ID: 1082014997

View in Genome Browser
Species Human (GRCh38)
Location 11:47478805-47478827
Sequence CTCCCAAGACTGTTGTTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 83}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082014997 Original CRISPR CTCCCAAGACTGTTGTTAGC TGG Intronic
905371615 1:37485480-37485502 CTCCCAAGGCTGTGGCCAGCTGG - Intergenic
906127273 1:43434637-43434659 CTCCCAAGGCTGTAGGGAGCTGG - Intronic
912699262 1:111864295-111864317 CTCCCAAGATTGCTGTTGGTGGG + Intronic
916635423 1:166662709-166662731 ATTACAAGACTGTGGTTAGCTGG + Intergenic
918813931 1:189158251-189158273 CTCCTGAGACTTGTGTTAGCAGG + Intergenic
1063542810 10:6951306-6951328 CAGCCAAGTCTGTTGTTAGAGGG + Intergenic
1065159239 10:22901919-22901941 CTCCCAAGACAGCTCTTAGGAGG - Intergenic
1065819524 10:29512683-29512705 CTTCCAAGAGTGATGTTAGTCGG + Intronic
1068254135 10:54486277-54486299 CTCCCAAGACTTTCCTTAACAGG + Intronic
1072267861 10:93747722-93747744 CTCCCAAGATAGTTCTTAGCAGG - Intergenic
1074320704 10:112399297-112399319 CTGCCAAAACTGTTGTTAAAGGG + Intronic
1078922098 11:15840445-15840467 CTCCTAACACTGTGGTTGGCTGG - Intergenic
1079963052 11:26947559-26947581 CTCCCAGGACTGTGGAGAGCAGG - Intergenic
1082014997 11:47478805-47478827 CTCCCAAGACTGTTGTTAGCTGG + Intronic
1087811667 11:102615377-102615399 CTCCCAAGAATTTTGTGAGCTGG - Intronic
1089742069 11:120591319-120591341 CTCCCAAGCCTGTATGTAGCTGG + Intronic
1093072842 12:14724512-14724534 CTTCCAAGACCGTTGTCAGTGGG + Intergenic
1094615953 12:32036532-32036554 CTCCCAAGGGTGTTCTGAGCAGG - Intergenic
1098987455 12:77028088-77028110 CTCCCAAGACTATGGGTAACAGG - Exonic
1104136791 12:125948100-125948122 CTCCCTAAACTCTTCTTAGCTGG + Intergenic
1106788911 13:33134878-33134900 CTCTCAAGACTATTAATAGCAGG - Intronic
1108011434 13:46016989-46017011 CTCTCAGGACTGTTGGTATCTGG + Intronic
1118698100 14:68404927-68404949 CTCTCAAGACTCTTGTGGGCTGG + Intronic
1119987209 14:79151336-79151358 CCCCCAAGAATGTTCTTTGCAGG - Intronic
1122965293 14:105121097-105121119 CCCCCAAGGCAGTTGTTTGCTGG - Intergenic
1128040617 15:64569611-64569633 CTCCCCAGACTGGGGTTAGAGGG + Intronic
1128667561 15:69549589-69549611 CTCCCCAGATCGGTGTTAGCTGG - Intergenic
1128799916 15:70490754-70490776 CTCACTAGATTGCTGTTAGCTGG - Intergenic
1129663044 15:77563931-77563953 CTCACAAGTCTGTGGTCAGCAGG - Intergenic
1129886321 15:79040320-79040342 CTGCCTAGACTGTTGTCAGTGGG + Intronic
1130189199 15:81715574-81715596 TTGCAAAGACTGTTGTGAGCTGG - Intergenic
1131883348 15:96882316-96882338 CTCCCAAAGCTGTTCTTAACTGG + Intergenic
1132854938 16:2040499-2040521 CTCCCAACACTGGTGCTAGTTGG + Intronic
1148995442 17:51705412-51705434 CTCCCAAGAGGGTGGTAAGCTGG - Intronic
1151907823 17:77060551-77060573 CCACCAAGACTGTTATTGGCTGG + Intergenic
1152787781 17:82259404-82259426 CTCACAACACTGTTTTCAGCAGG - Intronic
1154204668 18:12326727-12326749 CAGCCAAAACTGTTGCTAGCTGG + Intronic
1157123821 18:44936588-44936610 CTCCTATGGCTGTTTTTAGCAGG - Intronic
1158985817 18:62815482-62815504 CTCACATGGCTGTTGTTAGGAGG + Intronic
1159120616 18:64165002-64165024 ATCCCCATACTGTTGTAAGCAGG + Intergenic
1164798691 19:31057929-31057951 CTCCCTGGAATGTTGTTACCTGG - Intergenic
1164801330 19:31079268-31079290 CTTCTAAGACTGTTCTTAGCAGG + Intergenic
1165605781 19:37102417-37102439 CTACCAGGACTGTTGTCAGCAGG + Intronic
1165932686 19:39370089-39370111 CTCCCAATACTGTTGATGGCTGG - Exonic
929196902 2:39194125-39194147 CTCACAAGATTGTTTTTAGTGGG - Intronic
930691395 2:54369284-54369306 CTCCTAAGATTATTGTTAGATGG - Intronic
931206930 2:60156735-60156757 CTCCCATGACTGTTGTTGGGGGG - Intergenic
931284020 2:60817733-60817755 CTCCCAGGAGTGTTGGCAGCTGG + Intergenic
933123666 2:78575842-78575864 TTCCCAAGGATGTTGTTAGAAGG + Intergenic
933492112 2:82998649-82998671 CTCCATAGGCTGTTCTTAGCTGG + Intergenic
934939321 2:98489176-98489198 CTCCCAAGAATGGTGGTACCTGG + Intronic
939509684 2:143090152-143090174 CTACCAAGCCTGGTGATAGCTGG - Intergenic
940965505 2:159832803-159832825 CTCTCAAGACTGATGTTATACGG + Intronic
947319851 2:228904927-228904949 GTCTCAAGACTGTTAATAGCTGG - Intronic
1170354875 20:15480816-15480838 CCTCCATGACTGTGGTTAGCTGG + Intronic
1171015337 20:21536393-21536415 CTCCCATGACTGCTGGTAACAGG - Intergenic
1175153731 20:56955186-56955208 ATCCCAAGTCTGTGGTTGGCTGG - Intergenic
1175373589 20:58509507-58509529 CTTCCAAGAGTGTTGTAAGACGG + Intronic
1176883054 21:14221117-14221139 CTCTCAAAACTTTGGTTAGCTGG - Exonic
950040597 3:9917031-9917053 CTCCCAAGCCTGGTGTTGGTGGG + Intergenic
953143661 3:40252726-40252748 CTACCAAGCCTGTTGATAGCTGG + Intronic
957011718 3:75013458-75013480 CTTCCAAGACAGTTTATAGCAGG - Intergenic
957210472 3:77251647-77251669 CTCCCATAATTGTTGTTAGGAGG + Intronic
957339324 3:78873119-78873141 CCCCCAAGACTGTTTTTGGGAGG - Intronic
959231321 3:103655923-103655945 TTCCTAATACTCTTGTTAGCTGG + Intergenic
962896299 3:139718052-139718074 TTCTCAAGACTGTTTTTATCTGG - Intergenic
968416209 4:436546-436568 CTCTCAAGACTGTTTCCAGCTGG + Intronic
973822864 4:54678163-54678185 CTGCCAGGAGTGTTGATAGCAGG + Intronic
975775989 4:77787806-77787828 CTCCCAACAATCTTGTAAGCAGG + Intronic
980998699 4:139807465-139807487 CTACCAAGCCAGTTGTTAACAGG - Intronic
982443663 4:155465109-155465131 CTACCAAGCCTGGTGATAGCTGG - Intergenic
992393093 5:76347328-76347350 CTTCCCAGAGTGTTGTTTGCTGG - Intronic
992827024 5:80559925-80559947 CTCACAAGACTTTTGCTAGAAGG - Exonic
993065885 5:83096359-83096381 CTGCCAAGACTGATGTTGGTGGG + Intronic
1007013209 6:38437378-38437400 CTCTGAAAACTGTTGTGAGCTGG - Intronic
1008156664 6:48023790-48023812 CTCCCAAAACTGTTCTTACAAGG + Intronic
1009668023 6:66707901-66707923 CTCCAAATACTGTTGTTTCCAGG - Intergenic
1010652652 6:78473165-78473187 CTCCGAGGACTGTTGTGAGGTGG + Intergenic
1023044423 7:36198844-36198866 CCCCCAAGACAGGTGGTAGCAGG - Intronic
1023966216 7:44964250-44964272 CTCCCAAAACTGTCGCCAGCGGG - Intronic
1026163366 7:67889498-67889520 CTTCCAAGACTGTGGGCAGCTGG - Intergenic
1032521566 7:132549527-132549549 CTCCCAAGATTTTTGAAAGCTGG + Intronic
1033818890 7:145109555-145109577 CTCCCAACACTGTTGTATGGCGG - Intergenic
1034095320 7:148402443-148402465 CTCCCAAAAATGTGATTAGCAGG + Intronic
1035957363 8:4096087-4096109 ATCACAAGACTGTTGTTGGATGG + Intronic
1037078489 8:14753083-14753105 CCTCCAAGACTGATGATAGCTGG - Intronic
1039269253 8:35862827-35862849 CTCCCAAGAGAGTTGTAAACAGG - Intergenic
1047021363 8:120778136-120778158 GTTCCAAGACTCCTGTTAGCAGG + Intronic
1058920383 9:109608890-109608912 CTCCCAATACTGTTGTTCTGGGG + Intergenic
1060477305 9:123996546-123996568 CTCCCAAGTCTGTTTCTACCTGG - Intergenic
1199067005 X:143431319-143431341 CTACCAAGCCTGGTGATAGCTGG + Intergenic