ID: 1082009099

View in Genome Browser
Species Human (GRCh38)
Location 11:47438332-47438354
Sequence GAGTCAGAGAGGCCCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082009099_1082009105 3 Left 1082009099 11:47438332-47438354 CCTTTGAGGGGCCTCTCTGACTC 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1082009105 11:47438358-47438380 TTTGGGGATTATGAAAAGAATGG 0: 1
1: 0
2: 3
3: 42
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082009099 Original CRISPR GAGTCAGAGAGGCCCCTCAA AGG (reversed) Intronic
901678051 1:10898321-10898343 GGGTCAGAGGGCCCCCTCAAGGG + Intergenic
905248486 1:36630855-36630877 GGTGCAGAGAGGCCCCTGAAAGG - Intergenic
907831979 1:58073333-58073355 GAGTCAGAGAGGACTTTCCAGGG - Intronic
910900460 1:92114994-92115016 GCATCAGAGGGGGCCCTCAAGGG - Intronic
913227656 1:116714026-116714048 GCATCAGAGGGCCCCCTCAAGGG - Intergenic
913609067 1:120492995-120493017 GGGTCAGAGATGTCCCTCCAGGG + Intergenic
914204760 1:145517454-145517476 GGGTCAGAGATGTCCCTCCAGGG - Intergenic
914370802 1:147022773-147022795 GGGTCAGAGATGTCCCTCCAGGG + Intergenic
914483883 1:148090641-148090663 GGGTCAGAGATGTCCCTCCAGGG - Intergenic
914582124 1:149028844-149028866 GGGTCAGAGATGTCCCTCCAGGG - Intronic
914959218 1:152191380-152191402 GGCTCAGAGAGGCAGCTCAAGGG - Intergenic
915105821 1:153534648-153534670 GACTCAGAGAGGACCCCCAGAGG + Exonic
916957114 1:169850136-169850158 GAGTCCCAGAGGATCCTCAAAGG - Intronic
918038010 1:180894314-180894336 GAGTCATAGAGGACTCTGAAAGG - Intergenic
918549321 1:185722777-185722799 GAGCCAGAGAAGCCCATGAAGGG + Intergenic
919724299 1:200872331-200872353 GGGTCAGAGAAGCCACTCATAGG + Intergenic
921478221 1:215634899-215634921 GTGTCAGCAAGGCCTCTCAAGGG - Intronic
923437427 1:233980471-233980493 GAGTCAGAAAGTCCCTGCAAGGG - Intronic
924850327 1:247822597-247822619 GAGGCAGAGAGGTCCCAGAAAGG - Intergenic
1064677965 10:17780823-17780845 GAGACAGAGGGGCTCCTAAATGG + Intronic
1070559506 10:77555216-77555238 GAGTCAGACGGCCCCCTCACAGG + Intronic
1071232991 10:83610907-83610929 GAGTCAGTGAGGACCCTGAATGG + Intergenic
1073096237 10:100981686-100981708 GCTTCAGAGAGGTCCCTCATGGG - Intronic
1081762457 11:45585759-45585781 TAATCAGAGAGACGCCTCAAAGG - Intergenic
1082009099 11:47438332-47438354 GAGTCAGAGAGGCCCCTCAAAGG - Intronic
1084011150 11:66349170-66349192 GAGCCAGGGAGGCCCCTATAGGG + Intronic
1084696772 11:70760615-70760637 GATTCATCGAGTCCCCTCAAGGG - Intronic
1085082606 11:73646875-73646897 GGGTCGGAAAGGCCCCTCTAGGG - Intronic
1086497638 11:87420894-87420916 GAGGCAGAGAGGCTTCTCCAGGG - Intergenic
1089282930 11:117387062-117387084 GAGTCAAAGAGGTCACCCAAGGG - Intronic
1091568858 12:1667229-1667251 GAGACAGAGAGTCCCCTGAGAGG + Intergenic
1092193928 12:6537851-6537873 GCGTCGGAGGGCCCCCTCAAGGG + Exonic
1099274015 12:80552190-80552212 GTGTCAGAAAGGTCCATCAAGGG + Intronic
1099781419 12:87200545-87200567 GAGTCACAGAGTGCCCTGAAAGG + Intergenic
1100460292 12:94792888-94792910 CAGGCAGGGAGGCCCCTCAGTGG - Intergenic
1100716782 12:97314236-97314258 AAGTCAGAGAGGGCCATCAAAGG - Intergenic
1101455619 12:104827327-104827349 GAGACAGGGAGGCCCAGCAAAGG + Intronic
1103890066 12:124231995-124232017 GAGCCGGAGAGGCCCCTGGAAGG - Intronic
1104758415 12:131282955-131282977 GAGTCAGACAGCACCCCCAAGGG + Intergenic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1113023997 13:105920619-105920641 GAGTCAGGGAGGCTCCAAAACGG - Intergenic
1113596720 13:111538972-111538994 GAGGCGGAGAAGCCTCTCAAAGG - Intergenic
1117715306 14:58574167-58574189 GAGTCTAAGAAGCCCCTCGATGG + Intergenic
1121605415 14:95236630-95236652 TAGTCACACAGGCCCCCCAATGG - Intronic
1123977499 15:25567067-25567089 AAGTGAGAGGGGCGCCTCAATGG - Intergenic
1125747782 15:42008826-42008848 GTGTCAGAGAGTCCTCTCGATGG + Intronic
1127524481 15:59778773-59778795 GACTTACAGAGGCCCCTCCATGG - Intergenic
1128792136 15:70441247-70441269 GGGTAAGAGAGGCTGCTCAAAGG + Intergenic
1129092660 15:73167477-73167499 GAGGCCCATAGGCCCCTCAAGGG + Intronic
1132748349 16:1446207-1446229 GAGGCAGAGGGGCCCTTCCAGGG + Exonic
1132850545 16:2023105-2023127 GAGGCAGAGAAGCCTCTCATGGG - Intergenic
1133292057 16:4728797-4728819 CAGTCAGTACGGCCCCTCAAAGG - Intronic
1133926550 16:10197584-10197606 GAGCCAGAAAGCCGCCTCAAGGG - Intergenic
1134507606 16:14820931-14820953 AAGTCAGGGAGGCCCCTTAGGGG + Intronic
1134692119 16:16197825-16197847 GTGTCAGAGAGGCACATGAAAGG - Intronic
1134695304 16:16219693-16219715 AAGTCAGGGAGGCCCCTTAGGGG + Intronic
1134976528 16:18574993-18575015 AAGTCAGGGAGGCCCCTTAGGGG - Intergenic
1138212118 16:55172345-55172367 GGGTCAGAAAGGCCACTCAGAGG - Intergenic
1141920831 16:87134314-87134336 GAGGCAGCCAGGCCCCTCCAGGG + Intronic
1142133197 16:88440229-88440251 GGGTCAGGGAGGCCCCACCATGG + Exonic
1142140089 16:88468924-88468946 CAGACAGCGAGGCCCCTAAAAGG - Intronic
1142901541 17:3015212-3015234 GAGTGAGAGATGTCCCTCCAGGG + Intronic
1142901543 17:3015225-3015247 GAGTCAAAGATGCCCCTGGAGGG - Intronic
1145047597 17:19630169-19630191 GAGACAGCCAGGCCCCTCTAAGG - Intergenic
1146884557 17:36462434-36462456 GGGGCAGAGCAGCCCCTCAAGGG + Intergenic
1147638244 17:41977162-41977184 GAGTCAGAGGGGCCCATGAGCGG - Exonic
1148193369 17:45695830-45695852 GAGTGAGGGAGGCCCCTCCTGGG + Intergenic
1148209281 17:45798608-45798630 GAGTCACACACGCCCCTCCAAGG - Intronic
1150003879 17:61457726-61457748 GAGGCAGAGAGGCCTCCCACAGG - Intronic
1151752837 17:76050873-76050895 CAGTCTGTAAGGCCCCTCAAGGG - Intronic
1155037792 18:22039801-22039823 GAAGCAGAGAGTCCCATCAATGG - Intergenic
1156636644 18:39038876-39038898 GAGTAAGACAGTACCCTCAAAGG + Intergenic
1160393928 18:78558494-78558516 GAGCCACAGGGGACCCTCAAAGG - Intergenic
1160492236 18:79348048-79348070 GAGTTAGCGAGGCCCCTGAGAGG + Intronic
1161545719 19:4878738-4878760 GAGAATGAGAGGCCCCTCCACGG + Intergenic
1162252234 19:9455305-9455327 GAGTAAGAGTGTCCCATCAATGG - Intergenic
1162717665 19:12644097-12644119 GAGCCAGAGAGGCCCGAGAAGGG - Intronic
1163549451 19:17957462-17957484 AAGTCAGAGAGGCCTCTCTAGGG + Intronic
1163557206 19:17999583-17999605 GGGTCAGAGAGACCCTTCAGGGG + Exonic
1164840965 19:31391747-31391769 GAGTCTGAGAGGACCCTCCAGGG + Intergenic
1167747300 19:51359457-51359479 GAGTCAGGGAGGCTTCTGAAGGG + Intronic
926841369 2:17084175-17084197 GAGTCATAGTGGCCTCTCCATGG - Intergenic
929261520 2:39871491-39871513 AACACAGAGAGGCCCCTCATTGG - Intergenic
930030582 2:47056027-47056049 GAGTCAGCGAGGCCACTCTCAGG + Intronic
930845391 2:55898157-55898179 GAGTTAAATAGGCCCTTCAATGG - Intronic
932824905 2:74930276-74930298 GATTCAGAAAGGCCCCAAAAAGG - Intergenic
934949696 2:98567772-98567794 GAGTCAGGGATGGCCCCCAAGGG + Intronic
937159967 2:119751200-119751222 GATTCTGAGATGCCCCTCATGGG + Intergenic
937255405 2:120551985-120552007 GAAGCAGAGAGTCCCCGCAAAGG - Intergenic
947717933 2:232351214-232351236 GGGGCAGAGAGGCCCCGCACAGG + Intergenic
1168966056 20:1898700-1898722 GAGTGAGAGAGGCCCCTTTCTGG + Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1172643609 20:36456424-36456446 GAGGCTGAGAGGCCACTCACAGG + Intronic
1172882164 20:38209082-38209104 GAGCCAGAGAGTCCCCTGTAGGG - Intergenic
1174540900 20:51288551-51288573 GGGCCATAGAGGCCCTTCAAGGG - Intergenic
1175756515 20:61533589-61533611 CAGCCAGAGGGGCCCCTCATGGG - Intronic
1178683124 21:34689947-34689969 GAGTCAGAATGGCTCCTAAAAGG - Intronic
1178941806 21:36912883-36912905 CACTAAGAGAGGCCACTCAAAGG + Intronic
1180155847 21:45977170-45977192 GAGTCAGAGAGGCCCTGCCAGGG + Intergenic
1181458064 22:23070701-23070723 GCGTCAGGGATGCCCCTCAGGGG + Intronic
1184148217 22:42623764-42623786 GAGTGAGGGAGGCCCCTCACTGG - Intronic
951707320 3:25556406-25556428 GACTGAGAGTGACCCCTCAATGG + Intronic
952243146 3:31555016-31555038 GAGGCAGAGAGGCCAGTCAGTGG - Intronic
952729011 3:36619622-36619644 GAGTCAGGATGGCCCCTCACTGG + Intergenic
952916798 3:38252544-38252566 GAGGAAGAGTGGCCACTCAAAGG - Intronic
953094823 3:39765213-39765235 GAGTCTGGGAGGCCCCTAAAAGG - Intergenic
954333845 3:49904796-49904818 GAGTCAGAGAGGCACGTAAGTGG + Intronic
954520286 3:51219078-51219100 GAGTCAGAGGGTCCTCTAAAAGG - Intronic
961045325 3:123704060-123704082 GACTCAGACAAGCCTCTCAAGGG + Intronic
962278158 3:134030800-134030822 GAGACAGTGAGGCTTCTCAAGGG + Intronic
964529492 3:157651740-157651762 CTCTCACAGAGGCCCCTCAATGG - Intronic
965849693 3:173009425-173009447 GAGTCAGAGGGGCTCTTCCATGG - Intronic
968635234 4:1675061-1675083 CGATCAGAGAGGCCCCTCTAAGG + Intronic
970379518 4:15492917-15492939 GCATCAGAGGGCCCCCTCAAGGG - Intronic
970848079 4:20566974-20566996 GTGTCACAGAGTCCCCTCATGGG - Intronic
971257446 4:25028435-25028457 GAGGCAGAGACGGCCCTCCAAGG + Intronic
972345099 4:38186156-38186178 AATGCAGTGAGGCCCCTCAAAGG - Intergenic
972580498 4:40391468-40391490 GAGTAAGAGAGGCCTCTAAGGGG - Intergenic
972673082 4:41232607-41232629 GAGTCATGGAGGCCCCCTAATGG + Intergenic
975597195 4:76060015-76060037 CAGTCTGAGAGGTCCCTCCAGGG + Intronic
976970967 4:91102013-91102035 CAGTCAGACAGACCCCTGAATGG + Intronic
982190583 4:152850860-152850882 GAAGCAGAGAGGCCACTTAAGGG + Intronic
986789598 5:11146744-11146766 AAGTCAGTGAGGCCACCCAAAGG + Intronic
987057046 5:14203683-14203705 CAGTCACAGATGCCCGTCAAGGG - Intronic
990575407 5:57119100-57119122 GGTTCAGAGAGCTCCCTCAATGG + Intergenic
990577605 5:57138228-57138250 GAATCAGAGGAGCCCTTCAAGGG - Intergenic
991665830 5:68999054-68999076 GAGTCAGAGAGCCACATCACTGG + Intergenic
997305298 5:132831507-132831529 GAGCCGGAGAGGCTCATCAAAGG - Intergenic
997537689 5:134635301-134635323 GAGTCAGGCAGGCCCCTAAGAGG - Intronic
997872841 5:137520337-137520359 AAGTCTGTGAGGCCTCTCAAGGG + Intronic
1001087009 5:168707763-168707785 CAGTCAGAGAGGCCCCCATATGG - Intronic
1001200318 5:169710186-169710208 GATTCAGAGAGGTGCCTCCAAGG - Intronic
1002102215 5:176863194-176863216 CAGGGAGAGAGGCCCCTCAGGGG + Intronic
1003796625 6:9612667-9612689 GAGTCAGAGATGCCTCAAAAGGG + Intronic
1003874910 6:10426463-10426485 GAGACAGAGAGTCTCCTAAATGG + Intergenic
1005807371 6:29487414-29487436 GAGACAGAGACACACCTCAAAGG + Exonic
1007251255 6:40496626-40496648 TCCTCAGAGAGGCCTCTCAAAGG + Intronic
1007596592 6:43054555-43054577 GAGTCTAAGAAGCCCCCCAAGGG - Intronic
1010781829 6:79953198-79953220 GCATCAGAGGGCCCCCTCAAAGG - Intergenic
1011071809 6:83393195-83393217 GCGTCAGAGGACCCCCTCAAAGG + Intronic
1014222146 6:118808521-118808543 CATTCACAGAGTCCCCTCAAAGG + Intergenic
1017201783 6:151762464-151762486 GATTTAAAGAGGCCCCTTAAAGG - Intronic
1017726875 6:157282419-157282441 GAGTCAGAAAGGCACGTTAAAGG - Intergenic
1019414754 7:922134-922156 GTGTCAGTGCGGCCCCTCCAGGG - Intronic
1020150676 7:5679534-5679556 GAGGCAGGGAGGACCCTCAAGGG - Intronic
1023637209 7:42224666-42224688 AATTCAGAGACACCCCTCAAAGG + Intronic
1024511855 7:50210897-50210919 GAGCCAGAGAGGACACTCGAAGG + Intergenic
1025175977 7:56802663-56802685 GAGCTGGAGAGGCCCCTCAGAGG + Intergenic
1025695817 7:63773759-63773781 GAGCTGGAGAGGCCCCTCAGAGG - Intergenic
1026494868 7:70893436-70893458 GAGAGAGAGAGGCACCTGAATGG + Intergenic
1030343210 7:108404227-108404249 AAGCCAGAAAGGCCTCTCAATGG - Intronic
1034172378 7:149072138-149072160 GCACCAGAGAGGCCACTCAAAGG - Exonic
1034482215 7:151330961-151330983 GAGAAAGAGAGGCTCCTGAAAGG - Intergenic
1035245966 7:157562107-157562129 GAGGCAGAGTGGCCCACCAAGGG + Intronic
1036287224 8:7453799-7453821 GAGTCAGAGAGTCCCTGCCAGGG - Intronic
1036334256 8:7857725-7857747 GAGTCAGAGAGTCCCTGCCAGGG + Intronic
1039221098 8:35331615-35331637 GAGTCAGAGCACCCCCTCCAAGG - Intronic
1040987711 8:53314651-53314673 GGGGCAGAGAGGCCTCTCATAGG + Intergenic
1041124870 8:54626028-54626050 GATTCAGATAGTCCCCTTAAAGG + Exonic
1042497457 8:69471072-69471094 CGGTCAGAGAGGCTTCTCAAAGG - Intronic
1043087195 8:75849546-75849568 GAGACAGATAGGCTCCTGAATGG - Intergenic
1043530432 8:81143932-81143954 GAGTCAGAGAGGCCCCTTCGAGG + Intergenic
1048099074 8:131327902-131327924 GAGTCACAGAAGCCACTGAAGGG - Intergenic
1048423764 8:134303654-134303676 TAGTCATAGAGGCCCCTTGAGGG - Intergenic
1051153759 9:14116481-14116503 GAGTCGGAGAGGCCAGTCAATGG + Intronic
1057354495 9:94322511-94322533 CAGTCGGAGAGGCCACTCAGTGG - Intronic
1057653266 9:96935124-96935146 CAGTCGGAGAGGCCACTCAGTGG + Intronic
1060529251 9:124338896-124338918 GATTCAGACAGTCCCCTTAAAGG + Intronic
1061166921 9:128928297-128928319 GAGACAGGCAGGCCACTCAAGGG + Intronic
1061505114 9:131027332-131027354 GAGGAAGCGAGGCCCCTCAGCGG - Intronic
1062284864 9:135768373-135768395 GAGTCACAGTGCCCCCTCAGTGG - Intronic
1185949988 X:4422146-4422168 GAATCAGAGATTCCCCACAAAGG - Intergenic
1186650782 X:11557924-11557946 GATTCAGAGAGGCCACTCCTGGG - Intronic
1189802702 X:44706512-44706534 GAGTAAGAGAGGCCCTGTAAAGG + Intergenic
1190514781 X:51212560-51212582 GAGCCAGAGAGGACTCTCTAAGG - Intergenic
1197723836 X:129762479-129762501 GAGTCAGAGATGCCCCTGTGGGG + Intronic
1200763122 Y:7058056-7058078 AAGTGAGAGAAGCCCCTTAAGGG - Intronic