ID: 1082013534

View in Genome Browser
Species Human (GRCh38)
Location 11:47467307-47467329
Sequence GATGGTGCCACAAGAGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 214}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082013523_1082013534 22 Left 1082013523 11:47467262-47467284 CCCTCCACTCACATTCTTACTCA 0: 1
1: 0
2: 0
3: 23
4: 373
Right 1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 214
1082013520_1082013534 29 Left 1082013520 11:47467255-47467277 CCTCTCCCCCTCCACTCACATTC 0: 1
1: 0
2: 5
3: 106
4: 1346
Right 1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 214
1082013522_1082013534 23 Left 1082013522 11:47467261-47467283 CCCCTCCACTCACATTCTTACTC 0: 1
1: 0
2: 0
3: 25
4: 380
Right 1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 214
1082013525_1082013534 18 Left 1082013525 11:47467266-47467288 CCACTCACATTCTTACTCAAGTC 0: 1
1: 0
2: 2
3: 22
4: 198
Right 1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 214
1082013524_1082013534 21 Left 1082013524 11:47467263-47467285 CCTCCACTCACATTCTTACTCAA 0: 1
1: 0
2: 2
3: 16
4: 259
Right 1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 214
1082013521_1082013534 24 Left 1082013521 11:47467260-47467282 CCCCCTCCACTCACATTCTTACT 0: 1
1: 0
2: 3
3: 39
4: 425
Right 1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 214
1082013529_1082013534 -6 Left 1082013529 11:47467290-47467312 CCAAGACCCTGAGGCTGGATGGT 0: 1
1: 0
2: 1
3: 23
4: 241
Right 1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG 0: 1
1: 0
2: 2
3: 33
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082013534 Original CRISPR GATGGTGCCACAAGAGAGGA GGG Intronic
900230683 1:1555527-1555549 GAGTGTGCCACAAGCGTGGACGG + Intronic
900613631 1:3554700-3554722 GAGGCTGGCACAGGAGAGGAGGG - Intronic
903469429 1:23575566-23575588 GAGGGTGTCACAAGAGTGGAGGG - Intergenic
904558336 1:31380211-31380233 TTTGGTGCCAGAAGAGGGGATGG - Intergenic
905027730 1:34862752-34862774 GATGGGGCAACAAGACAGCAGGG - Intergenic
906207027 1:43992284-43992306 GGTGGTGCCAGAAGAGAAGAGGG - Exonic
906776588 1:48535214-48535236 GATGGGGACACGAGAGAGCAAGG + Intronic
906946627 1:50300280-50300302 GACAGAGCCACATGAGAGGAAGG + Intergenic
910318692 1:85919369-85919391 GATGGAGCCACAAGAAAGAGGGG + Intronic
911838833 1:102656051-102656073 GATGGGGACAGAAGAAAGGATGG + Intergenic
911881082 1:103238857-103238879 AATGGAGACACAACAGAGGATGG + Intergenic
912652428 1:111451206-111451228 GATGGTGTCAAGAGATAGGATGG - Intronic
914847668 1:151291774-151291796 AAGGGGGCCACAGGAGAGGAGGG + Exonic
914946908 1:152075299-152075321 AATGGTACCACTAGGGAGGAGGG - Intergenic
915933914 1:160078809-160078831 GGTGGTGCCAGAACAGAGGAAGG + Intergenic
917748056 1:178029733-178029755 GAAGGTGGCTCTAGAGAGGAGGG - Intergenic
919611656 1:199752459-199752481 GGAGGGGCCACAAGAGAGAAGGG + Intergenic
919854823 1:201698101-201698123 GGCTGAGCCACAAGAGAGGAAGG - Intronic
922188291 1:223295485-223295507 GAGTGTGCCATAATAGAGGATGG + Intronic
924293916 1:242566526-242566548 GATGCTGCCTAAGGAGAGGATGG + Intergenic
924455030 1:244212501-244212523 GATGGTGCCACCACACAGAAGGG + Intergenic
924457722 1:244231554-244231576 GTTGCTGCCAAAAGGGAGGAGGG - Intergenic
1067720927 10:48727248-48727270 GCAGGTGACACAGGAGAGGAAGG - Intronic
1069399157 10:68023531-68023553 GTGGTTGCCACAAGAGAGTATGG + Intronic
1069876251 10:71565048-71565070 GCTCCTGCCACAAGAAAGGAGGG - Intronic
1070752941 10:78974480-78974502 GAGGGTAGCAAAAGAGAGGAGGG - Intergenic
1072051365 10:91706891-91706913 GATGCTGCCAGAAAAAAGGATGG + Intergenic
1073176663 10:101561145-101561167 CCTGGTGCCTCCAGAGAGGAAGG - Intergenic
1074240014 10:111629112-111629134 GCAGCAGCCACAAGAGAGGAGGG - Intergenic
1075220851 10:120583227-120583249 GTTTGTGCCACAACAGATGAGGG + Intronic
1076184545 10:128436014-128436036 CCTGGTGGCAGAAGAGAGGATGG + Intergenic
1076500157 10:130930556-130930578 GATGGAGCCACAGGAGAAGGAGG - Intergenic
1076500164 10:130930592-130930614 GATGGAGCCACAGGAGAAGGAGG - Intergenic
1076500180 10:130930664-130930686 GATGGAGCCACAGGAGAAGGAGG - Intergenic
1077504460 11:2923687-2923709 GAGGATGGCACAGGAGAGGAAGG + Intronic
1077759015 11:5070122-5070144 GATGCTGGCACAAGACAGGCGGG - Intergenic
1079078012 11:17395612-17395634 GATGGTGCCGCTGAAGAGGACGG + Exonic
1079310204 11:19358620-19358642 GATGGCTTCACAAGAGATGAAGG - Intronic
1079452944 11:20613018-20613040 GATGATGACACAAATGAGGAAGG - Intronic
1081726374 11:45332296-45332318 GATGGAGACACAAGAGTGGCAGG - Intergenic
1082013534 11:47467307-47467329 GATGGTGCCACAAGAGAGGAGGG + Intronic
1082715749 11:56611179-56611201 GATGGTGGGACAACAGAGGAAGG - Intergenic
1083054181 11:59803875-59803897 GATGGTACCACAGAAGTGGAAGG - Intergenic
1083683362 11:64361479-64361501 GATGGTGCCACAGAAGGAGAAGG - Exonic
1083912868 11:65720319-65720341 GATGGTGACAGAAGAGAAGAAGG - Exonic
1084013099 11:66363522-66363544 GGTGCTGCCACACGAGAGGGAGG - Exonic
1084460159 11:69292736-69292758 GATGGTGACACCAGTGAGGTGGG - Intergenic
1085136921 11:74099303-74099325 GATTGTTCCACAAGAGAGATAGG + Intronic
1089402839 11:118174473-118174495 GAGGATGCCACAAGTGACGAGGG - Intronic
1089760089 11:120716841-120716863 GATGGATCCACAGGAGAGGGTGG + Intronic
1093210674 12:16304538-16304560 GATGTTGAAACAAGAGAGAAAGG + Intergenic
1093667308 12:21829950-21829972 GATGGGGACACTAGAGATGACGG + Intronic
1095131300 12:38546317-38546339 GATGGTGGGACATGAGGGGAAGG + Intergenic
1095603733 12:44043508-44043530 GATGTTGCCACTATGGAGGATGG - Intronic
1100283128 12:93137812-93137834 GATGTTGGCACCAGAGATGAAGG - Intergenic
1104135869 12:125937920-125937942 GATGGAGGTATAAGAGAGGAAGG - Intergenic
1104422575 12:128649310-128649332 GATTGTGCCACCAGGGAGGGAGG + Intronic
1105898384 13:24737178-24737200 GATGGTGCCTCTAGAGGGCAGGG - Intergenic
1107323131 13:39210625-39210647 GTTGGTGACACAGGAGAGGAGGG - Intergenic
1108315369 13:49231745-49231767 TAGGATGGCACAAGAGAGGAAGG + Intergenic
1109219597 13:59627864-59627886 GAAGGTGGAACAAGAGAGAACGG + Intergenic
1112191465 13:97182133-97182155 GATGCTGCCACAAAAGTGGAAGG + Intergenic
1113755589 13:112808688-112808710 GATGGTGTGAAAAGAGAGGCGGG - Intronic
1113877019 13:113601093-113601115 GATGGTGCCACCACAGAGGAGGG - Intronic
1114924809 14:27383449-27383471 GCTTGTGCCACAGGAGAGGCTGG + Intergenic
1116425453 14:44784867-44784889 GATGGTGCCAAAAGAGATTGAGG - Intergenic
1118444270 14:65837524-65837546 GATGGTGCTCCAGCAGAGGAAGG + Intergenic
1118702106 14:68443507-68443529 GATGCTGACAAATGAGAGGAGGG + Intronic
1118901909 14:69993247-69993269 GCTGGTGGCAAAAGAGAGGCTGG + Intronic
1119551347 14:75516176-75516198 GTTGGTGCCAAAGGAGGGGAAGG - Intergenic
1120829880 14:88988308-88988330 GATGGAGCCACAAGATGGAAGGG - Intergenic
1121102237 14:91257782-91257804 GATGGTGCCACACGGTGGGACGG - Intergenic
1121882428 14:97512970-97512992 GATGGTGCCACAAGAGTTCTTGG + Intergenic
1123034838 14:105467666-105467688 GAGGGTGCCCCAGGAAAGGAGGG - Intronic
1123464119 15:20501663-20501685 GATGGTGGCAGAAGAGAGGCAGG + Intergenic
1123653946 15:22498759-22498781 GATGGTGGCAGAAGAGAGGCAGG - Intergenic
1124060998 15:26293720-26293742 GATGGTGCCACTGGAGTGGAGGG + Intergenic
1124274849 15:28317647-28317669 GATGGTGGCAGAAGAGAGGCAGG + Intronic
1124307853 15:28593958-28593980 GATGGTGGCAGAAGAGAGGCAGG - Intergenic
1124639497 15:31388065-31388087 GATGCTGCCACGAGTCAGGAAGG + Intronic
1127539107 15:59919745-59919767 GAGGCTGTTACAAGAGAGGATGG - Intergenic
1128712847 15:69885039-69885061 GCTGCTGACACAAGAGAGGATGG - Intergenic
1130042132 15:80413818-80413840 GGTGGGGCCAAAGGAGAGGAGGG + Intronic
1130060020 15:80563026-80563048 GATGGTGCCAAACGGGAGGAGGG - Intronic
1132251659 15:100339975-100339997 GATGGTGGCACAAGAAAAGGTGG + Intronic
1132575496 16:661961-661983 GCTGGTGCCACAATAGAGCAGGG - Exonic
1132785510 16:1655112-1655134 GAGGGTGCCAAAAGAGACAAGGG - Intronic
1133259695 16:4540242-4540264 GGTGGTGCCACTAGACAGGTTGG + Intergenic
1133632060 16:7630778-7630800 GAGAGAGCCACAAGAGAGGGTGG - Intronic
1135685351 16:24494362-24494384 GATGGTGTCACAGGTGAGGGGGG - Intergenic
1136000170 16:27286464-27286486 GATGGTGCCAGGAAAGAGGTAGG + Intronic
1136995483 16:35185952-35185974 GATGGTGTCAGTAGAGAGGAGGG + Intergenic
1137010319 16:35314543-35314565 CAGGGTCCCACAAGAGAGGCTGG - Intergenic
1137376965 16:47960169-47960191 GATGGAGCCACAGGAGAGCTTGG + Intergenic
1140930851 16:79626463-79626485 CTTGGGGCCACAAGAGAAGAGGG + Intergenic
1141610467 16:85178351-85178373 CATGGAGCCAGAAGAGGGGACGG + Intronic
1141819809 16:86437524-86437546 GATGGTGATAGAAGAAAGGATGG - Intergenic
1143415877 17:6749717-6749739 GATGGCGCCAAAAGCGAAGAAGG + Intergenic
1145776872 17:27535177-27535199 GCTGGCGCCACAACATAGGATGG + Intronic
1146699553 17:34944550-34944572 GAAGGTGGCTCAAGAGAGAATGG - Intronic
1147439066 17:40436428-40436450 GATGGGGCCAGAAGAGAGTCTGG + Intergenic
1152995216 18:400093-400115 GCTGGTGTCACTAGAGAGGAAGG + Intronic
1153089764 18:1330521-1330543 GATGGTTCCACACGATAGGCAGG + Intergenic
1153824055 18:8858527-8858549 GATGGTGCCACTGGGGAGGAAGG + Intergenic
1154124968 18:11683934-11683956 GATGCTGCCACAAGCCAAGAAGG + Intergenic
1155936442 18:31759804-31759826 GATTATGCCCCAAGAGATGAGGG + Exonic
1156469718 18:37369577-37369599 GATGGTGAAACTAGAGAGGAAGG - Intronic
1156528788 18:37795149-37795171 GGTGATGCCACAGGAGAGGGAGG + Intergenic
1156722930 18:40092510-40092532 GATGGTGCAACACTAGAGGTGGG + Intergenic
1160385491 18:78493992-78494014 GATGGTGACACAATGGGGGATGG - Intergenic
1163057344 19:14730397-14730419 GATGGTGGGATAAGAGAGAAGGG - Intronic
1163182105 19:15611655-15611677 GATGGTGCCGAAAGTGAAGAAGG + Intergenic
1163267202 19:16228379-16228401 GATGGTGCCACTTGTGGGGAGGG + Intronic
1163282011 19:16324272-16324294 GGTGGTCCCACAACAGATGAGGG + Intergenic
1163314387 19:16532287-16532309 GAAGCTGCCCCATGAGAGGAAGG + Intronic
1163502594 19:17685940-17685962 GATGGTGCCCAGAGAGGGGAGGG - Intronic
1166963671 19:46515091-46515113 GATGGGGCCCCCAGTGAGGAAGG + Intronic
1167520429 19:49951487-49951509 GTTGGTGTCAGAAGTGAGGATGG + Intronic
925025001 2:600709-600731 GGTTGTGCCACAAGACAGGTTGG - Intergenic
925449194 2:3953695-3953717 GATGGTCCCACAATGTAGGAAGG - Intergenic
925460377 2:4057877-4057899 GATGTTGCCACTACAGGGGATGG - Intergenic
926765666 2:16320989-16321011 GAAGGTGCCTCAAGAGGGGCAGG - Intergenic
926825936 2:16904951-16904973 GATGTTGCCACTACTGAGGATGG + Intergenic
928205906 2:29283234-29283256 GATGGTTCTGCAAGAGATGATGG - Intronic
928568347 2:32577008-32577030 GGGGGGGCCACAAGATAGGAGGG - Intronic
930965539 2:57319605-57319627 GAGGGTGGAACATGAGAGGAGGG + Intergenic
932870824 2:75395991-75396013 GATGTTGCCACAATTGGGGATGG + Intergenic
934558353 2:95299349-95299371 CCTGCTGCCACAAGAGAGGAAGG - Intronic
935807801 2:106766328-106766350 GATAGAACCACAAGACAGGAAGG + Intergenic
937430741 2:121835999-121836021 GATGGAGCCACGAGAGAGGGAGG + Intergenic
937496193 2:122422689-122422711 TCTGGTGAGACAAGAGAGGAAGG + Intergenic
937845497 2:126574405-126574427 GAGGATCCCACAAGAGTGGAAGG - Intergenic
938505253 2:131873396-131873418 GATGGTGCCACATAACAGGAGGG - Intergenic
941705137 2:168650257-168650279 GTTGGTGTCTCATGAGAGGAGGG + Intronic
944049259 2:195448517-195448539 CATGGTGGCAGAAGAGAGAAGGG - Intergenic
945632880 2:212304651-212304673 AATGATGCCACAAGGGTGGAAGG + Intronic
947380818 2:229543729-229543751 GGAGGTGCCAGAAGAGAGGAAGG - Intronic
948179318 2:235967099-235967121 GAAGGTGGCACTGGAGAGGAGGG - Intronic
948336191 2:237209174-237209196 GATGGGGACACGAGAGAGGCTGG - Intergenic
948428216 2:237901949-237901971 GATGGGGCCTCAGGAGGGGAGGG + Intronic
948575272 2:238945899-238945921 GCTGGTGGCACCAGAGAGCAAGG - Intergenic
948752888 2:240142596-240142618 GATGGGGCCGCCAGAGAGGATGG + Intronic
1170663289 20:18363246-18363268 GCTGGAGGCACAAGAGAGAAGGG + Intergenic
1171260131 20:23724722-23724744 GATGGTGACACTAGTGATGATGG - Intergenic
1172039208 20:32031745-32031767 TATGGTTCAAGAAGAGAGGACGG + Exonic
1174642369 20:52055665-52055687 GAAGGCACCAGAAGAGAGGAAGG + Intronic
1176186408 20:63782339-63782361 GAGGGTGACAGAAGCGAGGATGG + Intronic
1176787847 21:13280483-13280505 GGTGGTGCCACATAACAGGAGGG + Intergenic
1177386045 21:20410664-20410686 GAAGGTGATACAAGAGAAGATGG + Intergenic
1179180436 21:39040243-39040265 GATGGTGCCAGAGGAGGGCACGG + Intergenic
1181139349 22:20792700-20792722 GATGGTGCCACACAGGAGGCAGG + Intronic
1181438729 22:22924887-22924909 GAAGGGGCCACAAGAGACCAGGG - Intergenic
1181684403 22:24518581-24518603 GAAGGTGCCAGAAAAGGGGATGG - Intronic
1181865190 22:25849051-25849073 GATAATGTCACAAGAGAAGAGGG + Intronic
1182050532 22:27309675-27309697 GAAGGTGTCCTAAGAGAGGATGG + Intergenic
1183378420 22:37478592-37478614 GAGGGTGCCCCAGGAGGGGAAGG + Intronic
949218132 3:1596224-1596246 GATGGTGCCAAAAGCGAAGAAGG - Intergenic
949615654 3:5751305-5751327 GACCTTGCCACAAGAAAGGAGGG - Intergenic
952845442 3:37684254-37684276 GAGGATTCCACAAGAGAGAAGGG - Intronic
956459024 3:69453345-69453367 GAAGGTGCCATCAGAGAGTAAGG - Intronic
958927552 3:100175621-100175643 GGAAGTGCCACAGGAGAGGAAGG + Intronic
960216272 3:115041991-115042013 GATGGAGTGGCAAGAGAGGAAGG - Intronic
961210390 3:125120755-125120777 GAGGGTCCCGCAGGAGAGGAAGG - Intronic
961524966 3:127490810-127490832 GATGGGGGCCCATGAGAGGAAGG - Intergenic
962334473 3:134514430-134514452 GATTTTGCCAAAAGTGAGGAAGG + Intronic
967012147 3:185445836-185445858 GTTGGTGTGACAAGAGAGGATGG - Intronic
967678400 3:192328690-192328712 GTTGGTGCCAGAAGTGAGGGTGG + Intronic
969457102 4:7306391-7306413 GAAGGAGCCAGAACAGAGGAAGG + Intronic
969487766 4:7481781-7481803 GATGCTGCCAGAACAGAGGAGGG + Intronic
970958860 4:21848903-21848925 GATACTGCCACAAGAGAAAAGGG + Intronic
971093211 4:23369609-23369631 GATTGGGGCACAAGAGAGGGAGG - Intergenic
971244367 4:24914766-24914788 GATGGTGACACAACTGATGAAGG + Intronic
971720173 4:30234512-30234534 GATGAATGCACAAGAGAGGAGGG + Intergenic
973627342 4:52785935-52785957 TATGGTGACACCAGAAAGGATGG - Intergenic
974595268 4:64006297-64006319 GAAGGAGACAAAAGAGAGGAAGG + Intergenic
974989466 4:69066955-69066977 GATGGTGCTTGAATAGAGGAAGG - Intronic
977077468 4:92474180-92474202 GATGGTACCAGGAGATAGGAGGG - Intronic
980786461 4:137562547-137562569 GAGGGTGCTGGAAGAGAGGATGG - Intergenic
981166609 4:141566368-141566390 GGTGCAGCCACAGGAGAGGATGG - Intergenic
981825798 4:148939749-148939771 GATAGTGACATAAGAGAGCAAGG + Intergenic
982444152 4:155470720-155470742 GATGGTGTGAGAGGAGAGGATGG - Intergenic
983626279 4:169804876-169804898 GGTGGTGCCCCCAGAGGGGACGG + Intergenic
984061405 4:174992408-174992430 GATGTTGCCACTACTGAGGATGG + Intergenic
986955876 5:13148739-13148761 GATGTTGCCACTACTGAGGATGG + Intergenic
987885279 5:23805312-23805334 GATGTTGCCACTACAGGGGACGG - Intergenic
988288390 5:29251801-29251823 GAAGGAGGCACAAGAGAGGAGGG - Intergenic
988991641 5:36677257-36677279 GAAGGTGCCACGAGGCAGGATGG + Intronic
993344455 5:86765252-86765274 GGTGGGGCCACAAGAGAGGTTGG + Intergenic
998564821 5:143207543-143207565 GATGGAACCACAGGAGAGCAGGG - Intronic
998962703 5:147505782-147505804 GCTGGTGGCACAATAGAAGAAGG + Intronic
1000277130 5:159747914-159747936 GATTGTGTCTCAAGAAAGGAAGG - Intergenic
1000369278 5:160519462-160519484 GTGGGAGCCAGAAGAGAGGAAGG - Intergenic
1000418345 5:161008151-161008173 CATGGAGCTAGAAGAGAGGATGG + Intergenic
1001197194 5:169684418-169684440 GATTGCTCCACAAGTGAGGATGG - Intronic
1001617450 5:173054520-173054542 TATAGTGTTACAAGAGAGGATGG + Intergenic
1004574136 6:16876860-16876882 GATGGTGAAACATGGGAGGAGGG - Intergenic
1005977911 6:30814258-30814280 TATGGAGCCACACGAGAAGATGG - Intergenic
1007989662 6:46242096-46242118 GATGTTGCGACAGGAGACGAGGG - Intronic
1008427306 6:51374351-51374373 CATGGTGCCACTAGAGTGGAGGG - Intergenic
1010666159 6:78632062-78632084 GATGTCCCCACAGGAGAGGAGGG + Intergenic
1011129431 6:84038131-84038153 GGTGGGGCCACATGGGAGGAAGG + Intronic
1012401005 6:98843048-98843070 GATGGTGCCCCAAGAGAAAGAGG + Intergenic
1014654099 6:124077716-124077738 TATGGTCCCACAAGGGAGGCAGG - Intronic
1015420143 6:132998019-132998041 GATGGCGCCAAAAGTGAAGAAGG - Intergenic
1016113517 6:140255488-140255510 GATGGTGGTACAAGAAAGGGAGG - Intergenic
1017433339 6:154392615-154392637 GATGATGCCAATAGAGAGGCTGG - Exonic
1018852542 6:167651372-167651394 CATGGAGACACAAGAGAGCAGGG + Intergenic
1020289761 7:6714478-6714500 GATGGTGCCTCAGGAAAGGGTGG + Intergenic
1021834168 7:24651115-24651137 GATGAGGCCAGAAAAGAGGATGG + Intronic
1023370296 7:39506323-39506345 GATGGTGAAACAAGAGAGCTGGG + Intergenic
1024048569 7:45601831-45601853 GATGGTGCCAGGAGAAGGGAAGG + Intronic
1028709969 7:93895641-93895663 GATGAAGCCACATGAAAGGATGG + Intronic
1028878044 7:95845785-95845807 AATTTTGTCACAAGAGAGGAAGG + Intronic
1029927578 7:104333719-104333741 GAGGGTGCCACAAGATAGGATGG - Intronic
1031122516 7:117738051-117738073 GGTGGTGCCACAGGAGTGGCAGG + Intronic
1032448308 7:132003607-132003629 GATGGTCCCAGAAATGAGGAGGG + Intergenic
1033543203 7:142376132-142376154 GAGGGTGACCCAGGAGAGGACGG + Intergenic
1033548087 7:142420781-142420803 GAGGGTGACCCAGGAGAGGAGGG + Intergenic
1033801501 7:144907479-144907501 GAAGGAGCCACGAGAGAGGAAGG - Intergenic
1034503515 7:151467548-151467570 GATAGTGCCAGAAGTGAAGAGGG - Intronic
1034748672 7:153547670-153547692 GAGGGGGACAGAAGAGAGGATGG - Intergenic
1034748984 7:153550889-153550911 GAATGTGACAGAAGAGAGGACGG - Intergenic
1038531691 8:28323024-28323046 GATGCTGCCAGCAGAGAAGAGGG - Intronic
1039089650 8:33814304-33814326 GGTGGGGCCACAAGACAGGTCGG + Intergenic
1040685921 8:49873077-49873099 GATGGTGTTAGAAGGGAGGAGGG - Intergenic
1043420149 8:80089343-80089365 GATGGTGGCAAAAGAGAGGCAGG + Intronic
1044089500 8:87981498-87981520 ACTGGAGCCACAATAGAGGAAGG + Intergenic
1044461958 8:92455984-92456006 GTTGGTGCCAACAGACAGGAAGG - Intergenic
1046417996 8:113940425-113940447 GATGTTGCCACTAGTGGGGATGG + Intergenic
1046962207 8:120124065-120124087 GATGGAGCAATGAGAGAGGAAGG - Intronic
1051890098 9:21932549-21932571 GATGGGGCCACAGGAGTGGTTGG - Intronic
1052861479 9:33440518-33440540 GATGGAGCCATGTGAGAGGAGGG + Intergenic
1053407241 9:37887693-37887715 GATTATGCCCCAAGAGATGAGGG + Exonic
1055074737 9:72202270-72202292 AGTGGTGGCACAAGAAAGGACGG - Intronic
1058544594 9:106047039-106047061 GAAGGTGCTACCAGAGAGGTAGG + Intergenic
1059210560 9:112511010-112511032 GATGGTGTGTCAAGAGAGGTAGG + Intronic
1060262927 9:122092030-122092052 GATGGTGGAAGAAGAGAGAAAGG + Intronic
1061364866 9:130167261-130167283 GTTGGAGGGACAAGAGAGGAAGG - Intergenic
1061724072 9:132571959-132571981 GTGGCTGCCACCAGAGAGGAGGG + Intronic
1062229339 9:135472763-135472785 GATGGTGGCTCCAGTGAGGAGGG - Intergenic
1203769833 EBV:44003-44025 GATGGTGCCACAAAAGTGTCCGG + Intergenic
1188841504 X:35023467-35023489 TGTGTTGCAACAAGAGAGGAAGG + Intergenic
1189644267 X:43109543-43109565 GTTGGTGCCAGAAGTGAGGGTGG + Intergenic
1192425380 X:71070331-71070353 GATGGTGACAATGGAGAGGAGGG + Intronic
1193879156 X:86900347-86900369 GATGTTGCCACTACTGAGGATGG + Intergenic
1196138411 X:112234459-112234481 GATGGTGCCACTGCAGTGGAGGG - Intergenic
1197156263 X:123273194-123273216 GATGGTCCCACAAGAAAGCTAGG - Intronic
1198794557 X:140381651-140381673 GATGGTGCCACAACTGAGGTGGG - Intergenic
1200053611 X:153447135-153447157 GATGGTGCCAGGAGGGAGCAGGG + Intronic
1201958714 Y:19654277-19654299 GATGGTGGAATATGAGAGGAGGG - Intergenic