ID: 1082021195

View in Genome Browser
Species Human (GRCh38)
Location 11:47534855-47534877
Sequence GTGACAACACACATTTAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 130}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082021195 Original CRISPR GTGACAACACACATTTAGCT GGG (reversed) Intronic
902887676 1:19417973-19417995 ATGAAAACACAAAATTAGCTGGG + Intronic
906239464 1:44233562-44233584 GTGACATCAGGCAATTAGCTGGG - Intronic
908606367 1:65801222-65801244 GTGGCAAAACAGATGTAGCTTGG + Intronic
909653117 1:77997946-77997968 GTGAAAATACAAAATTAGCTGGG - Intronic
910552039 1:88486298-88486320 GCCACAAAACACATTTGGCTTGG - Intergenic
910896862 1:92078988-92079010 CTTACAACAACCATTTAGCTAGG - Intergenic
910995299 1:93098142-93098164 GAGACAACACACACTTTTCTAGG - Intronic
911712034 1:101084843-101084865 GAGACCCCACACATTCAGCTGGG - Intergenic
913156690 1:116106650-116106672 CTGAAAACACAAAATTAGCTGGG - Intergenic
913201676 1:116499658-116499680 GTGAAAATACAAAATTAGCTGGG - Intergenic
916707981 1:167372957-167372979 CTGACAAAACACACTTAACTGGG - Intronic
917883740 1:179364296-179364318 CTAAAAACACAAATTTAGCTGGG + Intergenic
918913765 1:190608333-190608355 GTAACAACACAAATTTATCATGG - Intergenic
919821739 1:201477318-201477340 GAGACAACAATCACTTAGCTTGG + Intergenic
1064079683 10:12298461-12298483 GTGAAAATACAAAATTAGCTGGG - Intergenic
1065093612 10:22259998-22260020 CTAACAACTCACATTTAGCCAGG + Intergenic
1072559707 10:96560159-96560181 GTGGCAGCACGCATTTAGGTGGG - Intronic
1073097390 10:100988187-100988209 GTGACTTCCCACATTTGGCTAGG + Exonic
1074218593 10:111412653-111412675 GTATCAACTCACATGTAGCTTGG - Intergenic
1074581917 10:114727170-114727192 GTGACACCATACATTTATCTTGG - Intergenic
1081806057 11:45891179-45891201 GCCACAACACACTTCTAGCTTGG + Intronic
1082021195 11:47534855-47534877 GTGACAACACACATTTAGCTGGG - Intronic
1082666379 11:55980859-55980881 GTGACAATACAAAATTAGCCAGG + Intergenic
1085096509 11:73764954-73764976 GTAAAAATACACAATTAGCTGGG - Intergenic
1088672735 11:112159189-112159211 CTGAAAACACAAAATTAGCTGGG + Intronic
1091784330 12:3233334-3233356 GTGACAATCCACATTCAGCTAGG - Intronic
1092510418 12:9149655-9149677 GTGACTAGACAGATTTAGCATGG - Intronic
1092568465 12:9695358-9695380 GTGGCGACACACACTTAGGTAGG - Intronic
1096173723 12:49496582-49496604 GTGGCAACACATCTTTAGATAGG - Intronic
1097167990 12:57095782-57095804 GTGACAACACAAATTTGGGAGGG - Exonic
1099940235 12:89178392-89178414 GAGGCAACACATATTTTGCTTGG + Intergenic
1100283558 12:93141414-93141436 GTGACAAAACACATTTTGTGTGG - Intergenic
1101850897 12:108401336-108401358 GAAACAACACACATTTGGCTGGG - Intergenic
1103382475 12:120505180-120505202 GTGACTAGACAAAGTTAGCTGGG + Intronic
1109495285 13:63162355-63162377 GACACAACACACATTGAACTAGG - Intergenic
1112904687 13:104402383-104402405 GTGACAACACAGATGAACCTGGG + Intergenic
1115322625 14:32100358-32100380 ATGACAACAAAAAATTAGCTAGG - Intronic
1119455601 14:74752768-74752790 CTGAAAATACACATTTAGCTAGG - Intergenic
1121449467 14:93998227-93998249 GGGACAACACATACTTAGCCTGG - Intergenic
1123898761 15:24854837-24854859 CTAAAAACACAAATTTAGCTGGG + Intronic
1128556054 15:68632352-68632374 GTGATAAAACGCATTCAGCTCGG + Intronic
1128780343 15:70354905-70354927 CTGACAAGACACAGATAGCTGGG - Intergenic
1131172218 15:90186456-90186478 GTAAAAACACAAAATTAGCTGGG + Intronic
1131799112 15:96051639-96051661 GTCACAACAGACATTCAACTTGG - Intergenic
1135745906 16:25015745-25015767 CTAACAATACAAATTTAGCTGGG + Intergenic
1135895004 16:26392262-26392284 GTGATAACACAAATTTGGCAAGG + Intergenic
1138381133 16:56603394-56603416 ATGACAATACAAAATTAGCTGGG + Intergenic
1140633776 16:76886996-76887018 GTGACAATAAACATTCAACTTGG + Intergenic
1149312711 17:55410896-55410918 GTGACAAAGCACACTGAGCTTGG - Intronic
1150198046 17:63321741-63321763 GGGACACCACACATTGAGCAAGG - Intronic
1150928154 17:69555798-69555820 GGAACAACACACACTAAGCTGGG - Intergenic
1155261840 18:24050708-24050730 CTGAAAATACACAGTTAGCTGGG + Intronic
1157848427 18:51025795-51025817 GTGACAATACTCCTTTAGCTAGG + Intronic
1159019869 18:63134511-63134533 CTGAGAACACACACTGAGCTCGG - Intronic
1164529103 19:29034210-29034232 TAAACAACACACATTTGGCTGGG - Intergenic
1165891462 19:39114933-39114955 GTAAAAATACAAATTTAGCTGGG + Intergenic
926666802 2:15533941-15533963 ATGAAACCAAACATTTAGCTTGG + Intronic
931573944 2:63699833-63699855 TTGACAAAACACAGTTAACTGGG + Intronic
933921472 2:87051548-87051570 GTGACAAAATAAATTTAGATGGG + Intergenic
933930148 2:87142247-87142269 GTGACAAAATAAATTTAGATGGG - Intergenic
934001481 2:87718033-87718055 GTGACAAAATAAATTTAGATGGG - Intergenic
937599235 2:123709852-123709874 TAGACAACACACATATAGTTGGG + Intergenic
939916612 2:148052369-148052391 CTGAAAATACACAATTAGCTGGG - Intronic
941866451 2:170339881-170339903 GTGACAAAACACATCAAGCAGGG - Intronic
941958757 2:171231883-171231905 GTGAAAATACAAAATTAGCTGGG + Intergenic
945546372 2:211157771-211157793 GTTACAACAAACATTTGCCTTGG + Intergenic
1169355841 20:4904290-4904312 GTGATAACACCCATTCAGCCAGG - Intronic
1171985261 20:31656001-31656023 GTAAAAATACAAATTTAGCTGGG + Intergenic
1174072641 20:47909645-47909667 GTGACAACACCCATAGAGCAGGG - Intergenic
1182151470 22:28029984-28030006 GTGACAATCCTCATTTGGCTGGG - Intronic
1184076564 22:42183056-42183078 CTCACAACACAGATTTAGGTGGG - Intronic
1185383946 22:50523075-50523097 GGGACACCACTCATTGAGCTGGG - Exonic
950028054 3:9834135-9834157 GAGACAATACTCATTTGGCTGGG - Intronic
950743273 3:15066305-15066327 CTGACAATACAAAATTAGCTGGG - Intergenic
951531161 3:23699314-23699336 GTGAAAACACAAATGTACCTGGG - Intergenic
951732152 3:25822178-25822200 GTGACAATACACATTAAAATTGG + Intergenic
956794988 3:72709860-72709882 GTGACACCACACATCAAGGTAGG + Intergenic
957547276 3:81655813-81655835 TTAAAAACACACATTTGGCTGGG - Intronic
957645024 3:82910431-82910453 GTGACAAGACGCATTTATCAGGG + Intergenic
958688961 3:97436424-97436446 GTGACAAAATACATTTAAATGGG + Intronic
965241548 3:166205804-166205826 GTTCCAACTCACATTTAGATAGG + Intergenic
965858765 3:173121327-173121349 CTGAAAACACACATTGAGCGAGG - Intronic
972950484 4:44316516-44316538 GTGAGAAAACACATTTGGCTCGG - Intronic
976586038 4:86798298-86798320 GTGACAACACTAATTTTGCTGGG - Intronic
976889764 4:90032554-90032576 GTGGGAACACACATTTTGGTTGG - Intergenic
988518437 5:31924863-31924885 GTGACAACACACACTCTACTAGG - Intronic
990344094 5:54854338-54854360 GTGATAATAAACAATTAGCTAGG + Intergenic
990983542 5:61621938-61621960 GTGACAAAACAGATAGAGCTTGG + Intergenic
992212408 5:74493796-74493818 CTGACAACAAACCTTGAGCTTGG - Intergenic
992231455 5:74668122-74668144 GGGACAAGAAACATTTACCTGGG + Intronic
996763405 5:127009773-127009795 GTGATCAGACACATTTAGTTGGG + Intronic
996908594 5:128631186-128631208 GTGTCCACACACATTGAGGTTGG + Intronic
1002782168 6:375375-375397 ATGAAAACACACTTTTAGCCAGG + Intergenic
1006246039 6:32737112-32737134 GTAACATCACACATTGGGCTGGG - Intergenic
1009397062 6:63212016-63212038 GTGACAGAACACATTCAGTTGGG - Exonic
1009892637 6:69706164-69706186 GTGGCAGCACACACTTAGGTGGG + Intronic
1011603948 6:89083598-89083620 GTGACAACACGTATGTAGCTGGG - Intronic
1015695197 6:135972071-135972093 CTGAAAATACACAATTAGCTGGG + Intronic
1016607644 6:145950585-145950607 GTGACAAAACACACTGAGCAAGG - Intronic
1017145477 6:151230581-151230603 GTGACTACAAAAAATTAGCTGGG + Intergenic
1018699449 6:166415250-166415272 ATGACAACACTCATTTTTCTAGG - Intronic
1024602423 7:50995502-50995524 GAGAGAACCCACAGTTAGCTTGG + Intergenic
1026263647 7:68777457-68777479 GTGACCACACAAATTGAGCCTGG + Intergenic
1027380687 7:77606113-77606135 CTGAAAACACATAATTAGCTGGG - Intronic
1028342057 7:89733988-89734010 GTGACCACCCACAATGAGCTTGG + Intergenic
1029410537 7:100407099-100407121 GTGAAAACAGACACTTAACTAGG - Intronic
1031501176 7:122518747-122518769 CTGGGAACACACATTTAACTGGG + Intronic
1032657458 7:133947091-133947113 GTGAGAAGACCTATTTAGCTCGG - Intronic
1033091060 7:138386389-138386411 CTGAAAACACAAAATTAGCTGGG - Intergenic
1034724923 7:153326716-153326738 GAAACAACTAACATTTAGCTAGG - Intergenic
1034991387 7:155549979-155550001 GTGACATCACACAGGTAGCCCGG + Intergenic
1035716627 8:1760291-1760313 GACACAACAAACATTTATCTTGG - Intronic
1038255992 8:25951617-25951639 GAGAATACACACACTTAGCTAGG + Intronic
1038763173 8:30403629-30403651 GTGTATACACAGATTTAGCTAGG - Intronic
1039093051 8:33853078-33853100 GTGATAGAACACATTTAGCAAGG + Intergenic
1039127740 8:34222247-34222269 TTGCCACCACATATTTAGCTTGG - Intergenic
1043062444 8:75521623-75521645 GTAACAGTACACATTTATCTCGG - Intronic
1044567817 8:93684097-93684119 CTGACAACACAGAGCTAGCTGGG + Intergenic
1044752900 8:95433047-95433069 CTAAAAACACACAATTAGCTGGG + Intergenic
1047580974 8:126214822-126214844 TTGTCAACATACATTTATCTTGG + Intergenic
1048397985 8:134033069-134033091 ATGACAACACACACTTACATTGG + Intergenic
1051829512 9:21259616-21259638 GTAACAACAAAAAATTAGCTGGG - Intergenic
1055942150 9:81660709-81660731 GTTAAAACATACATGTAGCTGGG - Intronic
1058654829 9:107210737-107210759 GTAAAAACACAAAATTAGCTGGG - Intergenic
1058821059 9:108729743-108729765 TTGAAAATACACAGTTAGCTGGG + Intergenic
1058824278 9:108760835-108760857 CTGACAACTCTCCTTTAGCTTGG + Intergenic
1061442733 9:130617621-130617643 GTGACAGCAGACATATAGGTCGG - Intronic
1061561743 9:131408878-131408900 CTGAAAACACAAAATTAGCTGGG - Intronic
1061658805 9:132114072-132114094 GTGACAACACCCTTTTATTTCGG + Intergenic
1188217637 X:27498846-27498868 GTGACAACACAGATCAACCTAGG - Intergenic
1189015755 X:37094868-37094890 GTGTATACACAGATTTAGCTAGG - Intergenic
1189378794 X:40486830-40486852 GTGACAACATACAATAAACTGGG + Intergenic
1190668918 X:52721432-52721454 GTGACCACACATTTTTGGCTGGG + Intergenic
1190670499 X:52736972-52736994 GTGACCACACATTTTTGGCTGGG - Intergenic
1194285178 X:92001627-92001649 CTAAAAACACAAATTTAGCTAGG - Intronic
1196714240 X:118796196-118796218 GTGAAATCACACATGTAACTCGG - Intergenic
1199499526 X:148494739-148494761 ATGAGAGCACACATTTATCTGGG + Intergenic
1200602746 Y:5226170-5226192 CTAAAAACACAAATTTAGCTAGG - Intronic
1200767972 Y:7096788-7096810 GTGACAACAGAGGTGTAGCTTGG - Intergenic