
946331163 2:219009892-219009914 GGATGGGTCTGGAGCTCTGATGG + Intronic
946422559 2:219572695-219572717 GCATGGGTTTGCAGGCCAGGCGG + Intronic
948113946 2:235479802-235479824 GCATGGGGGTGGACCTCAACCGG - Intergenic
1169150390 20:3285010-3285032 GAATGGGAGTGGAGGGCAGGAGG - Intronic
1170004125 20:11646955-11646977 GCATGGGGGAGAAGCTGAGGTGG + Intergenic
1172122409 20:32606240-32606262 GTGTGGCTTTGGAGCTCAGGGGG - Intronic
1172444794 20:34987399-34987421 GTAAGGGTTTGGAGCTGAGGAGG - Intronic
1172776966 20:37413524-37413546 TGATGGGTGTGGGGCCCAGGAGG - Intergenic
1173422916 20:42918552-42918574 GCGTGGGTGAGGAGAGCAGGTGG - Intronic
1174351895 20:49974444-49974466 GCTAGGGTGGGGAGCTCAAGGGG + Intergenic
1175460508 20:59148864-59148886 GCAGGGGTGTTGTGGTCAGGAGG - Intergenic
1175966845 20:62664206-62664228 GCATGGGCCTGGAGCCCTGGGGG - Intronic
1176090774 20:63317743-63317765 CCATGGGGGCGGAGCACAGGGGG - Intronic
1179452099 21:41474289-41474311 GCATGAGTGAGGAGGTGAGGGGG + Intronic
1179491099 21:41742064-41742086 GCCTGGCTGTGGCGCTCAGGTGG + Intronic
1179997752 21:44981776-44981798 GCCTGCGTGTGGTGTTCAGGGGG + Intergenic
1179997770 21:44981833-44981855 GCCTGCGTGTGGTGTTCAGGGGG + Intergenic
1179997787 21:44981890-44981912 GCCTGCGTGTGGTGTTCAGGGGG + Intergenic
1179997867 21:44982176-44982198 GCCTGCGTGTGGTGTTCAGGGGG + Intergenic
1180174912 21:46082744-46082766 GCAGGGGAGAGAAGCTCAGGAGG + Intergenic
1181419092 22:22785607-22785629 GCAGGGGTGTGGAGGCCAGGGGG - Intronic
1183588391 22:38766354-38766376 GCTTGGCTGAGGAGCTCCGGTGG + Intronic
1184057100 22:42059984-42060006 TGATGGGCATGGAGCTCAGGAGG + Exonic
1184399302 22:44264522-44264544 GCAGGGGTTTGGGGCACAGGTGG + Intronic
1184735967 22:46398033-46398055 GGCTGGGTGAGGAGCTCAGAGGG + Intronic
1185399310 22:50607761-50607783 CCATGGGTCTGGAGTTTAGGAGG + Intronic
950414293 3:12859862-12859884 GGATAGGTGGGGACCTCAGGAGG - Intronic
951325409 3:21296894-21296916 GCCTGGGTGTGGAGTGGAGGGGG - Intergenic
953125825 3:40090958-40090980 TCTTGGGTGTGGACTTCAGGAGG + Intronic
953740821 3:45537719-45537741 GCAGGGGTGAGGAGATGAGGTGG + Intronic
953925547 3:46980639-46980661 AGATGGGTGGGGAGCTCAGGAGG - Intronic
954409671 3:50364975-50364997 GCATGGGTGGGGAGTCAAGGAGG + Intronic
956581428 3:70818415-70818437 GATGGGGGGTGGAGCTCAGGTGG - Intergenic
957091994 3:75740098-75740120 GCACGGCTGTGGATCTCAGAAGG - Intronic
957401592 3:79722447-79722469 GAATGGCTGTGGACCTCAGGAGG - Intronic
957632853 3:82740535-82740557 GCACAGATGTGGAGCTCTGGTGG + Intergenic
958498441 3:94875020-94875042 GCATGGGAGGGGGGCTGAGGAGG - Intergenic
960994797 3:123333622-123333644 GCCTGGGTGTGTGCCTCAGGAGG + Intronic
961504104 3:127358848-127358870 GCAAGAGTGTGGAGCACAGCTGG + Intergenic
964014002 3:151924779-151924801 GCATGGTTGTGGTGCTCAGCAGG + Intergenic
965272688 3:166638706-166638728 GCATAGGAGTGAAGCTGAGGTGG + Intergenic
966830733 3:184006132-184006154 CGATTGGTGTGGAGCCCAGGTGG - Intronic
966930255 3:184671405-184671427 GCATGGTTGGGGAGCTGAGGAGG + Intronic
966930387 3:184671968-184671990 GCATGGTTGGGGAGCTGAGGAGG + Intronic
968581986 4:1399448-1399470 GCATGGGTGGGGAGCACAGGGGG + Intergenic
968959408 4:3735320-3735342 GGATGGGCCTGGAGCTCTGGAGG + Intergenic
971841272 4:31855749-31855771 GCATGTGGGTGGAGGTCAGGAGG - Intergenic
972383088 4:38537013-38537035 ACTTGGGTGTGGAGCACAGTGGG - Intergenic
972410041 4:38784366-38784388 GACAGGGTGTGGAGCTCAGGTGG - Intergenic
974437641 4:61877012-61877034 GCAAAGGTGAGGAGCTCAAGTGG + Intronic
974562606 4:63541282-63541304 GCTTGGGTGTGGAGCAGAGAAGG - Intergenic
975753895 4:77552927-77552949 GCATGGGCGTGGAGCAGAGAAGG + Intronic
976426768 4:84913098-84913120 GCATAGGTGTTGAACTCATGAGG - Intronic
977650026 4:99458842-99458864 GCATGGCCGAGGAGCACAGGAGG + Intergenic
978360056 4:107921887-107921909 GAAAGGAGGTGGAGCTCAGGTGG + Intergenic
979737408 4:124104562-124104584 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
981616235 4:146647737-146647759 GCCTGCCTGCGGAGCTCAGGCGG + Intergenic
982611012 4:157574667-157574689 GCATGGGAGGGAAGCTGAGGGGG + Intergenic
982678558 4:158403325-158403347 GAAAGGAGGTGGAGCTCAGGCGG - Intronic
985945083 5:3175628-3175650 GCAGGGGTGTGGAGCCCCAGAGG + Intergenic
986290230 5:6393861-6393883 GCATGAGTGTGCAGGTAAGGAGG + Intergenic
986471574 5:8081581-8081603 GCAGGGGAGTGGAGCACAGGGGG + Intergenic
986686846 5:10282335-10282357 GCATGGGTGTGGGGATCATGTGG - Intronic
986686852 5:10282357-10282379 GCATGAGTGTGGGGATCATGCGG - Intronic
987249168 5:16080924-16080946 GCCTGTGGGTGGAGCTCGGGAGG - Intronic
987280311 5:16407161-16407183 AGATGGGTGAGGAGCTGAGGGGG + Intergenic
987669772 5:20991183-20991205 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
989405566 5:41057181-41057203 GAATGGGGGTGGAAATCAGGTGG + Intronic
990555053 5:56924694-56924716 GTTTGGGTGTGGAGCCAAGGTGG - Intronic
990788594 5:59451424-59451446 GTATGTGTCTGGAGCTCAGGAGG - Intronic
991359343 5:65803337-65803359 GCATGGGAGGGAAGCTGAGGGGG - Intronic
992085020 5:73270490-73270512 ACAGGGATGTGCAGCTCAGGAGG - Intergenic
992868664 5:80983379-80983401 GCATGGTTGTGGGGCTCACTGGG + Intronic
994824734 5:104698692-104698714 GCCTGGGTGTGGAGCAGAGAGGG - Intergenic
994938238 5:106284536-106284558 GACAGGGGGTGGAGCTCAGGTGG + Intergenic
995492910 5:112711164-112711186 GCCAGGAGGTGGAGCTCAGGTGG - Intronic
996837914 5:127814396-127814418 CCCAGAGTGTGGAGCTCAGGAGG + Intergenic
997421203 5:133768147-133768169 TCCTGGGTGTGGACCCCAGGAGG - Intergenic
997454626 5:134007542-134007564 GAATGGAGGTGGGGCTCAGGGGG - Intergenic
997518340 5:134506369-134506391 GCCAGGGTGTGGGGCCCAGGAGG + Intergenic
997783645 5:136685735-136685757 GCATGGGTGTGGAGTGGAGATGG - Intergenic
998130822 5:139650293-139650315 GGATGGGGGGGGAGCTAAGGGGG + Intronic
998205760 5:140155820-140155842 ACATGGGGTTGGAGCACAGGGGG - Intergenic
999209684 5:149877217-149877239 GAATGGGGGTGGGGTTCAGGGGG + Intronic
999709245 5:154301856-154301878 GGGTGGGAGTGGAGCTAAGGAGG + Intronic
1000393577 5:160749786-160749808 GCATGTGTGTGGATCACAGGAGG + Intronic
1001031810 5:168268779-168268801 GCAGGGGATTGGAGCTCAGCGGG + Intergenic
1001298210 5:170514181-170514203 GCATGGGTGAGGAGCTGATGGGG - Intronic
1002434820 5:179224817-179224839 GTCTGGGCGTGGAGCTGAGGTGG - Intronic
1002542058 5:179912973-179912995 GGATGGGTGGGGAACTGAGGAGG + Intronic
1002782303 6:376526-376548 GCAGGGGTGAGGGGCTTAGGGGG + Intergenic
1003691165 6:8355029-8355051 GGATGGGTTTGGAGTTCAGAAGG + Intergenic
1003813001 6:9805249-9805271 AAATGGTTGTGAAGCTCAGGAGG - Intronic
1004319517 6:14621560-14621582 GCATGGGTGTGGTGAGCTGGGGG - Intergenic
1004444524 6:15685825-15685847 GCATGGGTCTGAAGTTCAGGTGG - Intergenic
1006608149 6:35274408-35274430 GCTTGTGTGTGGAGCGCAGTAGG + Intronic
1007111384 6:39315100-39315122 GCAAGGCTGTGGAGCCAAGGCGG - Exonic
1007776723 6:44228176-44228198 GCCTGGGAATGGAGCACAGGAGG - Intronic
1012407981 6:98922937-98922959 GCATGTGAATGGAGTTCAGGTGG - Intronic
1012425386 6:99108506-99108528 TGACGGGGGTGGAGCTCAGGCGG + Intergenic
1014129995 6:117819899-117819921 CCAGGGATGTGGAACTCAGGAGG - Intergenic
1015243634 6:131053524-131053546 GAAGGGCTGTGGAGCTCAGGGGG - Intronic
1016450320 6:144175793-144175815 CCACGGGTGTGGAAGTCAGGTGG - Intronic
1018447144 6:163868056-163868078 GCCTGGGTGAGGAGCTGGGGAGG + Intergenic
1018865795 6:167746206-167746228 GCATGAGTGTGGAGCCTGGGAGG - Intergenic
1019064239 6:169282512-169282534 GAATGGCTGGGTAGCTCAGGAGG - Intergenic
1020555890 7:9669877-9669899 GCATGGGGGTGGAGCTGAGGTGG - Intergenic
1022468817 7:30669302-30669324 GCTGGAGTGTGGGGCTCAGGCGG - Intronic
1022472969 7:30693001-30693023 GGGTGGCTGTGGGGCTCAGGAGG + Intronic
1022813607 7:33893084-33893106 GTGGGGGTGTGGAGCTGAGGAGG - Intergenic
1025054983 7:55758020-55758042 GACAGGATGTGGAGCTCAGGTGG + Intergenic
1026053486 7:66965951-66965973 GACAGGGGGTGGAGCTCAGGTGG + Intergenic
1026665220 7:72336014-72336036 GGATGGGTCTGGCGCCCAGGTGG - Intronic
1028333223 7:89622408-89622430 GCCTGGGTGTGGAGCGGACGGGG - Intergenic
1029564889 7:101330102-101330124 GCTTGGGTGTGGAGCAGAGCTGG + Intergenic
1032128660 7:129212149-129212171 GCAGGGGGGTGAAGCTCAGGGGG - Exonic
1034266301 7:149782698-149782720 GCAGGGGTAGGGAGCTCAGGTGG + Intergenic
1034459672 7:151191499-151191521 AAATGTGTGTGGAGCTCAGCTGG - Intronic
1034462557 7:151205906-151205928 GGAGGGCTGTGGGGCTCAGGAGG - Intergenic
1035280523 7:157775630-157775652 GCCTGGGTGTGGGGCTGAGGCGG + Intronic
1035527499 8:325296-325318 AGCTGGGTGTGGAGATCAGGGGG - Intergenic
1035684975 8:1517331-1517353 GAACGGATGTGGAGCCCAGGAGG + Intronic
1035920270 8:3668711-3668733 GGATGAGTTGGGAGCTCAGGAGG + Intronic
1036816083 8:11903722-11903744 ACATTTGTGTGGATCTCAGGAGG - Intergenic
1037024516 8:14017178-14017200 GCATGGATGTGGGGCTCAGGTGG + Intergenic
1037129353 8:15389032-15389054 GACTGGAGGTGGAGCTCAGGCGG + Intergenic
1038416575 8:27400796-27400818 GCGTGGGTCTGGAGCTCAGGAGG + Intronic
1038491843 8:27977173-27977195 TCATGGGGGTGGAGCCCACGTGG - Intronic
1038950061 8:32404309-32404331 ACATGAGTGTGCAGATCAGGTGG - Intronic
1039149484 8:34487940-34487962 GCATGGTTGTGTAGATCAAGGGG - Intergenic
1039407268 8:37324084-37324106 GCATGGGTGTGGAGGCCAAGAGG + Intergenic
1040092251 8:43410171-43410193 GCAGGGCTGTGGAGCTCCTGGGG + Intergenic
1040400379 8:47044184-47044206 GCAGGGCTGTGGAGCTCCTGGGG - Intergenic
1043484177 8:80682666-80682688 GCATAGGTGTGGAGAGAAGGGGG - Intronic
1045647823 8:104316553-104316575 GCATGGGTGGGGAGCACAGGTGG + Intergenic
1046593322 8:116231401-116231423 GCATGGGGGTGTAGCAGAGGAGG - Intergenic
1048413913 8:134205097-134205119 GCATGAGGATGGAGCTCAAGTGG - Intergenic
1048848237 8:138619955-138619977 GCTTAGGTGTGGCGCTCAGCTGG - Intronic
1049217902 8:141416069-141416091 GCAAGGGGGTGGAGCCCGGGTGG + Intronic
1049326155 8:142022551-142022573 GCTCAGGTGTGGAGCTCAGGTGG + Intergenic
1049326169 8:142022606-142022628 GCTCAGGTGTGGAGCTCAGGTGG + Intergenic
1049520791 8:143089152-143089174 GCACAGGTGGGGAGCTCTGGGGG + Intergenic
1049531800 8:143158979-143159001 GGATGGGTGGGGGGCGCAGGGGG - Intronic
1049534183 8:143170461-143170483 GCAGGGGCGTGGAGCACTGGGGG - Intergenic
1050948664 9:11559930-11559952 GCATGGATGTGCAGGGCAGGAGG + Intergenic
1052783196 9:32802080-32802102 GCAGGAGGCTGGAGCTCAGGTGG + Intergenic
1053275267 9:36778750-36778772 GAATGTGTGTGTTGCTCAGGAGG + Intergenic
1053293052 9:36894745-36894767 GGGTGGCTGTGGAGCGCAGGAGG - Intronic
1057214621 9:93220954-93220976 GGATGGGTGGGCAGCCCAGGAGG - Intronic
1059246894 9:112856459-112856481 GCATGGGTGTGGAGGGGAGTGGG + Intronic
1062181363 9:135192904-135192926 GCCTGGGTGTCAAGTTCAGGAGG - Intergenic
1062466228 9:136682828-136682850 GCCTGGGGGCTGAGCTCAGGCGG - Intronic
1062737061 9:138143421-138143443 CTCTGGGTGTGGACCTCAGGAGG + Intergenic
1185853672 X:3512374-3512396 GCCAGGAGGTGGAGCTCAGGAGG + Intergenic
1185971545 X:4670824-4670846 GCCAGGAGGTGGAGCTCAGGTGG - Intergenic
1186610854 X:11136953-11136975 GCTTGGTTGTGGATCGCAGGTGG - Intergenic
1190010897 X:46783766-46783788 GCATGGGGGTGGGGCTGATGGGG + Intergenic
1191008492 X:55737169-55737191 GCCTGGGAGAGGAGCTGAGGTGG - Intronic
1191038815 X:56057144-56057166 GCATGGGGTTGGAGCTCTGGGGG + Intergenic
1192074800 X:67982517-67982539 GCTTGGTAGTGGAGCTGAGGGGG + Intergenic
1192326796 X:70139496-70139518 GTATGGGTCTGAAGGTCAGGAGG - Intronic
1193276092 X:79589977-79589999 GCATGGATGTGGGGCACTGGAGG + Intergenic
1193779211 X:85682658-85682680 GCCTGGGTGTGGAGCAGAGAGGG + Intergenic
1195159218 X:102155176-102155198 GCATGGGAGTGGGGATCGGGTGG - Intronic
1195734738 X:108000797-108000819 GCATGGGGGTGGAGCAGAGAGGG - Intergenic
1195734821 X:108001242-108001264 GCCTGGGTGTGGAGTGCAGAGGG - Intergenic
1196187278 X:112757912-112757934 ATATGGGTCTGAAGCTCAGGAGG - Intergenic
1196267318 X:113665634-113665656 GACAGGGAGTGGAGCTCAGGAGG - Intergenic
1196613775 X:117743675-117743697 GCCTGGGTGTGGAGTCCAGAGGG - Intergenic
1196948629 X:120853483-120853505 GCATGGGGGTGGAGGTCAAGGGG + Intergenic
1198562745 X:137868481-137868503 TCATGGGTGTGGTTCTGAGGTGG - Intergenic
1200273763 X:154712556-154712578 CCATGGCAGTGGAGCTCAGGAGG - Exonic
1200399248 X:156009682-156009704 CTCTGGGTGTGGACCTCAGGAGG + Intronic
1200809773 Y:7472140-7472162 GCCAGGAGGTGGAGCTCAGGAGG - Intergenic
1201858682 Y:18572122-18572144 GCATGGGGGAGGAGCTCACATGG - Intronic
1201874639 Y:18748259-18748281 GCATGGGGGAGGAGCTCACATGG + Intronic