ID: 1082009099

View in Genome Browser
Species Human (GRCh38)
Location 11:47438332-47438354
Sequence GAGTCAGAGAGGCCCCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 163}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082009099_1082009105 3 Left 1082009099 11:47438332-47438354 CCTTTGAGGGGCCTCTCTGACTC 0: 1
1: 0
2: 0
3: 13
4: 163
Right 1082009105 11:47438358-47438380 TTTGGGGATTATGAAAAGAATGG 0: 1
1: 0
2: 3
3: 42
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082009099 Original CRISPR GAGTCAGAGAGGCCCCTCAA AGG (reversed) Intronic