ID: 1082005831

View in Genome Browser
Species Human (GRCh38)
Location 11:47418510-47418532
Sequence TCCTCTGTGCAGGAACTGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082005821_1082005831 22 Left 1082005821 11:47418465-47418487 CCAGACACCAAAATGCCGAAAGT No data
Right 1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG No data
1082005826_1082005831 7 Left 1082005826 11:47418480-47418502 CCGAAAGTGAAAGGGTGGCTTCT No data
Right 1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG No data
1082005823_1082005831 15 Left 1082005823 11:47418472-47418494 CCAAAATGCCGAAAGTGAAAGGG No data
Right 1082005831 11:47418510-47418532 TCCTCTGTGCAGGAACTGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082005831 Original CRISPR TCCTCTGTGCAGGAACTGCA GGG Intergenic
No off target data available for this crispr