ID: 1082006741

View in Genome Browser
Species Human (GRCh38)
Location 11:47423464-47423486
Sequence CTGCCATATACTCCCGTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082006741_1082006745 -4 Left 1082006741 11:47423464-47423486 CCAGGAACGGGAGTATATGGCAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1082006745 11:47423483-47423505 GCAGAAAAGACACCGGGCCAGGG 0: 1
1: 1
2: 1
3: 17
4: 164
1082006741_1082006748 2 Left 1082006741 11:47423464-47423486 CCAGGAACGGGAGTATATGGCAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1082006748 11:47423489-47423511 AAGACACCGGGCCAGGGGCTGGG 0: 1
1: 0
2: 1
3: 24
4: 283
1082006741_1082006744 -5 Left 1082006741 11:47423464-47423486 CCAGGAACGGGAGTATATGGCAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1082006744 11:47423482-47423504 GGCAGAAAAGACACCGGGCCAGG 0: 1
1: 0
2: 2
3: 22
4: 201
1082006741_1082006747 1 Left 1082006741 11:47423464-47423486 CCAGGAACGGGAGTATATGGCAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1082006747 11:47423488-47423510 AAAGACACCGGGCCAGGGGCTGG 0: 1
1: 0
2: 0
3: 18
4: 238
1082006741_1082006746 -3 Left 1082006741 11:47423464-47423486 CCAGGAACGGGAGTATATGGCAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1082006746 11:47423484-47423506 CAGAAAAGACACCGGGCCAGGGG 0: 1
1: 0
2: 0
3: 24
4: 236
1082006741_1082006750 10 Left 1082006741 11:47423464-47423486 CCAGGAACGGGAGTATATGGCAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1082006750 11:47423497-47423519 GGGCCAGGGGCTGGGAGCAGTGG 0: 1
1: 1
2: 30
3: 381
4: 2644
1082006741_1082006743 -10 Left 1082006741 11:47423464-47423486 CCAGGAACGGGAGTATATGGCAG 0: 1
1: 0
2: 0
3: 6
4: 61
Right 1082006743 11:47423477-47423499 TATATGGCAGAAAAGACACCGGG 0: 1
1: 0
2: 4
3: 12
4: 241

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082006741 Original CRISPR CTGCCATATACTCCCGTTCC TGG (reversed) Intronic