ID: 1082024862

View in Genome Browser
Species Human (GRCh38)
Location 11:47564949-47564971
Sequence CTGTTTGGTCAGATGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 218}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1082024858_1082024862 -5 Left 1082024858 11:47564931-47564953 CCTGCTATGTAAACACTGCTGTT 0: 1
1: 0
2: 0
3: 7
4: 172
Right 1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 218
1082024857_1082024862 5 Left 1082024857 11:47564921-47564943 CCTATTTTTTCCTGCTATGTAAA 0: 1
1: 0
2: 5
3: 54
4: 509
Right 1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG 0: 1
1: 0
2: 2
3: 19
4: 218

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1082024862 Original CRISPR CTGTTTGGTCAGATGAAGGA GGG Intronic
900896422 1:5486100-5486122 CTGCTTGGACAGGTGAAGGCTGG - Intergenic
901116212 1:6846982-6847004 CTGCTTGAGCACATGAAGGATGG + Intronic
903706525 1:25289887-25289909 CTCATTGGTCAAAGGAAGGAAGG + Intronic
905635539 1:39548932-39548954 CAGTTTGGTCAGATGAAGACTGG - Intergenic
905663126 1:39743821-39743843 CAGTTTGGTCAGATGATGACTGG + Exonic
906150167 1:43582963-43582985 CTGTGTGGGCAGATGAAGGTTGG + Intronic
911077990 1:93898386-93898408 GTTTTTGGTCATATGAAGTAGGG + Intronic
913090486 1:115473527-115473549 CTGGTTGGTGAGAGGAAGGGAGG + Intergenic
913423403 1:118698865-118698887 CTGTTTGTGCAAATGAAGTAGGG + Intergenic
915347211 1:155203593-155203615 CTGGTTGGTGAGAAGGAGGAAGG + Intronic
915441783 1:155950151-155950173 CTGTTTTGTCTGATGATGAATGG - Intronic
918218651 1:182415650-182415672 CTGCCTGGTCAGAGGGAGGAGGG + Intergenic
919124930 1:193382259-193382281 TTGTTTGGTTAGATGAAACATGG - Intergenic
920400471 1:205673060-205673082 GTGTGTGGGCAGGTGAAGGATGG - Intronic
922703965 1:227779228-227779250 CTCATGGGTCAGATGAAGGCCGG + Intronic
924657353 1:245985041-245985063 CTGTGTGGTCAGGTGAGCGATGG - Intronic
1062916999 10:1248154-1248176 CTGTTTGGTCAGCTGGAGACGGG - Intronic
1062917019 10:1248283-1248305 CTGTTTGGTCAGCTGGAGACGGG - Intronic
1062917038 10:1248412-1248434 CTGTTTGGTCAGCTGGAGACGGG - Intronic
1062982997 10:1741121-1741143 CTGTGTGGTCAGCCGCAGGAAGG - Intergenic
1063097434 10:2920852-2920874 GTGTGTGGTCAGATGAGGGGTGG - Intergenic
1065286167 10:24189685-24189707 ATGTTTGGTTTGATGAAGAATGG + Intronic
1066299449 10:34083990-34084012 CTGATTGGAGTGATGAAGGATGG + Intergenic
1066539735 10:36433047-36433069 TTGTTTGGGGAGATGAAGTAGGG + Intergenic
1067536946 10:47117976-47117998 CTGTTTGGTCTGCTGTAGAAGGG + Intergenic
1069821285 10:71230240-71230262 CTGATTGGTCAGAGTGAGGAGGG + Intronic
1071523631 10:86345928-86345950 GTGGTTGGTCAGGTGAAGAAAGG - Intronic
1073569651 10:104566918-104566940 CTGTGTGCTCACATGAAGAAAGG - Intergenic
1074091875 10:110267788-110267810 ATATTGGGTCAGATGAATGAGGG + Intronic
1075047377 10:119156725-119156747 CAGTTTGTCCAGATGAAGTATGG - Exonic
1076480009 10:130778765-130778787 CTGTGTGGTTGGATGAAGGTGGG + Intergenic
1080238240 11:30097359-30097381 CTGTTTTGTCACTTTAAGGAAGG - Intergenic
1081292488 11:41344009-41344031 TTGTTTGCTCAGATAATGGAAGG - Intronic
1082024862 11:47564949-47564971 CTGTTTGGTCAGATGAAGGAGGG + Intronic
1085211461 11:74783539-74783561 CTGTTCTGTGAGGTGAAGGAAGG + Intronic
1085331476 11:75655527-75655549 CAGATTGGTCAGATAATGGAAGG + Intronic
1086641893 11:89168893-89168915 TTGTTTGATTAAATGAAGGAAGG + Intergenic
1086931235 11:92695164-92695186 CTGTCTGGTCAGAAGAAGTAAGG + Intronic
1089855318 11:121538585-121538607 CTGTTTGCTCAAATACAGGACGG - Intronic
1090218526 11:124994176-124994198 CTGTTTGGTCAGCTGAAAGACGG + Intronic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1090874524 11:130776851-130776873 CTGTTTGTTCAGATGCACGAGGG - Intergenic
1092611350 12:10176477-10176499 CTGTTTAGGCAGGTGAAGGCTGG + Intronic
1092871140 12:12806951-12806973 ATGTATGTTCAGATGAAGAAAGG - Intronic
1094324613 12:29223307-29223329 GTGTTTGCTCAGAGAAAGGAAGG - Intronic
1095593810 12:43936708-43936730 CTGTTAGGTCAGATGCAGCCAGG + Intronic
1097203492 12:57300029-57300051 TTGTTTGGTAAGATGTAGTATGG - Intronic
1098364099 12:69684263-69684285 CTGATTAGAAAGATGAAGGAGGG - Intronic
1098869870 12:75804743-75804765 CTGTTTGATCAGATGAAGTATGG + Intergenic
1098892798 12:76026948-76026970 CTGTTGGGACAAAGGAAGGAAGG - Exonic
1099943567 12:89218927-89218949 ATGTTTGAACAGATGAAGCATGG - Intergenic
1100116220 12:91307979-91308001 CTGTTTCTTCAAATGATGGAAGG + Intergenic
1103795429 12:123499844-123499866 CTGAGTGGTCAGAGGAAGGGAGG - Intronic
1104105802 12:125657817-125657839 CTCTGTGGTCACATGAAGGGAGG + Exonic
1105968382 13:25405081-25405103 CGGGCTGGTCAGATGAAGGCTGG + Intronic
1107303448 13:38992213-38992235 CTATGTGGTCTGATGAAAGAAGG - Intergenic
1107803461 13:44132096-44132118 CTGTCTGGTGAGGGGAAGGAGGG + Intergenic
1108044053 13:46366204-46366226 CTGGTTGGTCAGATGCAGCCAGG - Intronic
1109244139 13:59932090-59932112 CTATTTGGTCAGGTTAAGGAAGG - Intronic
1111665833 13:91266954-91266976 CTGTCTGGTCACAAGCAGGAGGG + Intergenic
1111871390 13:93837447-93837469 CATTTGGGTCAGATGAAGGTTGG - Intronic
1112882556 13:104124969-104124991 CTCTGTGTGCAGATGAAGGATGG + Intergenic
1114214551 14:20646462-20646484 CTGTTTGTTAAGCTGAGGGAAGG + Intergenic
1115199846 14:30841140-30841162 TTGTTTGGTGCGATGAAGAATGG - Intergenic
1117118867 14:52547645-52547667 CTGTTTGGAGAGAGGAAGAATGG - Intronic
1117445730 14:55802106-55802128 CTGATTGGTCAGGTCAGGGATGG - Intergenic
1117785337 14:59278181-59278203 CTGTGTGATCAGATGAAGTGAGG + Intronic
1119748424 14:77060920-77060942 CTGTTTGGTGAGGTCAAGGAAGG + Intergenic
1120404526 14:84078418-84078440 CTGTTTGGACAAGTTAAGGATGG + Intergenic
1121357581 14:93228823-93228845 CTGATTGGTCATAGGAAGTAAGG - Exonic
1123842982 15:24268250-24268272 CTGATTGGTCAGATCAGAGATGG - Intergenic
1123858019 15:24434322-24434344 CTGATTGGTCAGATCAGAGATGG - Intergenic
1127058803 15:55161074-55161096 CTGTGTGGTGAGGTGAGGGAGGG + Intergenic
1128524935 15:68406012-68406034 CTGCTGGGTCAGATGCAGGAAGG - Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1132025257 15:98399648-98399670 CTGTGTGCTCACATGGAGGAAGG - Intergenic
1134224709 16:12381321-12381343 TTGGTTGGTGAGATGAACGATGG - Intronic
1136125825 16:28179685-28179707 TAGTTTGGTCAGAGAAAGGAAGG - Intronic
1137495374 16:48965313-48965335 CTGTGTAGACAGATGAAGGAGGG + Intergenic
1140021386 16:71242378-71242400 ATGTTTGCTCACATGAATGAAGG - Intergenic
1143990341 17:10954346-10954368 CTGTTGGTCCAGATGAATGATGG + Intergenic
1144523282 17:15968568-15968590 CTGTGTGGTCAGGCGGAGGAGGG + Intronic
1148216535 17:45836596-45836618 CTGTTGGGTGGGATGAGGGAGGG - Intergenic
1148653099 17:49263736-49263758 CTGATAGGTAAGATGATGGAGGG - Intergenic
1151037900 17:70822344-70822366 CTGTTTGGTTAGCTGAAATATGG - Intergenic
1151237868 17:72734581-72734603 CTGTTTGGTCCGGGGAAGGGAGG + Intronic
1152435372 17:80273218-80273240 CTGTAACGGCAGATGAAGGAAGG - Intronic
1155798187 18:30066332-30066354 CTGTTTCTTCACATGGAGGAAGG + Intergenic
1156362345 18:36394078-36394100 CTACTTGGGCAGATCAAGGAAGG + Intronic
1157312190 18:46560638-46560660 CTGTTTGCTAAGCTGCAGGATGG + Intronic
1158636405 18:59162348-59162370 CTGTTTGGTAAGTTGAGGCAGGG - Intergenic
1159275264 18:66211132-66211154 CTGATTAATCAGAAGAAGGAGGG - Intergenic
1159758286 18:72392727-72392749 CGGTTTGGTTAGATGGATGAGGG + Intergenic
1160043835 18:75369058-75369080 GTGCTTGGTCAGATGAAGATGGG - Intergenic
1161729782 19:5952247-5952269 CGGGTAGTTCAGATGAAGGAGGG + Intronic
1162621440 19:11847527-11847549 CTGTCTGGTCAGAGAAAGGGTGG - Intergenic
1166470311 19:43074189-43074211 CTGTCAGGTCAGATTTAGGACGG + Intronic
1167689094 19:50974832-50974854 CTCTTGGGTCTGAGGAAGGAGGG + Intergenic
1167746438 19:51353913-51353935 CTCTTGGGTCTGAGGAAGGAGGG - Intronic
1168116083 19:54222010-54222032 CATTTTGTTCTGATGAAGGAAGG - Exonic
1168119065 19:54241758-54241780 CATTTTGTTCTGATGAAGGAAGG - Exonic
1168185479 19:54697310-54697332 CATTTTGTTCTGATGAAGGAAGG + Intronic
925018377 2:548885-548907 GTGTTTGGGCAGATGAAGAAGGG - Intergenic
925088489 2:1133592-1133614 CTATTTGGTCAGATTAGGCAAGG - Intronic
925088946 2:1137611-1137633 CTGTCTGGTCAGCTGCAGGGTGG - Exonic
926132117 2:10310074-10310096 CTGTTTGCTCAGGTGCAGAAAGG + Intronic
926132131 2:10310219-10310241 CTGTTTGGTCATGTGCAGAAAGG + Intronic
927517280 2:23679862-23679884 CTGCTTGGCCAGATGGAGGAAGG + Intronic
928400932 2:30978216-30978238 CAGTTTGGGCAGCTGGAGGAGGG - Intronic
929484842 2:42343890-42343912 CTGTTGGGTAAGGTGAAGGTTGG - Intronic
930505714 2:52280990-52281012 CTGTGTTCTCAGATGGAGGAAGG + Intergenic
931016793 2:57991460-57991482 TTGTTTGGACAGATGAATGCTGG + Intronic
931955257 2:67417350-67417372 CTGTGTCGTCCCATGAAGGAAGG + Intergenic
933139667 2:78778208-78778230 CTGTTCGGTTAGATGAGGGATGG - Intergenic
933208591 2:79538715-79538737 GAGTTTGGTCAGAAGAAGGCTGG + Intronic
934086852 2:88517085-88517107 GTGTGTGGTCATAGGAAGGAAGG - Intergenic
936450949 2:112633704-112633726 CTGTGTCCTCAGATGAAGGAAGG - Intergenic
937094967 2:119229389-119229411 CTCTATGGTCAGCTGAGGGAGGG - Intronic
939953991 2:148509656-148509678 CTGTGTGATCAGAGGAAGGGCGG - Intronic
940106664 2:150108849-150108871 CTGTATCTTCAGTTGAAGGATGG + Intergenic
941892722 2:170598377-170598399 CTGTTTATTCAGATGGAGGCAGG - Intronic
943471980 2:188305529-188305551 CTGCTTGGGCAGGTAAAGGAAGG + Intronic
947544452 2:231001155-231001177 CTTTTTGGGAAGAGGAAGGAAGG - Intronic
1172748241 20:37230207-37230229 CTGTTTTCTCAGTTCAAGGATGG - Intronic
1173539130 20:43838283-43838305 CTGCTTGGTCTGAGGAGGGAGGG + Intergenic
1179046763 21:37851543-37851565 CTGTTTGGATAGAGGAGGGAAGG + Intronic
1180182371 21:46123725-46123747 GTGTGTGGTTAGATGATGGATGG + Intronic
1181459152 22:23076040-23076062 CTGGTTGGTCATAGGAAGGGTGG + Intronic
1182493451 22:30689768-30689790 CTGTTTGGTCACATGGGGGGAGG + Intergenic
1183013212 22:34964515-34964537 CAGTTTGATCAGATTATGGAAGG - Intergenic
1183014591 22:34975363-34975385 CTGGTAGGTCAAATCAAGGAGGG + Intergenic
1183669657 22:39264911-39264933 AGATTTGGTCAGATGGAGGAGGG - Intergenic
1183917995 22:41138607-41138629 AGTTTTTGTCAGATGAAGGAGGG + Intronic
1183989756 22:41589915-41589937 CTGATTGGCCAAATGAAGAAGGG + Intergenic
1185104864 22:48861926-48861948 CTGTTTGCTCTGATGCAGGCTGG - Intergenic
1185181842 22:49368232-49368254 CTGTTTGGGCACCTGGAGGATGG - Intergenic
952428836 3:33202408-33202430 CTTTTTGATGACATGAAGGAAGG + Intronic
952800136 3:37282807-37282829 CTGTTTGGTCTAAGGGAGGAAGG + Intronic
952809512 3:37388680-37388702 CAGTTTGGTCAGATGGTGGCTGG - Intronic
953141533 3:40233836-40233858 CTGTTTGGTCCGATAACAGAAGG - Intronic
955391409 3:58524856-58524878 CTGTTTGCTCAGATCACAGAAGG - Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956840064 3:73131118-73131140 CTGTGTCCTCAGATGATGGAAGG + Intergenic
960721244 3:120626405-120626427 CTCTTTCTTCAGAGGAAGGAAGG - Intergenic
964621577 3:158724478-158724500 CTGTTTGCTTTGATGGAGGATGG + Intronic
966277847 3:178197267-178197289 CTGTTTGGGGAGATGCAGGAGGG - Intergenic
966794374 3:183699251-183699273 CTGTTTACTGAGATGAAGAATGG + Intronic
968847330 4:3052293-3052315 CTGTTTGGCCTGATGAAAGTTGG + Intergenic
970046112 4:11856397-11856419 TTTTTTGGTCAGATGAGGAAAGG + Intergenic
971770691 4:30892684-30892706 CTTTTTTGTGAGATGAATGATGG + Intronic
973117842 4:46483520-46483542 CTATTTTGTCAGCAGAAGGAAGG - Intergenic
975757282 4:77583339-77583361 CTGTGTTGGGAGATGAAGGATGG - Intronic
978595413 4:110372616-110372638 CTGTGTTGTCACATGATGGAAGG + Intronic
978708015 4:111740183-111740205 CTGAGAGGTCAGATTAAGGAAGG - Intergenic
979617629 4:122761834-122761856 CTGTGTCCTCACATGAAGGAAGG - Intergenic
980009738 4:127581639-127581661 CAGTTTGGCCAGCTGAAGGGCGG + Intergenic
980265217 4:130506255-130506277 ATGTTTCTTCAGTTGAAGGAAGG - Intergenic
980847499 4:138341740-138341762 TGATTTGGTCAGAAGAAGGAAGG + Intergenic
981029042 4:140105535-140105557 CTGTTTTGTCAGACAGAGGATGG - Intronic
981049812 4:140298647-140298669 CTGATTGGCCACAGGAAGGAAGG - Intronic
984064049 4:175026112-175026134 CTGCTTTGTCACAAGAAGGATGG + Intergenic
988067315 5:26237665-26237687 CTGCTTGGCCACAGGAAGGAAGG - Intergenic
988873996 5:35423562-35423584 ATGTTTGATAAGATGAAGGAAGG + Intergenic
990338889 5:54802730-54802752 CTGTTTGGCCTGCTGAATGATGG - Intergenic
990339901 5:54812085-54812107 CTGTTTGGTCAGGTCAGTGAAGG - Intergenic
992747538 5:79834420-79834442 CTGTCTGCGCAGATGAGGGAGGG - Intergenic
992810027 5:80377389-80377411 CTGTCTGGAAAGAGGAAGGAAGG + Intergenic
993164584 5:84335927-84335949 CTGTTTCCTCAGATGGAGGAAGG + Intronic
993838737 5:92849144-92849166 CTCTTTGGTCAGAGGAATCACGG + Intergenic
996413454 5:123183802-123183824 CTGTTTAGTAAGAAGGAGGAAGG - Intronic
1000155049 5:158542048-158542070 CTGTTTTGGCAGATTCAGGAAGG + Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001564699 5:172692129-172692151 CTGATTGGTCAGACCCAGGATGG + Intergenic
1001617276 5:173052891-173052913 ATTTTTGGTAAGATGAATGAAGG + Intergenic
1003563909 6:7206437-7206459 CTGAATGGACAAATGAAGGAAGG - Intronic
1007008724 6:38394051-38394073 CTGGTTGGAAAAATGAAGGAAGG - Intronic
1007888165 6:45256382-45256404 CTGTTTCCTCACATGGAGGAAGG + Intronic
1009312802 6:62176535-62176557 TTTTTTGGTCAAATGAATGAAGG - Intronic
1010292556 6:74154993-74155015 CTGTTTCTTCAGGTGAAGAATGG + Intergenic
1010309061 6:74361390-74361412 TTATTTTGTCAGATAAAGGAAGG + Intergenic
1015464106 6:133528702-133528724 CTGTGTGGTTAGGAGAAGGAGGG - Intronic
1015808705 6:137140158-137140180 CTGTTTGTTCACATGAAAGCTGG - Intergenic
1017341604 6:153330656-153330678 CTGTATGTTCAGATGGAAGATGG + Intergenic
1017819968 6:158042169-158042191 CTGTTTTGTCAGTAGAAGAATGG + Intronic
1018351426 6:162963165-162963187 TTGTTTGGGCAGGTGAAGGCAGG + Intronic
1020668099 7:11072905-11072927 CTGTTAGTTCACATGAAAGATGG - Intronic
1021505047 7:21373403-21373425 CTCTTTAGTCAGATGAATAAGGG - Intergenic
1023113516 7:36838105-36838127 CTGTTGAGTCAGAAAAAGGATGG + Intergenic
1023915642 7:44586820-44586842 CTGGTTGAACAAATGAAGGACGG - Intergenic
1024248997 7:47492257-47492279 CTGTTTGGCCAGCAGCAGGAAGG + Intronic
1024354774 7:48403291-48403313 CAGTGTGGTCAGAAGAAGCAAGG - Intronic
1025028532 7:55537210-55537232 ATGTGTGTTCAGCTGAAGGAAGG - Intronic
1027246785 7:76373124-76373146 ATTAATGGTCAGATGAAGGAGGG + Intergenic
1028990653 7:97045711-97045733 CTGTTAGGTCAGCTGGAGGCTGG - Intergenic
1029708921 7:102289126-102289148 CTGTTTGGGCAGAGCAAGGCAGG + Intronic
1032860644 7:135876085-135876107 CTGAGAGGTCAGATGAAGGCAGG - Intergenic
1038176872 8:25188184-25188206 TTGTTTGGTTAGATGGAGGAAGG + Intronic
1043747628 8:83895954-83895976 CTGTTTGGTGACAAGAAGCATGG + Intergenic
1043957580 8:86379225-86379247 CAGTTTGGAACGATGAAGGATGG + Intronic
1044558695 8:93591521-93591543 CTGTCAGGTCAGATGAAGCCTGG - Intergenic
1044808330 8:96031629-96031651 CTGTTTCCTCATATGAAGCATGG - Intergenic
1045149770 8:99391392-99391414 CTGTGGGGACAGATGAGGGAGGG + Intronic
1045531717 8:102991267-102991289 CTGTTTGCTCAAATGAAGTCTGG + Intergenic
1046204508 8:110975301-110975323 CTGTTTAGAAAGATAAAGGAGGG + Intergenic
1046740801 8:117827022-117827044 CTGATTTGCCAGATGAAAGATGG - Intronic
1048289275 8:133167959-133167981 CTCTGTGGTCAGATTAATGATGG - Intergenic
1049073123 8:140372472-140372494 GTGTGTGGACAGGTGAAGGAAGG - Intronic
1049167508 8:141135851-141135873 CTGTTTGGTCAGCCGAGGAAGGG + Intronic
1051152442 9:14097895-14097917 CTGGTTGGTCAGGAGAGGGAGGG - Intronic
1052528127 9:29647759-29647781 CTGTGTCCTCAGATGATGGAAGG - Intergenic
1053654045 9:40197552-40197574 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1053904433 9:42826729-42826751 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054366160 9:64343768-64343790 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1054530552 9:66178785-66178807 GTGTTTGGGTAGATGGAGGAGGG - Intergenic
1054673789 9:67833498-67833520 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1055149937 9:72984671-72984693 CTATTAGATCACATGAAGGAAGG - Intronic
1056282160 9:85052113-85052135 CTGTTTTTTCAGATGACAGAAGG - Intergenic
1056695140 9:88842320-88842342 CTGTAAAGTCAGATGAAAGATGG - Intergenic
1056796612 9:89663027-89663049 CTACTTGGTCAGCTGAAGAACGG - Intergenic
1057379594 9:94555783-94555805 GTGTTTGGGTAGATGGAGGAGGG + Intergenic
1057558963 9:96112401-96112423 CATTTTGGTCAGATGAGGAAGGG - Intronic
1057745074 9:97745000-97745022 CTGTTTGAACATATGTAGGATGG - Intergenic
1058958108 9:109968111-109968133 CTGTGTGGTCTGAAGAAGAAAGG + Intronic
1061315947 9:129795856-129795878 CTGGGAGGTCAGAGGAAGGAGGG + Intergenic
1186174900 X:6916066-6916088 CAGTTTGGTGACTTGAAGGAAGG - Intergenic
1187221761 X:17334095-17334117 CTGTGTACTCAGATGATGGAAGG + Intergenic
1188282219 X:28284351-28284373 TTTTTTGGTCAGGTTAAGGAAGG + Intergenic
1188552148 X:31376179-31376201 CTGTTTTGTTAGAGGAAGGAAGG - Intronic
1189265573 X:39713499-39713521 GTGTATGATCAGATGATGGATGG + Intergenic
1192344443 X:70289766-70289788 GTGGCTGGTCAGGTGAAGGAAGG - Intronic
1193662918 X:84279004-84279026 CTGGTAGTTCAGAGGAAGGAGGG - Intergenic
1194296771 X:92135490-92135512 TTTTTTGGTGAGAGGAAGGAAGG + Intronic
1195750216 X:108156915-108156937 CTGAATGGTCTGAAGAAGGAAGG - Exonic
1196972806 X:121127967-121127989 CTGTGTTGTCACATGATGGAAGG + Intergenic
1198960400 X:142175980-142176002 CTGTCTGGACAGGTGAGGGAGGG - Intergenic
1198962433 X:142196209-142196231 CTGTCTGGACAGAAGAGGGAGGG - Intergenic
1198963632 X:142206038-142206060 CTGTCTGGACAGGAGAAGGAAGG - Intergenic
1199035121 X:143041195-143041217 CTGTTTCCTCACTTGAAGGATGG + Intergenic
1200614286 Y:5360068-5360090 TTTTTTGGTGAGAGGAAGGAAGG + Intronic
1201725297 Y:17143706-17143728 CTGATTGGTCAGGTTAGGGACGG - Intergenic