ID: 1082005380

View in Genome Browser
Species Human (GRCh38)
Location 11:47416115-47416137
Sequence GGATGCTCCTGCCAGCACAG GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 221}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082005370_1082005380 9 Left 1082005370 11:47416083-47416105 CCAGGCCAGAGAGGCCTCCCGGT 0: 1
1: 0
2: 0
3: 24
4: 216
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005371_1082005380 4 Left 1082005371 11:47416088-47416110 CCAGAGAGGCCTCCCGGTCCAGC 0: 1
1: 0
2: 0
3: 24
4: 191
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005374_1082005380 -5 Left 1082005374 11:47416097-47416119 CCTCCCGGTCCAGCTCAGGGATG 0: 1
1: 0
2: 0
3: 20
4: 153
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005376_1082005380 -9 Left 1082005376 11:47416101-47416123 CCGGTCCAGCTCAGGGATGCTCC 0: 1
1: 0
2: 0
3: 15
4: 195
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005375_1082005380 -8 Left 1082005375 11:47416100-47416122 CCCGGTCCAGCTCAGGGATGCTC 0: 1
1: 0
2: 3
3: 22
4: 209
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005365_1082005380 26 Left 1082005365 11:47416066-47416088 CCGGGCAGGGAGCAGCCCCAGGC 0: 1
1: 0
2: 7
3: 94
4: 614
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005368_1082005380 10 Left 1082005368 11:47416082-47416104 CCCAGGCCAGAGAGGCCTCCCGG 0: 1
1: 0
2: 2
3: 22
4: 285
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005363_1082005380 30 Left 1082005363 11:47416062-47416084 CCTGCCGGGCAGGGAGCAGCCCC 0: 1
1: 0
2: 3
3: 54
4: 589
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221
1082005367_1082005380 11 Left 1082005367 11:47416081-47416103 CCCCAGGCCAGAGAGGCCTCCCG 0: 1
1: 0
2: 1
3: 14
4: 265
Right 1082005380 11:47416115-47416137 GGATGCTCCTGCCAGCACAGGGG 0: 1
1: 0
2: 2
3: 26
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082005380 Original CRISPR GGATGCTCCTGCCAGCACAG GGG Exonic